How can you distinguish the head of an earthworm from the tail?

Answers

Answer 1

The head and tail of an earthworm can be distinguished by several anatomical features: Size and Shape: The head of an earthworm is usually smaller and more pointed compared to the tail.

The tail is generally thicker and more rounded. Setae: Earthworms have small bristle-like structures called setae on their body segments, which help them move and burrow through the soil. The setae are typically more numerous and longer on the tail end compared to the head end.

Mouth Opening: The mouth of an earthworm is located on the underside of the head, and it is surrounded by a fleshy lobe known as the prostomium. The prostomium is typically larger and more prominent compared to the tail end, which lacks a distinct mouth opening.

Reproductive Structures: In some earthworm species, the tail end may have a genital pore,

Learn more about   earthworm   here:

https://brainly.com/question/28690031

#SPJ11


Related Questions

HELP I WILL GIVE U 50 points
Which characteristics of rocks are used in classification? Check all that apply.

origin
texture
composition
weight
age

Answers

Texture composition

HELP PLEASE
Describe the life cycle of a mollusk.​

Answers

A diverse group of invertebrates called mollusks have a life cycle that has numerous stages: egg, larva, juvenile, adult, reproductive phase and senescent phase.  

Adult mollusks lay eggs, which is often how it begins. These eggs develop into larvae that may or may not be able to move about freely. The larva enters a juvenile stage as it matures and expands, during which its anatomy and behavior undergo considerable changes. The juvenile snail develops into an adult mollusk once it is fully grown.

Mollusks reproduce sexually after they reach adulthood, with men and females often releasing gametes into the soil or water. Some species may also exhibit intricate courtship rituals or possess uniquely designed reproductive organs. Senescence, which might include a loss in physical function, reproductive ability, or other aspects of mollusks' ability to reproduce, occurs when they near the end of their lifespan.

To know more about the life cycle of a mollusk, refer:

https://brainly.com/question/14787680

#SPJ1

If the results of an experiment are considered valid they will? A. Give the same nontestable results B. Give The same outcome when repeated C. Give different outcomes in different parts of the world D. give different results from repeated by different scientist

Answers

Answer:B

Explanation:

If it's valid, then it has substantial evidence to back up the results, which will  be the same over and over again.

Some owls produce 2 pellets per day. Assume each pellet
represents 80g of biomass. Also assume that one 40g vole can cause 50 cents of crop damage to a farm per season. If a barn owl family of seven (2 adults[producing 2 pellets/day] and 5 young [producing 1 pellet/day]) lives on a farm for 12 weeks and feeds exclusively on voles, how much will the farmer save in crop damages over the course of a season?

Answers

Answer:

I'm in fifth grade

Explanation:

I'm just 10 sorry just started

on this app

What contribution did Thompson add to the understanding of the atom?
a
Discovered that electrons orbit the nucleus. B
Discovered the nucleus of the atom using the Gold Foil experiment
c
Reasoned that atoms are indivisible. D
Discovered a subatomic particle (protons or, neutrons or , electrons)

Answers

The contribution that thompson did add to the understanding of the atom was that he Discovered that electrons orbit the nucleus.That is option A.

What is an atom?

An atom is defined as the smallest indivisible part of an element that is made up of central nucleus with electrons that revolves round about it.

There are various scientist that contributed towards the study and understanding of atoms and they include the following:

Democritus, John Dalton, J.J. Thomson, Ernest Rutherford, Niels Bohr, Robert Millikan and Irwin Schrodinger.

Joseph John Thompson or J.J. Thomson in 1879 proposed the existence of electrons that revolves round the nucleus of an atom.

Learn more about atom here:

https://brainly.com/question/26226232

#SPJ1

Which is an example of a decomposer?
A a hawk
B a mouse
C a flower
D a mushroom

Answers

D a mushroom is the right answer fungi are types of decomposers and mushrooms are fungi

Answer:

D, a mushroom

Explanation:

i had the same question and got it right ;)

which of the following is an age indicator for adults? group of answer choices dental development epiphyseal fusion pubic symphysis morphology all of the above

Answers

The correct answer is "All of the Above". All four indicators (dental development, epiphyseal fusion, pubic symphysis morphology, and all of the above) are age indicators for adults.

Age indicators for adults:

Dental development: The development and eruption of teeth can be used to estimate age in adults, as tooth formation and eruption follow a specific pattern and timeline. Epiphyseal fusion: The fusion of epiphyses (end part of long bones) to the diaphysis (shaft) of the bone can also be used to estimate age in adults, as it occurs in a predictable manner. Pubic symphysis morphology: The morphology (shape) of the pubic symphysis (a joint between the two halves of the pelvis) can also be used to estimate age in adults, as it undergoes changes with increasing age.

Learn more about adults: https://brainly.com/question/1488186

#SPJ11

Does anyone have an answer to why my heart physically hurts

Answers

Answer:

I'm dead

Explanation:

that's sad

Remember what you learned about the South American plate. What
is the relative motion between this plate and the plates on the east
and west sides?

Answers

The relative motion between the South American and Nazca plates is generally characterized by subduction of the Nazca plate beneath the South American plate along the Peru-Chile Trench, which has caused a number of large earthquakes and volcanic eruptions in the region.

What is an earthquake?

An earthquake is a sudden and violent shaking of the ground caused by the movement of tectonic plates in the Earth's crust.

A volcanic eruption is an event in which molten rock, ash, and gas are expelled from a volcano, typically accompanied by a range of explosive and non-explosive processes.

The South American plate is bordered by the Nazca plate to the west and the African and Antarctic plates to the east.

The relative motion between the South American and Nazca plates is generally characterized by subduction of the Nazca plate beneath the South American plate along the Peru-Chile Trench, which has caused a number of large earthquakes and volcanic eruptions in the region.

The relative motion between the South American and African/Antarctic plates is generally characterized by divergence, with the Mid-Atlantic Ridge marking the boundary between these plates.

Learn more on volcanic eruption here https://brainly.com/question/25121802

#SPJ1

evolutionary ideas of Lamarck and Darwin (research work)

Answers

Answer:

Lamarck's transmutation theory established the foundation of an evolutionary model introducing a new way to research in nature. Darwin's selection theory was proposed in 1859 to explain the origin of species within this epistemological process.

Explanation:

If an organism that is homozygous dominant is crossed with a heterozygote for that trait, the offspring will be __________.

Answers

Answer: all of the dominant phenotype

The offspring of an AA x Aa cross are either AA or Aa. All will express the dominant phenotype.

If an organism that is purebred dominant is crossed with one that is heterozygous for a trait, half of the offspring will be purebred dominant and the other half will be heterozygous.

What is dominance?

If the allele of a gene is completely showing its character in a heterozygous condition, then it is called "completely dominant." Another allele of the gene that can't be expressed is called recessive.

An example is the cross made between purebred tall (TT) and heterozygous tall (Tt). The purebred will form gametes T, and the heterozygous will form gametes T and t.

From the cross, two genotypes, such as TT and Tt, are developed, each having 50%. All the F1 offspring here are tall in phenotype. All tall and short characters are expressed when the two heterozygous Tt and Tt are crossed.

Hence, if an organism that is purebred dominant is crossed with one that is heterozygous for a trait, half of the offspring will be purebred dominant and the other half will be heterozygous.

Learn more about the dominance, here

https://brainly.com/question/14053639

#SPJ2

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.b) Circle the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. Use the mRNA codon table provided.c) Where in the cell do transcription and translation occur?

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write

Answers

a) In order to transcribe the segment of DNA, it is important to note that this process is important for gene expression as a protein. An enzyme called RNA polymerase moves along the DNA until the end of the gene, releasing the mRNA. The DNA has two strands: one that goes from 5' to 3' direction, and another one that goes from 3' to 5' direction. The one that's used for transcription will always be the 3' to 5' one, so we already have the correct strand to work with, as it is a 3' to 5' strand.

However, the mRNA will be assembled in the 5' to 3' direction. Using the same complementary base-pairing rules as in DNA, we will pair Cytosine (C) with Guanine (G), but as there is no Thymine (T) in RNA, we will pair Adenine (A) with Uracil (U).

Therefore, the sequence o mRNA read in the 5' to 3' direction is:

5' CUAUGGAAACACAUCAGUAGAA 3'

b) The starter codon is the AUG codon of a messenger RNA (mRNA). Therefore, the sequence of amino acids will start to be decoded there.

The stopper codon can be one of the three following options: UAA, UAG or UGA. In this case, we can only find the UAG codon.

The codons, then will be:

AUG GAA ACA CAU CAG UAG

Then, we can say that the amino acids translated will be:

Met Glu Thr His Gln

(Methionine - Glutamine - Threonine - Histidine - Glutamine

c) In eukaryotes, transcription occurs inside the nucleus of the cell and translation occurs in the cytoplasm.

Differentiate between primary and secondary lymphoid organ? Give two examples each for the Granulocyte, Agranulocyte and Fixed leukocytes.
Please answer this immunolgy question with explanation as soon as possible,You will get upvote sure for your proper answer.Thanks for your kind response

Answers

Answer:

Primary lymphoid organs are where lymphocytes are formed and mature. They provide an environment for stem cells to divide and mature into B- and T- cells. There are two primary lymphoid organs: the red bone marrow and the thymus gland.

Secondary lymphoid organs are where mature lymphocytes interact with antigens. They are responsible for the adaptive immune response, which is the body's ability to remember and respond to specific antigens. Examples of secondary lymphoid organs include lymph nodes, the spleen, and the tonsils.

Granulocytes are white blood cells that have granules in their cytoplasm. They are the first line of defense against infection. Neutrophils are the most common type of granulocyte. They are phagocytic, meaning they can engulf and destroy bacteria. Eosinophils are involved in allergic reactions and parasitic infections.

 - Neutrophils: These are the most common type of white blood cell, and they play a major role in fighting infections.

- Eosinophils: These cells help to fight parasites and allergic reactions.

Agranulocytes do not have granules in their cytoplasm. Lymphocytes are a type of agranulocyte that are involved in the adaptive immune response. They can be divided into B cells and T cells. B cells produce antibodies, which are proteins that can bind to and neutralize bacteria and viruses. T cells help to regulate the immune response and kill infected cells.

- Lymphocytes: These cells are involved in the immune system, and they produce antibodies.

- Monocytes: These cells mature into macrophages, which are large cells that engulf and destroy bacteria and other foreign substances.

Fixed leukocytes are white blood cells that are permanently located in tissues. Macrophages are a type of fixed leukocyte that phagocytose foreign particles and debris. Dendritic cells are a type of fixed leukocyte that present antigens to lymphocytes.

- Dendritic cells: These cells are found in the skin and other tissues, and they help to present antigens to lymphocytes.

- Mast cells: These cells are found in the tissues, and they release histamine and other chemicals in response to allergens or other triggers.

HELP ASAP!!!!!!!!!!!!!!!!!!!!!!!


NASA has launched many space explorations and space telescopes. How has the launch of the Hubble Space Telescope contributed to our understanding of space?

Answers

Answer:

Pictures from Hubble help scientists learn more about the whole universe.

Explanation:

Hubble has helped scientists learn about our solar system. The telescope observes comets and planets. Hubble even discovered moons around Pluto that had not been seen before. The telescope has helped scientists understand how planets and galaxies form. Galaxies contain billions of stars. A picture called "Hubble Ultra Deep Field" shows some of the farthest galaxies ever seen.  Because of Hubble pictures, scientists think the universe is almost 14 billion years old.

without carbon dioxide and food, cells cannot create atp to power life processes

Answers

Answer:

True

Explanation:

ATP is produced during the cellular respiration process. Carbon dioxide and Atp are two important components of cellular respiration.  The process of cellular respiration involves:

glucose + oxygen => carbon dioxide + water

Where glucose is present in food and convert into carbon dioxide and water. During cellular respiration, glucose is transferred to ATP and releases carbon dioxide and water. Without food, no glucose will be present and carbon dioxide releases as a byproduct.

Hence, carbon dioxide and food, are mandatory to create ATP to power life processes.

In hominin evolution, the usual temporal sequence is, in general ______.

Answers

These hominins emerged around 1.9 million years ago and had a widespread distribution.

Which hominin species exhibited a mix of ape-like and human-like characteristics?

In hominin evolution, the usual temporal sequence is, in general, as follows:

Ardipithecus: These early hominins appeared around 4.4 million years ago in Africa. They were bipedal but still retained some primitive ape-like features.

Australopithecus: The Australopithecus genus emerged around 4 to 2 million years ago. These hominins showed significant adaptations to bipedalism and exhibited a mix of ape-like and human-like characteristics.

Paranthropus: Around 2.7 to 1.2 million years ago, Paranthropus hominins coexisted with early Homo species. Paranthropus species had robust cranial features and specialized dentition, indicating adaptations to a vegetarian diet.

Homo habilis: This early Homo species appeared approximately 2.4 to 1.4 million years ago. Homo habilis is known for its increased brain size and the use of stone tools.

Homo erectus: These hominins emerged around 1.9 million years ago and had a widespread distribution. They were the first hominins to leave Africa and colonize other parts of the world.

Homo heidelbergensis: This hominin species appeared around 700,000 to 300,000 years ago and exhibited advanced tool-making abilities.

Homo neanderthalensis: Neanderthals existed from approximately 400,000 to 40,000 years ago in Europe and parts of Asia. They had a robust physique and made complex tools.

Homo sapiens: Modern humans, Homo sapiens, emerged around 300,000 to 200,000 years ago and are the only surviving species of hominins. They possess sophisticated culture, language, and advanced cognitive abilities.

It's important to note that the evolutionary sequence may not be strictly linear, and there were likely overlapping periods and regional variations in hominin evolution.

Learn more about hominins

brainly.com/question/32198556

#SPJ11

Name the described body systems and fill in the missing information. [30 points] :)

Name the described body systems and fill in the missing information. [30 points] :)

Answers

Answer:

The skeletal system and the muscular system

Explanation:

our organs and provides fatme to help the body keep its shape .It also stores important substance such as WBCs to give it strength.

Which molecule below is BEST described as energy rich because of the amount of energy that can be stored in it and released from it?

A.
CO2

B.
ADP

C.
H2O

D.
C6H12O6

Answers

Answer:

C6H12O6 is best described as energy rich because of the amount of energy that can be stored in it and released from it

what is the supplement that is the highest priority specifically for stan’s case at this moment? A. fluoride B. iron C. vitamin b12 D. vitamin d
E. calcium

Answers

The supplement that is the highest priority specifically for Stan’s case at this moment is iron. The correct answer is option B.

Iron is a mineral essential for human growth and development. It is an essential part of hemoglobin, a protein found in red blood cells that carries oxygen from the lungs to the rest of the body. The human body also uses iron to form myoglobin, a protein that stores oxygen in muscle tissue.

Iron deficiency symptoms develop slowly and become more severe as the condition progresses. Iron is the supplement that is the highest priority specifically for Stan’s case at this moment. Because Stan is exhibiting signs of anemia, including shortness of breath, fatigue, and pale skin, a lack of iron may be the cause.

As a result, the addition of an iron supplement to his diet may assist him in regaining his energy, maintaining healthy red blood cell production, and preventing iron-deficiency anemia in the future. Therefore correct answer is option B

Know more about Iron deficiency here:

https://brainly.com/question/12503352

#SPJ11

A forest ecosystem has different levels of organization. Arrange the levels of organization of the ecosystem in order so the smallest level with the fewest living things is on the top.
community
ecosystem
population
organism

Answers

1.) organism (one living thing)

2.) population (a group of species)

3.) community (a group of a population that consists of two or more different species in a single place)

4.) ecosystem (all organisms in an environment that interact with each other, as well as its own populations)

A particular single celled organism is it radiant energy to fix carbon as yours does organism generate ATP by breaking down sugars through a process that uses oxygen based on this information how should this organism be classified

Answers

The autotrophs are the organisms that uses sunlight (radiant energy) to perform the process of photosynthesis to fix carbon in the form of sugars. They generate ATP by breaking down the sugar using oxygen, which means they perform cellular respiration. This makes the organism aerobic autotroph.

Hope this help :)

Answer:

The autotrophs are the organisms that uses sunlight (radiant energy) to perform the process of photosynthesis to fix carbon in the form of sugars. They generate ATP by breaking down the sugar using oxygen, which means they perform cellular respiration.

hope it helps

which set of data in the table below best represents molecules an animal will use as building blocks to grow and reproduce?

Answers

The set of data in the table below that best represents molecules an animal will use as building blocks to grow and reproduce is the "macromolecules" category, as these large molecules such as proteins, carbohydrates, and lipids are the basic blocks of growth and reproduction in animals.

In order for an animal to grow and reproduce, it requires building blocks, which are essentially molecules. The primary molecules that serve as building blocks include proteins (made up of amino acids), nucleic acids (DNA and RNA), carbohydrates, and lipids.

These molecules are essential for various functions such as cellular growth, energy production, and genetic inheritance. Please provide the table data for a more specific answer.

To know more about molecules visit:-

https://brainly.com/question/19922822

#SPJ11

The set of data that best represents molecules an animal will use as building blocks to grow and reproduce is the macromolecules category, specifically proteins, carbohydrates, and lipids.

These molecules provide the necessary energy and materials for growth and reproduction. Proteins are essential for building and repairing tissues, while carbohydrates provide energy for cellular processes. Lipids are important for cell membrane structure and also provide energy storage.

                                It is important to note that all macromolecules play a role in the functioning of living organisms, but these three categories are particularly important for growth and reproduction.
                              Molecules an animal will use as building blocks to grow and reproduce, I would need the table with the data sets to be provided.

Learn more about carbohydrates

brainly.com/question/29775112

#SPJ11

Which is the definition of the equator?

Answers

Answer:

The equator is an imaginary line that splits the earth into two sections, the north and south hemispheres. The closer you are to the equator, the more hot it is.

The equator is an imaginary line that circles the Earth around its midpoint and is equidistant from the North Pole and the South Pole. It is defined as the line of 0 degrees latitude and is the reference point for all other latitude measurements.

The equator divides the Earth into the Northern Hemisphere and the Southern Hemisphere. It is about 40,075 kilometers (24,901 miles) long and is located about 13 kilometers (8 miles) above the Earth's surface. The Earth rotates on its axis from west to east, with the equator being the point of maximum rotational speed. This causes the equator to experience the highest solar energy, the longest days, and the shortest nights of any location on Earth.

As a research scientist, you measure the amount of ATP and NADPH used by the Calvin cycle in 3 hours. You find 9,000 molecules of ATP used, but only 6,000 molecules of NADPH. Where did the extra ATP molecules come from

Answers

Answer:

The correct answer is - Cyclic flow.

Explanation:

Cyclic electrons flow pumps proton in the lumen of thylakoid towards the concentration with the help of ATP synthase. This movement produces additional ATP.

These additional ATPs are come from cyclic electron flow, during light reaction come from cyclic electron flow, during light reaction.

It's not A and I need a CER statement or just a normal expaination please

It's not A and I need a CER statement or just a normal expaination please

Answers

Answer:

c. Adding animal genes into a plant

Explanation:

Adding animal genes into a plant represents a modern biotechnology technique that raises potential ethical issues. This technique, called transgenic or genetic engineering, involves inserting genes from one organism into another to produce a desired trait. In the case of adding animal genes into a plant, this could involve creating crops that are more resistant to pests or herbicides, or that produce certain pharmaceuticals.

This technique raises ethical concerns because it involves manipulating the genetic makeup of living organisms, which could have unintended consequences for the environment or human health. For example, the introduction of a new gene into a plant could cause unintended effects, such as allergies or toxicity. There are also concerns about the potential for genetic engineering to be used for non-food purposes, such as creating designer pets or even humans with specific traits.

Crossbreeding two different plants, using bacteria in the making of food, and transferring blood from one person to another are all examples of techniques that have been used for centuries or even millennia and are generally considered to be safe and ethical. However, it is worth noting that any technique, including these examples, could raise ethical concerns if used in a particular way or context.

Caroline set up a fourth test tube that contained a leaf and was exposed to dim


light.




After two hours the colour of the indicator solution in this test tube remained orange.




Explain why.

(hydrogen carbonate indicator test)

Answers

Answer:

Answer

+ 5.0

Answer: The NEGATIVE CONTROL is the

test tube that is filled with ONLY distilled

water.

Explanation:

A negative control of an experiment is

carried out alongside the main primary

experiment except that the treatment is

changed to something that is predicted

to have no result. In the negative

control, the student does not expect any

response. This would help the student

compare the result of a new experiment

against an already known existing results.

Analysing the experiment carried out

by the student, She filled two test tubes

with distilled water and placed a piece

of Elodea in one of the tubes, leaving

the other without a plant. The other test

tube that contains only distilled water is

the negative control because she wasn't

expecting any result from it. It's also

served as a control sample to the primary

experiment. This is observed as she

blew in each tube to add carbon dioxide,

which caused the distilled water to

become more acidic. This would help the

student know that the that experimental

results are valid and to ensure that time is

saved


What is the term for a preserved footprint left behind by an animal?
O A. Embryo
O B. Code
O C. Fossil
O D. Isotope

Answers

Answer:

A fossil.

It would be C

It is C a fossil because it is imprinted into the ground and it has been covered and pressed in sediments preserving the footprint

1) What is the rationale for experimental ablation method?
2) Explain the significance of the sham-lesion procedure.
2a) Explain how the activity of a brain region can be temporarily inactivated.
4) Compare and contrast the visual functions of rods and cones.
4a) Explain how the receptor potential produced in a photoreceptor by light generates action potentials within the retina.
6) Compare the anatomy and function of the dorsal and ventral streams.
6a) Describe the physical and psychological properties of sound.
7) Describe how the organ of Corti transduces sound waves into electrical potentials.
7a) Describe the neural pathways by which auditory signals for audition reach the cortex.
8) Explain how the brain codes for the spatial location of sound.

Answers

1) The experimental ablation method is a way of demonstrating the function of a particular brain region by removing it or inactivating it temporarily or permanently.

2) The sham-lesion procedure involves a similar surgical procedure to that of an ablation but without damaging the target area.

2a) Inactivation of a brain region involves the use of a drug or some other agent to temporarily disable or block activity within a particular region of the brain.

4) Rod cells are the primary photoreceptors for low-light conditions and are found in the outermost layer of the retina

4a) The generation of action potentials in the retina begins when a photon of light strikes a photoreceptor cell.

6) The dorsal stream is responsible for processing the object's location and motion.

6a) Sound is a physical phenomenon that is produced by the vibration of an object.

7) The organ of Corti is the sensory organ in the inner ear that is responsible for transducing sound waves into electrical potentials.

7a) The neural pathways by which auditory signals for audition reach the cortex begin in the cochlea.

8) The brain codes for the spatial location of sound by using several cues, including interaural time differences, interaural level differences, and spectral cues.

1) The rationale for this technique is that by making an animal brain-damaged in some particular region, researchers can learn more about how that region is involved in behavior. The major advantage of experimental ablation is that researchers can gain insights into what a particular brain region does by examining how a damaged brain differs from a normal one.

2) The purpose of this procedure is to create a control group with identical surgery minus the removal or inactivation of the target region. This allows researchers to control for any nonspecific effects of the surgical process.

2a) For instance, the drug muscimol, which is a GABA agonist, can be used to temporarily inactivate a specific brain area by binding to GABA receptors in that area.

4)Cone cells are photoreceptors that are responsible for color vision, visual acuity, and are found in the center of the retina. Rods are more sensitive to light than cones, and they provide better vision in dim light, while cones provide better vision in bright light.

4)The resulting receptor potential then travels from the photoreceptor cell to the bipolar cell, where it is further amplified. The resulting signal is then transmitted to the ganglion cell, which generates an action potential.

6)It sends information from the occipital lobe to the parietal lobe. In contrast, the ventral stream processes object recognition, sending information from the occipital lobe to the temporal lobe.

6a)The sound waves are propagated through a medium such as air, water, or a solid. The psychological properties of sound include pitch, loudness, and timbre.

7)When the basilar membrane vibrates in response to sound waves, the hair cells in the organ of Corti are also set into motion, generating an electrical signal that is transmitted to the brain.

7a) The auditory nerve carries information from the cochlea to the brainstem, where it is processed and sent to the thalamus. From the thalamus, the information is relayed to the auditory cortex in the temporal lobe.

8)The auditory cortex integrates these different cues to determine the location of a sound in space.

Learn more about experimental ablation at

https://brainly.com/question/31435659

#SPJ11

How is secondary succession different from primary succession?

Select one:

Secondary succession occurs after a disturbance in an area that was
previously uninhabited.

Secondary succession occurs when animals are introduced to an area that
had only plants.

Secondary succession occurs after a disturbance in an area in which the soil
has remained intact.

Secondary succession occurs over a longer period of time than primary
succession.

Answers

Answer:

Secondary succession occurs after a disturbance in an area in which the soil

has remained intact.

during replication, and the
In a strand of DNA the sequence should read: TACGCGTCA. A mistake was made
sequence ended up reading TACGCCTCA. What kind of mutation was this?
LP
none of the above

deletion
substitution
insertion

Answers

Answer:

substitution

Explanation:

Theres still the same amount of letters and the letter turn into t or a so substitution is the answer.  

substitution

they substituted “G” for “C”
Other Questions
how to tell which planet on this chart has the most gravitational force f the spring constant is 200 n/m and applied force is -50 n, how much will the spring be stretched or displaced? There are four main types of macromolecules that are synthesized and used in the metabolic processes of living cells. Name the type of molecules that are built from amino acids in the ribosomes of eukaryotic cells. A. carbohydratesB. lipidsC. proteinsD. nucleic acids Let X be an unobserved random variable with E[X] Assume that we have observed Y, Y2, and Y3 given by Y = 2X + W, Y = X + W, Y3 = X + 2W3, where E[W] = E[W] = E[W3] = 0, Var(W) = 2, Var(W) = 5, and Var(W3) = 3. Assume that W, W2, W3, and X are independent random variables. Find the linear MMSE estimator of X, given Y, Y2, and Y3. Change to negative sentences and interrogative sentences.My sister and I go to the mountain this holiday.(-) : ___________(?) : ___________ 1. Write an equation to represent the distance (d) that a person can run in t hours if she runs at a speed of 4 miles per hour. 2. Write an equation to represent the total cost (c) of buying candy bars (b) at a cost of $0.98 per bar. If a teacher wants to buy 20 chocolate bars for her students, how much will she pay? 3. Write an equation to represent the number of lawns (l) mowed in d days by a company that mows 18 lawns per day. How many lawns does the company mow in 5 days? What are the 5 differences between plant and animal cells? the nurse anticipates that which type of medication will be prescribed for a patient diagnosed with pulmonary edema related to heart failure Jack has utility of U(x1, x2) = max{3x1 , 4x2} of purchasing products 1 and 2. Melis has an initial endowment of (1 ,2) = (40,40), and initial prices are 4 and 10 for products 1 and 2, respectively. When prices change and 4TL for both products, find the pure substitution, income and endowment effects for Jack. how many gigabytes are in a terabyte A company produces electric insulators. The strength of the insulators is important since a broken insulator may cause a short circuit. Unfortunately, the strength varies significantly due to the material. Because of the expense, only a limited number of insulators could be tested. The engineers sampled 25 insulators (From a production run of 200), and conducted a destructive test to determine the force that was required to break the insulators. The mean value of this force was 1723 lbf with a sample standard deviation of 90 lbf. You may approximate the population standard deviation with the sample standard deviation for the following questions. a. Determine if the population is large enough or if a finite population correction (FPC) factor is needed. If so, what is the FPC factor? b. For 95% confidence, determine the margin of error (+ lbf) c. For these conditions, estimate the range of the probable population mean. Provide lower and upper values. For 95% confidence, determine the margin of error ( Assume the same mean and sample standard deviation. What is one advantage and one disadvantage of using 50 insulators instead of 25 insulators? d. lbf) if 50 insulators were tested. what is ( H+) and (OH-) in a healthy person's blood that has a PH of 7.50 assume that the temperature of the blood is 298 K. What factor was most influential in shaping a discriminatory system of caste in india?. As a result of a thorough physical inventory, Sheridan Company determined that it had inventory worth $320800 at December 31, 2020. This count did not take into consideration the following facts: Herschel Consignment currently has goods worth $46300 on its sales floor that belong to Sheridan but are being sold on consignment by Herschel. The selling price of these goods is $74900. Sheridan purchased $22000 of goods that were shipped on December 27, FOB destination, that will be received by Sheridan on January 3. Determine the correct amount of inventory that Sheridan should report. What are the vertical and horizontal asymptotes of F x )= 3x 2 x 2 4? Evaluate 9 - 3 times 2 + 4.A 6B 7C 15D 16 Can someone plz help me with this one problem plz!! discuss the two main factors that determine what should be an adequate mix of generalists and specialists. Quadrilateral ABCD is a parallelogram. What is BC?Try to explain if you can! Thank you Which of the following attack frameworks illustrate that attacks are an integrated end-to- end process, and disrupting any one of the steps will interrupt the entire attack process? MITRE ATT&CK The Diamond Model of Intrusion Analysis Cyber Kill Chain Command and Control