HOW WE CAN SEPRATE HYDROGEN AND OXYGEN ? ​

More than half of the population has the central skin pigmentation. The lightest and the darkest skin pigmentations are equally common in the population.

Skin, hair, and eye pigmentation differs between and among human populations. Many candidate gene and numerous genome-wide association studies have sought to identify the genes and alleles responsible for this variation (GWAS). Up until now, the majority of GWAS for pigmentary features have relied on categorical scales and subjective phenotypes.

However, the color of the skin, hair, and eyes varies constantly. Here, we aim to identify the genetic basis of the quantitative variance in these qualities and to characterize it objectively and properly. Reflectance or digital spectroscopy were used to evaluate the skin, hair, and eye colors of Europeans from Ireland, Poland, Italy, and Portugal. 176 women participated in a GWAS across 313,763 SNP sites for the three quantitative pigmentation traits.

To know more about variation :

https://brainly.com/question/3410561.

#SPJ4

Answer:

Mitosis cell division--- 46 chromosomes.

Meiosis cell division--- 23 chromosomes.

Explanation:

If the cell division occurs and the daughter cells formed with 46 number of chromosomes each so this is mitosis cell division because both the daughter cells receives double number of chromosome whereas, if the cell division happens and the daughter cells formed with 23 number of chromosomes each so this is meiosis cell division because all the daughter cells receives half number of chromosome.

During prophase, the chromosomes shorten and thicken. Chromosomes align in the cell's middle during metaphase. During anaphase, chromatids split apart at the centromere and go to opposing poles. After each chromosomal group's nuclear envelopes have been rebuilt, the telophase is when two nuclei are formed.

The duplicated genetic information found in a parent cell's nucleus is divided into two identical daughter cells during the fourth stage of mitosis, referred to as anaphase.

During telophase, the chromosomes begin to decondense, the spindle disintegrates, and the nuclear membranes and nucleoli reorganize. Each of the two daughter cells produced by the mother cell's cytoplasm splitting contains the same amount and kind of chromosomes.

Various chromosomes are frequently scattered all across the cell nucleus. While the cell's nucleus disintegrates during metaphase, the chromosomes of the cell condense and move near one another, aligning in the middle of the dividing cell.

Learn more about mitosis refer

https://brainly.com/question/19058180

#SPJ1

Answer:

option A is correct that is 12

Explanation:

meiosis occur in two phases in first phase DNA replication occur and amount of DNA become doubled without any change in the chromosome number and two daughter cell (each 2 n)are formed.

now in stage 2 each daughter cell undergoes mitosis with the formation of two cells with half chromosomes(n)

now 2n=24

n=24/2 =12

after meiosis stage 1...........two daughter cell each with  24 chromosomes

stage 2 .............each daughter cell form two grand daughter cell each with 12 chromosomes

net result.......4 daughter cell each with 12  chromosome(assuming cell as a diploid cell)

If a cell has 24 chromosomes before cell division then the daughter cell resulting from the mitotic division will have 24 chromosomes while the daughter cell resulting from the meiotic division will contain 12 chromosomes each.

The answer is option A.

There are sorts of cell departments: mitosis and meiosis. most of the time whilst humans discuss “cellular division,” they suggest mitosis, the procedure of making new frame cells. Meiosis is the sort of cell division that creates egg and sperm cells. Mitosis is an essential technique for lifestyles.

Learn more about mitosis and meiosis here: https://brainly.com/question/11842063

#SPJ2

The iodinated solutions move through the GI tract more quicker than the barium sulfate. It is because barium sulfate is a non-absorbable compound and is therefore not taken up by the body as quickly as iodinated solutions

Bаrium sulfаte moves through the gastrointestinal (GI) trаct slower thаn iodinаted solutions. This is becаuse bаrium sulfаte is а non-аbsorbаble compound аnd is therefore not tаken up by the body аs quickly аs iodinаted solutions. Аs а result, bаrium sulfаte is often used аs а contrаst аgent for imаging studies of the GI trаct becаuse it stаys in the trаct longer аnd provides better visuаlizаtion of the structures. Iodinаted solutions, on the other hаnd, аre more rаpidly аbsorbed аnd therefore move through the GI trаct more quickly.

For more information about the GI tract refers to the link: https://brainly.com/question/6423614

#SPJ11

Answer:

PLZ MARK AS BRAINIEST THANK AND FIVE STAR:)

1. Nucleotides are joined together by covalent bonds between the phosphate group of one nucleotide and the third carbon atom of the pentose sugar in the next nucleotide. This produces an alternating backbone of sugar - phosphate - sugar - phosphate all along the polynucleotide chain.

2. DNA replication is one of the most basic processes that occurs within a cell. Each time a cell divides, the two resulting daughter cells must contain exactly the same genetic information, or DNA, as the parent cell. To accomplish this, each strand of existing DNA acts as a template for replication.

3. Enzymes that participate in the eukaryotic DNA replication process include: DNA helicase - unwinds and separates double stranded DNA as it moves along the DNA. It forms the replication fork by breaking hydrogen bonds between nucleotide pairs in DNA. DNA primase - a type of RNA polymerase that generates RNA primers.

4. Chargaff's rules state that DNA from any species of any organism should have a 1:1 stoichiometric ratio (base pair rule) of purine and pyrimidine bases (i.e., A+G=T+C) and, more specifically, that the amount of guanine should be equal to cytosine and the amount of adenine should be equal to thymine.

5. RNA plays a central role in turning genetic information into your body's proteins. This remarkable molecule also carries the genetic instructions for many viruses, and it may have helped life get its start.

6. the three main structural differences between RNA and DNA are as follows: RNA is single-stranded while DNA is double-stranded. RNA contains uracil while DNA contains thymine. RNA has the sugar ribose while DNA has the sugar deoxyribose.

7. Of the many types of RNA, the three most well-known and most commonly studied are messenger RNA (mRNA), transfer RNA (tRNA), and ribosomal RNA (rRNA), which are present in all organisms.

8. Transcription is the process by which the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA). DNA safely and stably stores genetic material in the nuclei of cells as a reference, or template.

9. A codon is a sequence of three DNA or RNA nucleotides that corresponds with a specific amino acid or stop signal during protein synthesis. DNA and RNA molecules are written in a language of four nucleotides; meanwhile, the language of proteins includes 20 amino acids.

10. Translation is the process of translating the sequence of a messenger RNA (mRNA) molecule to a sequence of amino acids during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding amino acid sequence that it encodes.

11. Messenger RNA (mRNA) molecules carry the coding sequences for protein synthesis and are called transcripts; ribosomal RNA (rRNA) molecules form the core of a cell's ribosomes (the structures in which protein synthesis takes place); and transfer RNA (tRNA) molecules carry amino acids to the ribosomes during protein.

12. A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during cell division, exposure to ionizing radiation, exposure to chemicals called mutagens, or infection by viruses.

13. A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is copied or as the result of environmental factors such as UV light and cigarette smoke. Mutations can occur during DNA replication if errors are made and not corrected in time.

14. There are three types of DNA Mutations: base substitutions, deletions and insertions. Single base substitutions are called point mutations, recall the point mutation Glu -----> Val which causes sickle-cell disease. Point mutations are the most common type of mutation and there are two types.

15. By changing a gene's instructions for making a protein, a mutation can cause the protein to malfunction or to be missing entirely. When a mutation alters a protein that plays a critical role in the body, it can disrupt normal development or cause a medical condition.

16. Cancer refers to any one of a large number of diseases characterized by the development of abnormal cells that divide uncontrollably and have the ability to infiltrate and destroy normal body tissue. Cancer often has the ability to spread throughout your body. Cancer is the second-leading cause of death in the world.

PLZ MARK AS BRAINIEST THANK AND FIVE STAR:)

HOPE THIS HELPS:)

Our lungs also increase in size during exercise. This is so that your body can bring in more oxygen and get rid of the extra carbon dioxide that has built up in the blood. These two processes in one of the many ways that the respiratory and circulatory systems work together to achieve homeostasis during exercise.

To maintain homeostasis, your body redistributes blood flow. During exercise, blood flow to the nervous system, gastrointestinal tract, kidneys, brain and spleen decreases, while blood flow to the musculoskeletal system increases. Metabolic processes generate heat.

Learn more about homeostasis here: https://brainly.com/question/1046675

#SPJ2

a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.

However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).

Therefore, the sequence o mRNA read in the 5' to 3' direction is:

5' CUAUGGAAACACAUCAGUAGAA 3'

b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.

The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.

The codons, then will be:

AUG GAA ACA CAU CAG UAG

Then, we can say that the amino acids translated will be:

Met Glu Thr His Gln

(Methionine - Glutamine - Threonine - Histidine - Glutamine

c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.

Answer:

Testable

Explanation:

Hypothesis is a tentative idea that may prove to be the answer for problem so it may be testable

PLEASE MARK ME BRAINLIEST IF MY ANSWER IS CORRECT PLEASE

Answer:

testable

Explanation:

Answer:

As drogas diuréticas ajudam os rins a aumentar a quantidade de sal e urina removida na urina. Isso é pertinente porque o excesso de sal no corpo pode levar ao aumento da pressão nos vasos sanguíneos. O excesso de líquido não necessário ao organismo é assim removido. Esses medicamentos tornam-se eficazes dentro de 2 horas após a ingestão. Um exemplo típico é a clortalidona.

Based on the materials of the course, it is more likely to make human immunodeficiency virus (HIV) vaccination mandatory for the housekeeping staff is the correct statement. OSHA stands for Occupational Safety and Health Administration. Option A is correct

OSHA is the United States federal agency that is in charge of enforcing laws that deal with workplace safety, health, and occupational health. OSHA was established in 1971, and its primary mission is to ensure that employers are providing their employees with a safe and healthy working environment. OSHA has a wide range of regulatory powers that are used to ensure that employers are in compliance with the laws and regulations that deal with workplace safety and health.

Human immunodeficiency virus (HIV) vaccination is significant as HIV is a virus that damages the immune system, which is responsible for defending the body against illness. Without proper treatment, HIV can develop into acquired immunodeficiency syndrome (AIDS).There is currently no cure for HIV, but antiretroviral therapy (ART) is a treatment that can help manage the virus.

Vaccinations for Hepatitis B and HIV are now available to employees who work in settings where they may be exposed to infectious diseases. These vaccines can help reduce the risk of exposure to infectious diseases in the workplace. Therefore, it is more likely to make human immunodeficiency virus (HIV) vaccination mandatory for the housekeeping staff. Option A is correct

For more such questions on OSHA

https://brainly.com/question/29545254

#SPJ8

Ecosystem services is an example of how nature contributes to the supply of clean water. Ecosystem services are benefits that people obtain from ecosystems. They are distinguished into four categories: provisioning, regulating, cultural, and supporting services.

Ecosystem services include the provision of clean air and water, the pollination of crops, the mitigation of natural disasters, and the provision of recreational opportunities. Nature provides a variety of ecosystem services that are essential to human well-being. The supply of clean water is an example of ecosystem services. The water we drink comes from rivers, lakes, and underground aquifers that are replenished by rain and snowmelt.

These freshwater ecosystems not only provide us with water but also with food, fiber, and recreation opportunities. That nature contributes to the supply of clean water is an example of ecosystem services. Ecosystem services are benefits that people obtain from ecosystems.

The supply of clean water is one such service provided by nature, and it is essential for human well-being. The water we drink comes from rivers, lakes, and underground aquifers that are replenished by rain and snowmelt. These freshwater ecosystems not only provide us with water but also with food, fiber, and recreation opportunities.

To know more about Ecosystem, refer

https://brainly.com/question/842527

#SPJ11

The example of human genetic mutation and selection resulting from the Neolithic Revolution is the permanent "switch-on" of the lactase gene, prevalent in some populations, which allows humans to digest milk beyond weaning from breastmilk.

During the Neolithic Revolution, humans transitioned from a nomadic hunter-gatherer lifestyle to settled farming communities. This shift brought about significant changes in human behavior, including the domestication of animals for agriculture. One consequence of this transition was the development of the ability to digest milk in adulthood, known as lactase persistence.

Lactase persistence is the result of a genetic mutation that allows the lactase gene, which produces the enzyme lactase necessary for digesting lactose in milk, to remain active into adulthood. In most mammals, including our ancestors, the lactase gene switches off after weaning, making them lactose intolerant. However, in certain populations that have a long history of dairy farming, such as Europeans, some African and Middle Eastern communities, the lactase gene remains active throughout life.

This genetic mutation and subsequent selection were advantageous in societies that relied on dairy farming, as it provided a valuable source of nutrition and calories. Individuals with the lactase persistence mutation could continue to digest milk and its products, giving them a survival advantage. Over generations, this genetic trait became more prevalent in populations with a history of dairy farming, demonstrating the influence of human genetic mutation and selection resulting from the Neolithic Revolution.

Learn more about genetic mutation

brainly.com/question/793485

#SPJ11

Strip mining is more harmful to the environment than shaft mining, but less safe to miners.

The main impacts of mining are:

So in this case, Strip mining is more harmful to the environment than shaft mining, but less safe to miners.

See more about mining at brainly.com/question/14277327

#SPJ1

Aquatic plants and phytoplankton benefit from higher phosphorus concentrations. For herbivorous and omnivorous fish, this means more micronutrients in the near term.

One of the three primary nutrients that are most frequently utilized in fertilizers is phosphorous, which is produced by processing phosphate rock (the other two are nitrogen and potassium). Acid, that is used in everything including food and cosmetics to pet food and electronics, may also be made from phosphoric acid.

Bone and teeth are formed with the help of phosphate. Additionally, phosphorus is a component of a number of essential compounds, such as those that the cell uses for DNA, cell membranes, and energy (deoxyribonucleic acid). Phosphorus is a mineral that the body gets from food and excretes in urine and occasionally stool.

To know more about phosphate visit:

https://brainly.com/question/19826184

#SPJ4

Answer:

is A

I took the test

The Triassic period is the longest geological period and the Mesozoic era's smallest. The Cambrian period precedes the Triassic period.

The Triassic era started 250-200 million years ago, following the greatest and most drastic widespread destruction ever.

It is recognized for the progression of Dinosaurs on land, flying pterosaurs, and swimming plesiosaurs as well as ichthyosaurs during the first Mesozoic period.

The Cambrian period is the most critical occasion of the Paleozoic era due to the presence of many animals.

During this time, the Earth's natural temperature is raised and the ice sheets started to melt at an alarming rate, causing widespread death and destruction.

Thus, the correct option is 1.

For more details regarding Triassic period, visit:

https://brainly.com/question/9870817

#SPJ6

Vibrio vulnificus is a particularly pathogenic strain of bacteria due to its ability to hide its surface molecules behind a polysaccharide coat. This prevents interactions with pattern recognition receptors (PRRs) on phagocytic cells, which can make it difficult for the immune system to recognize and eliminate the bacteria.

However, antibodies can be employed to target and eliminate Vibrio vulnificus even in the absence of complement proteins. The following flow chart illustrates how this process could work:

1. Antibodies bind to surface molecules on Vibrio vulnificus.
2. The antibodies mark the bacteria for destruction by immune cells.
3. Phagocytic cells recognize the marked bacteria and engulf them.
4. The engulfed bacteria are destroyed by lysosomal enzymes within the phagocytic cells.

This process is known as antibody-mediated phagocytosis and is an important mechanism for eliminating pathogenic bacteria. By targeting surface molecules on Vibrio vulnificus, antibodies can help the immune system overcome the challenge posed by the polysaccharide coat and eliminate the bacteria.

To Know more about antibodies visit:

brainly.com/question/27931383

#SPJ11

Explanation:

Answer:

For plants to perform photosynthesis they require light energy from the sun, water and carbon dioxide.

Answer:

yes plants require sunlight , water and carbondioxide for photosynthesis. So they are important for plants

Answer:

like DNA, RNA is made up of nucleotides.There are two differences that distinguish DNA from RNA: (a) RNA contains the sugar ribose, while DNA contains the slightly different sugar deoxyribose (a type of ribose that lacks one oxygen atom), and (b) RNA has the nucleobase uracil while DNA contains thymine.

Explanation:

hope this helps :)

If you were looking at a frog's lifecycle, you would find more specialized cells in the adult frog stage (option b).

In a frog's lifecycle, the adult frog stage is where you would find more specialized cells. This stage occurs after the frog has gone through various developmental stages, starting from the beginning ball of cells.

1. The beginning ball of cells: This is the initial stage of a frog's development. It starts with the fertilization of the egg and the formation of a zygote. At this stage, the cells are not yet specialized and are in the process of dividing and multiplying.

2. Developing tadpole: After the beginning ball of cells, the zygote undergoes further development and transforms into a tadpole. The tadpole stage is characterized by the presence of gills and a tail. The cells in this stage are becoming more specialized but are still relatively unspecialized compared to the adult frog stage.

3. Adult frog: The adult frog stage is the final stage of the lifecycle. At this point, the tadpole has undergone metamorphosis and has transformed into a fully developed frog. In this stage, the cells have become highly specialized to perform specific functions necessary for the frog's survival, such as muscle cells, nerve cells, and specialized organs like the heart and lungs.

4. The same amount at all stages: It is not accurate to say that there is the same amount of specialized cells at all stages of the frog's lifecycle. As the frog develops and goes through metamorphosis, the cells differentiate and specialize to fulfill specific roles and functions required for each stage of development. The highest concentration of specialized cells is found in the adult frog stage.

For more such questions on cells, click on:

https://brainly.com/question/13920046

#SPJ8

Living organisms can be used to reduce environmental carbon through processes such as photosynthesis.

Every green organism containing chlorophyll and various plants performs photosynthesis. Plants constantly exchange carbon with the atmosphere. Plants absorb carbon dioxide during photosynthesis and much of its CO₂ is stored in roots, grasslands, and forests.

During photosynthesis, plants take in simple raw materials such as carbon dioxide and water and convert them to complex substances such as carbohydrates.

Oxygen is also released during this process as a by-product. In this way, Oxygen is released into the atmosphere, and carbon dioxide is taken in from the atmosphere.

Though the decomposition of plants again leads to the release of carbon into the environment. Also, other living things such as humans and animals take in plants and trap the carbon content which is again released back into the environment through excretion and respiration.

Thus, it's a balanced cycle in the ecosystem. So carbon can be reduced through photosynthesis performed by plants.

To know more about carbon:

https://brainly.com/question/29764662

Answer:

These names are important because they allow people throughout the world to communicate unambiguously about animal species.

Answer:

ç.

Explanation:

please click the heart and rate excellent and brainleist to

Variations in the composition of the extracellular matrix, determines the properties of the connective tissue. For example, if the matrix is calcified, it can form bone or teeth. Specialised forms of extracellular matrix also makes up tendons, cartilage, and the cornea of the eye.

Please tell me if i am wrong. Hope this helped!

The properties of certain tissues, particularly connective tissues, are determined by the extracellular matrix (ECM). The ECM is a network of proteins and other molecules that surrounds and supports the cells in the tissue.

The ECM determines the strength, flexibility, and other properties of the tissue. The ECM is composed of three main types of proteins: collagen, elastin, and glycosaminoglycans.

Collagen is the most abundant protein in the ECM. It is a strong, flexible protein that gives tissues their tensile strength.

Elastin is a protein that gives tissues their elasticity. It is a rubber-like protein that allows tissues to stretch and return to their original shape.

Glycosaminoglycans are long, sugar-like molecules that give tissues their viscosity. They help to keep tissues hydrated and prevent them from sticking to each other.

The ECM is also home to a variety of other molecules, including growth factors, cytokines, and adhesion molecules. These molecules play a role in the development, maintenance, and repair of tissues.

To know more about extracellular matrix:

https://brainly.com/question/30701384

#SPJ7

The demonstration shows how the distance between electric charges affects the strength of the electric force between them. This is due to the fact that the electric force depends on both the magnitude of the charges and the distance between them.

Electric charges are the fundamental property of matter, and they can either be positive or negative. Like charges repel each other, while opposite charges attract each other. Electric fields are the regions in which these charges exert a force on each other. The electric field is created by a charged object and is the force experienced by a charge placed in that field. The electric force is the force that charged objects exert on each other. This force depends on the magnitude of the charges and the distance between them. The closer the charges are, the stronger the electric force is between them. As the distance between charges increases, the electric force between them decreases. In my demonstration, I showed two objects with different electric charges. The objects were initially close to each other, and they exerted a strong electric force on each other. As I moved one of the objects away, the electric force between them decreased because the distance between them increased. This decrease in force shows the effect of distance on electric forces.
for more questions on charges

https://brainly.com/question/30413594

#SPJ11

Answer:

Please find the explanation of the four possible exceptions to Mendelian genetics below.

Explanation:

Genetics, generally, has to do with how genes are inherited or transferred from parents to offsprings. Gregor Mendel, however, explained this concept in his principles of inheritance called Mendelian genetics. There are, however, exceptions to this mendelian principle called Non-mendelian pattern of inheritance i.e patterns of inheritance that do not follow Mendel's principles. Four of them are explained below:

- Incomplete dominance- This non-mendelian inheritance pattern occurs when one allele of a gene does not completely mask its allelic pair, but instead forms an intermediate phenotype. This is in contrast with Mendelian genetics that proposes complete dominance. For example, a red and white flower produce a pink flower (intermediate).

- Codominance- This is another non-mendelian inheritance where two alleles of a gene are simultaneously expressed. For example, roan cattles is a combination of both red and white hairs.

- Multiple alleles: Some traits in a population are controlled by more than two alleles, as explained in mendelian inheritance. Examples of trait controlled by multiple alleles is height in humans.

- Sex-linked inheritance: Some traits are controlled by genes on sex chromosomes i.e. X and Y chromosomes. This genes exhibit inheritance pattern that are different from Mendel's. Example is haemophilia disease controlled by an affected gene on the X-chromosome.

Answer:an increase in oil drilling would increase the risk of pollution.

Explanation:

took the test 100 on it ‍♂️

Answer:

Light bounces off a white cement sidewalk.

Answer:

the answer is B

Explanation: