How can risk factors for circulatory disease be controlled? Justify your answer

Answers

Answer 1

Answer:

eat healthydont do alchoholdont do smoking of any type (cigaretter, hookah, marihuana)be physically active lower your stress; dont be under pressure when you are causing itstay at a healthy and average weight (stay away for underweight and obesity)


Related Questions

Need help asap please :(

Need help asap please :(

Answers

Answer:

picture quality is low

Explanation:

write your question

The cosmic radiation provides direct evidence for the origin of

A The universe

B our solar system

C Earth’s ozone layer

D earths earliest atmosphere of

Answers

Universe

Explanation:

If I'm not mistaken the cosmic radiation contains the same material from billions of years ago after the big bang that proves evidence of the universe.

Answer: C

Explanation: i took the test

Explain why cancer is a disease of the cell cycle and explain what a tumor is.

Answers

Cancer is a disease of the cell cycle because it is characterized by abnormal and uncontrolled cell growth. The cell cycle is the process by which cells divide and replicate themselves in order to grow and repair tissues in the body.

Normally, the cell cycle is regulated by a complex network of signaling pathways and checkpoints that ensure that cells divide in a controlled and orderly manner. However, in cancer cells, this process becomes deregulated, and cells can divide and grow in an uncontrolled manner.

A tumor is a mass of abnormal cells that have grown out of control. Tumors can be benign, which means they are not cancerous and do not spread to other parts of the body, or malignant, which means they are cancerous and can spread to other parts of the body.

Benign tumors are usually not life-threatening, but malignant tumors can be very aggressive and can lead to serious health complications if not treated.

To learn more about cancer:

https://brainly.com/question/26059802

why is it critical for maintaining flux through the metabolic pathway that nadh be oxidized to nad , and (b) how is that done under anaerobic conditions in human cells?

Answers

Enables the energy-producing process by which NAD can move electrons from one reaction to another. Through a variety of metabolic processes, cells regenerate their energy when they are anaerobic.

NAD+ and NADH: What Function in Metabolism?

With the help of metabolic activities like glycolysis, the TCA cycle, and fatty acid oxidation (FAO), NAD+ gets hydride to create NADH, a crucial redox carrier. Because of this, NADH also contributes to the production of ROS and is a key hydride donor for ATP synthesis via mitochondrial OXPHOS.

What is NAD+? As to why it matters:

Every cell in your body contains NAD+, a vital coenzyme. It is crucial for the metabolic process and serves two primary purposes by converting nutrients into energy.

To know more about NAD+ visit:-

https://brainly.com/question/4221953

#SPJ4

what did charles Darwin and Alfred wallace propose

Answers

Answer:

"theory of evolution by natural selection,”

this was proposed by charles darwin and alfred wallace in the 19th century

“Which is one function of a protein marcomolecule?”
A. Insulating organs of the body
B. Carrying oxygen in the blood
C. Making up the code for living things
D. Providing waxy coating on leaves​

Answers

Answer:

Explanation:
i believe the answer is B
Carrying oxygen in the blood

Hope this helps:)

The ultimate goal of sustainable development is to __________. A) limit the future use of resources B) meet current and future resource needs C) increase the current use of resources D) reduce resource use but increase supplies E) manufacture synthetic products to replace depleted resources

Answers

Answer: B

Explanation:

Answer:

B.) Meet current and future resource needs.

Explanation:

Edge 2021 :)

In which order does fluid move through the nephron?i. Ascending limb of the loop of Henleii. Collecting ductiii. Descending limb of the loop of Henleiv. Distal convoluted tubule (DCT)

Answers

The order in which fluid move through the nephrons is

Glomerulus →Proximal convoluted tubule →Descending limb of nephron loop →Ascending limb of nephron loop →Distal convoluted tubule →Collecting duct.

The renal tubule is made up of the proximal (convoluted and straight segments), transitional, distal (straight and convoluted portions), CNT, and CD tubules. The proximal tubule's straight section, these thin descending and ascending limbs, and the creamy ascending limb—which also contains the macula densa—make up the Henle loop. The CNT connects the CD system to the nephron.

An epithelium, which is composed of a single layer of cells and is attached to the basement membrane, surrounds the renal tubules. The epithelial cells have several structural modifications and transport-related capabilities to suit their various jobs.

To know about nephron

https://brainly.com/question/12307837

#SPJ4

a scientist adds a retrograde marker to the neurons in the superior colliculus of a monkey. the marker labels cell bodies. in which layer of the visual cortex would the scientist expect to find the marker?

Answers

In the 5th layer of the visual cortex would the scientist expect to find the marker.

Do memories include the visual cortex?

Small receptive fields and responses to fundamental components of the visual scene are characteristics of primary visual cortex neurons. However, current research indicates that the primary visual cortex also contributes to cognitive functions including working memory and visual perception.

The visual cortex is the main part of the brain in charge of receiving, integrating, as well as processing visual information from the retinas. It is situated in the occipital lobe of the primary cerebral cortex, the most backward region of the brain.

Therefore, in the 5th layer of the visual cortex would the scientist expect to find the marker.


To know more about the visual cortex, click on https://brainly.com/question/4561290
#SPJ4

What are clastic rocks formed from?

A. fragments of minerals or rocks

B. heat and pressure applied to an existing rock

C. mineral grains that precipitate by evaporation or another type of chemical event

D. the remains of animals and plants

Answers

A- they are formed by previous rocks sticking together

What is a likely consequence of a mutation that prevents apoptosis?

A - tumor

B - a loss of amino acids

C - a lack of cell division

D - a reduction in chromosome number

Answers

Answer: I think it’s A if not than b

Explanation:

Since the process apoptosis deals with Cells , only the likely to affected is cancer and mutations can cause a tumor but also it will be the lack of proteins which includes animo acids not sure tho .

Mutation is defined as the alteration of the genetic sequence of an organism due to environmental factors, replication errors, or adaptations.

The correct answer is:

Option A. Tumor

Mutation can lead to:

The mutation is the change in the genes, which can lead to disorders or any illness.

The functions of the body and other molecules can be altered, and therefore can be inherited from parent to offspring.  

Apoptosis is defined as the programmed death of the cells. During the replication, some cells have errors, therefore, they undergo apoptosis to prevent replication of errored genes.

Thus, the mutation in the gene controlling the apoptosis will eventually lead to uncontrolled growth of cells leading to tumors or cancer.

Therefore, option A is correct.

To know more about apoptosis and mutation, refer to the following link:

https://brainly.com/question/1412008

6) On what structure in the cell are proteins needed for cells functions made?

Answers

They are called Ribosomes

A mutation has occurred in the DNA and in the mRNA for a gene. Discuss which would have a more significant effect on gene expression. Why

Answers

A mutation in both DNA and mRNA can impact gene expression, but the effects may vary. DNA mutations typically have a more significant impact because they can alter the genetic code, potentially leading to changes in protein structure and function. These changes might result in loss or gain of function, ultimately affecting the phenotype of an organism.

On the other hand, mRNA mutations can also influence gene expression, but their impact might be more limited. Since mRNA is transcribed from DNA, if the DNA mutation is not present in the mRNA, the altered mRNA might not have a functional impact. However, if the mRNA mutation occurs independently from the DNA mutation, it can still affect translation and protein synthesis, potentially leading to errors in protein production or premature termination of translation.

Thus while both DNA and mRNA mutations can influence gene expression, DNA mutations are generally more significant due to their potential to permanently alter the genetic code and impact protein structure and function. In contrast, mRNA mutations, although capable of affecting translation, might have a more limited impact on gene expression, particularly when they do not originate from DNA mutations.

Learn more about phenotype here:

https://brainly.com/question/28447708

#SPJ11

Brewster Company manufactures elderberry wine. Last year, Brewster earned operating income of $194,000 after income taxes. Capital employed equaled $2.4 million. Brewster is 40 percent equity and 60 percent 10-year bonds paying 7 percent interest. Brewster's marginal tax rate is 40 percent. The company is considered a fairly risky investment and probably commands a 12-point premium above the 5 percent rate on long-term Treasury bonds. Jonathan Brewster's aunts, Abby and Martha, have just retired, and Brewster is the new CEO of Brewster Company. He would like to improve EVA for the company. Compute EVA under each of the following independent scenarios that Brewster is considering.

Required:

Use a spreadsheet to perform your calculations and round all interim and percentage figures to four decimal places. If the EVA is negative, enter your answer as a negative amount.

1. No changes are made; calculate EVA using the original data. $ fill in the blank 1

2. Sugar will be used to replace another natural ingredient (atomic number 33) in the elderberry wine. This should not affect costs but will begin to affect the market assessment of Brewster Company, bringing the premium above long-term Treasury bills to 10 percent the first year and 7 percent the second year. Calculate revised EVA for both years. EVA Year 1 $ fill in the blank 2 Year 2 $ fill in the blank 3

3. Brewster is considering expanding but needs additional capital. The company could borrow money, but it is considering selling more common stock, which would increase equity to 70 percent of total financing. Total capital employed would be $4,000,000. The new after-tax operating income would be $400,000. Using the original data, calculate EVA. Then, recalculate EVA assuming the materials substitution described in Requirement 2. New after-tax income will be $400,000, and in Year 1, the premium will be 10 percent above the long-term Treasury rate. In Year 2, it will be 7 percent above the long-term Treasury rate. (Hint: You will calculate three EVAs for this requirement.)

EVA

Year 1 $ ______

Year 1 (10% premium) $ ______

Year 2 (7% premium) $ _______

Answers

To improve EVA for Brewster Company, the EVA needs to be calculated under different scenarios. In the first scenario, EVA is calculated using the original data. In the second scenario.

In the first scenario, EVA is calculated using the original data provided. EVA is determined by subtracting the company's cost of capital from its after-tax operating income. The cost of capital is calculated by multiplying the cost of equity by the equity percentage and the cost of debt by the debt percentage.

In the second scenario, EVA is calculated after considering the substitution of a natural ingredient with sugar. This affects the market premium, which is the premium above the long-term Treasury rate. The revised market premium percentages are provided for the first and second years. EVA is recalculated using these revised premium percentages.

In the third scenario, EVA is calculated considering the expansion of the company with additional capital. The total capital employed increases to $4,000,000, and the equity percentage increases to 70%. The new after-tax operating income is provided. EVA is calculated using the original data and then recalculated considering the materials substitution described in the second scenario.

By calculating EVA under these different scenarios, Jonathan Brewster can assess the impact of potential changes on the company's economic value added and make informed decisions to improve the company's financial performance.

Learn more about Brewster Company here:

https://brainly.com/question/30638523

#SPJ11

WILL GIVE BRAINLIEST!!
1. Describe some of the natural hazards and disasters that can occur on earth, how they affect the earth and its population, and how these effects can be minimized.

Answers

Answer:

Wild fires

Explanation:

They can destory whole forests and reduce they air quiltiy in those areas because of the smoke. They also reduce the air quality over time because the trees they destoryed can no longer produce new oxogen. These effects can be minimized we can put out and report unattened fires, use caution when using flamable liquids.


How does blood change as it passes through a kidney?

Answers

Blood flows into your kidney through the renal artery. This large blood vessel branches into smaller and smaller blood vessels until the blood reaches the nephrons. In the nephron, your blood is filtered by the tiny blood vessels of the glomeruli and then flows out of your kidney through the renal vein.

Examine the following Punnett squares and circle those that are correct.

Answers

Based on the analysis, Punnett Squares 2 and 3 are correct representations of the possible combinations of alleles for the given genotypes of the parents.

In order to determine the correct Punnett squares, we need to analyze the given genotypes and accurately represent the possible combinations of alleles for each parent. Let's evaluate the provided Punnett squares:Punnett Square 1:Ee  eeGE GgThis Punnett square is incorrect. It incorrectly combines the genotypes of the two parents, resulting in an inaccurate representation of the possible offspring.Punnett Square 2:Ee  eeGG GgThis Punnett square is correct. It accurately represents the genotypes of the parents and shows the possible combinations of alleles for their offspring.Punnett Square 3:Ee  EeGg GgThis Punnett square is correct. It accurately represents the genotypes of the parents and shows the possible combinations of alleles for their offspring.Based on the analysis, Punnett Squares 2 and 3 are correct representations of the possible combinations of alleles for the given genotypes of the parents. Punnett Square 1 is incorrect as it does not accurately combine the genotypes of the parents.

For more questions on Punnett Squares

https://brainly.com/question/3522181

#SPJ8

Note: The correct question would be as

Punnett Squares Examine the following Punnett squares and circle those that are correct. E e GS g Ee ee Ee EE GG G gg GE e e g Ee ee Ee Ee Gg Gg Gg gg g g.

What is the difference between Protostome and Deuterostome development?

Answers

The difference between Protostome and Deuterostome development is with respect to different patterns of embryonic development

Cell division is normally spiral and definite during protostome development. This indicates that each cell has a distinct developmental fate and that cells divide at an angle to the polar axis of the embryo. Deuterostome development often involves radial, ambiguous cleavage. Each cell has the capacity to grow into an entire organism, and cleavage planes are perpendicular to the polar axis.  

The aperture that develops during gastrulation, the process of creating the three germ layers, is known as a blastopore. The blastopore often forms in the mouth in protostomes, while the anus forms later. Protostomy is the name given to this arrangement. In deuterostomes, the mouth develops from a secondary orifice while the blastopore typically turns into an anus. It is known as a deuterostome pattern.

Read more about Protostome on:

https://brainly.com/question/14640159

#SPJ4

Fmri scans have allowed us to make great advances in our understand of the roles of different regions of the brain. Suggest why this may be and give some examples of areas of research which you think might benefit from this study method

Answers

Answer:

FMRI helps to measure and map the brains activities.

Explanation:

FMRI refers to Functional Magnetic Resonance Imaging. It helps to measure and map the brain's activity.

FMRI scan works by looking at the blood flow in the brain to detect areas of activity. Glucose is the main source of energy in the brain,but not stored in the brain. So when parts of the brain need energy o perform action, more blood flow in to transport more glucose.

FMRI scan helps doctors to map out the brain before surgery and provides more information about individual brain to prevent serious injury before the surgery.

It also helps doctors monitor a progressive condition like dementia to study how the disease progresses.

What function makes the HIV virus unique?
A. It has viral DNA that remains dormant until environmental conditions are right.
B. It attacks neurons in the nervous system and causes paralysis
C. It attacks and destroys certain cells in the bodies of its host organisms.
D. It has viral DNA that is transmitted through direct contact with infected persons

Answers

Answer: A

It has viral DNA that remains dormant until environmental conditions are right.

HIV is a unique human RNA virus, capable of infecting cells of the immune system.  

Plz mark brainliest:)

It attacks and destroys certain cells in the bodies of its host organisms. Therefore, option (C) is correct.

What is HIV?

HIV, or human immunodeficiency virus, attacks and destroys a specific type of immune cell called CD4+ T cells. These cells play a critical role in the immune system, and their destruction leads to a loss of immunity and the development of acquired immunodeficiency syndrome (AIDS). HIV is unique in that it specifically targets and attacks these cells, leading to a gradual decline in the body's ability to fight off infections and diseases.

HIV is primarily spread through sexual contact, but can also be spread through sharing needles or from mother to child during pregnancy, childbirth, or breastfeeding. HIV can lead to AIDS (Acquired Immunodeficiency Syndrome) if left untreated.

Learn more about HIV, here:

https://brainly.com/question/20890118

#SPJ2

A hiatal hernia is a protrusion of a portion of the _____ through the ______. Group of answer choices stomach; diaphragm duodenum; pyloric sphincter small intestine; inguinal canal rectum; anus

Answers

A hiatal hernia is a protrusion of a portion of the stomach through the diaphragm.

Hiatal hernia is a condition which arises due to a rise in blood pressure. In this condition the stomach bulges up through an opening in the diaphragm. This condition interjects with the normal mechanism of reflux that occurs through the sphincter, which is present in the esophagus. This condition usually occurs when there is excessive pressure around the stomach due to activities like repeated vomiting. This condition is usually not fatal, however, in rare and serious cases this condition can effect the esophagus and cause esophageal cancer. This condition can also lead to leakage of stomach acids and cause ulcers in the alimentary canal. In serious cases of hiatal hernia the blood flow to and from the intestine can also be effected. Serious cases need surgical treatment.

Learn more about hiatal hernia here-

https://brainly.com/question/6180451

#SPJ4

Which type of interspecific interaction could best be described as a “win-win” interaction?


parasitism

commensalism

predation

competition

mutualism

Answers

Answer:The question describes a mutualistic relationship in which both the bee and the flower benefit. Mutualistic relationships can be described as win-win interactions between species.

Explanation:

Two differences between the heart of a fetus and an adult heart.

Answers

As in an adult heart, the prenatal heart develops four chambers and four valves. But because the fetal lungs will not be used until after birth, blood must bypass the lungs. Two structures develop in the prenatal heart that allow the blood to be routed around the lungs: the foramen ovale and the ductus arteriosus.

Hope it helps...

In which type of reaction does a substance break down into its
components?
O decomposition
Oall reactions involve breaking down substances
O combustion
O acid-base

Answers

Answer:

yoyoyoyo

Explanation:

In need of help please

In need of help please

Answers

Answer:

thick and low in nutrients

Explanation:

because it is so cold and has barely any room for life in the first place, the soil is extremely low in nutrients. it is very thick. i know this because worms cannot move or live in that area because it is too cold and the soil is too thick. if you see what i mean since the worms cant get into the soild since its so thick and cold the soil has no nutrients so sorry it was very hard to explain

many enzymes in both prokaryotic and eukaryotic cells are compartmentalized within organelles. group of answer choices true false

Answers

The statement "many enzymes in both prokaryotic and eukaryotic cells are compartmentalized within organelles" is true. the compartmentalization of enzymes within organelles allows for efficient organization and regulation of metabolic pathways within cells.

In eukaryotic cells, organelles such as the mitochondria, chloroplasts, peroxisomes, and lysosomes all contain specific enzymes that carry out specialized functions. For example, enzymes involved in aerobic respiration are located within the mitochondria, while enzymes involved in photosynthesis are located within the chloroplasts. In prokaryotic cells, enzymes may be compartmentalized within specialized structures known as bacterial microcompartments or within membranes. These structures allow prokaryotes to carry out specialized metabolic functions in a more efficient manner.

Learn more about prokaryotic cells: https://brainly.com/question/29688836

#SPJ11

:interaction where two species________to have a _______ _________with one another

Answers

Interaction where two species mutualism to have a commensalism, and parasitism with one another. Symbiosis is a relationship in which two or more species actively coexist in close proximity to one another.

Although there are many species interactions that fall under the umbrella word "symbiosis," it most often refers to the three main forms of mutualism, commensalism, and parasitism. Any association or interaction between two diverse species is referred to as symbiosis.

Whether one or both organisms benefit from the association determines the exact type of symbiosis. Symbiosis is a relationship in which two or more species actively coexist in close proximity to one another. Although there are many species interactions that fall under the umbrella word "symbiosis," it most often refers to the three main forms of mutualism, commensalism, and parasitism.

Learn more about species Visit: brainly.com/question/25939248

#SPJ4

Correct Question:

Interaction where two species ________ to have a _______ ________ with one another.

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right.
I. Which end of the DNA template is 5′ and which end is 3′?
II. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.

Answers

The 5′ end of the DNA template is ATTGCCAGATCATCCCAATAGAT, and the 3′ end is ATCTATTGGGATGATCTGGCAAT. The RNA transcribed from this template is 5′-UAACGGUCUAGUAGGGUUACUCA-3′.

I. To determine the 5′ and 3′ ends of the DNA template, you should note that RNA polymerase proceeds along the DNA template from the 3′ end to the 5′ end. Since the given sequence (ATTGCCAGATCATCCCAATAGAT) is the single-stranded DNA template and RNA polymerase moves from left to right, the 5′ end is on the left (ATTGCCAGATCATCCCAATAGAT) and the 3′ end is on the right (ATCTATTGGGATGATCTGGCAAT).

II. To transcribe RNA from the DNA template, RNA polymerase pairs RNA nucleotides with the DNA template nucleotides: A (adenine) pairs with U (uracil), T (thymine) pairs with A (adenine), C (cytosine) pairs with G (guanine), and G (guanine) pairs with C (cytosine). Using this base-pairing rule, the transcribed RNA sequence is 5′-UAACGGUCUAGUAGGGUUACUCA-3′.

Learn more about nucleotides here:

https://brainly.com/question/30299889

#SPJ11

(GIVING BRAINLIEST!!!)

(GIVING BRAINLIEST!!!)

Answers

Answer:

farther and shorter

Explanation:


Transcribe the following strand of DNA into mRNA:
DNA: TAC-GCC-GAC-ACT

Answers

I think it’s AUG CGG CUG UGA
Other Questions
What is the final couplet in a Shakespearean sonnet called?. The production possibilities frontier itself illustrates all goods that can be produced by an economy. the combination of goods and services that can be produced efficiently. all goods and services that are desired but cannot be produced due to scarce resources. all possible production of capital goods PLSSS HELP IF YOU TURLY KNOW THISS Why do some people find it easier and quicker to use online dictionaries instead of print dictionaries? Which statement best describes the density of the outer planets 3 points 13. To find the mileage, or how many miles a car can travel per gallon of gasoline, you can use the expression m/g, where m is the distance in miles and g is the number of gallons of gas used. Find the mileage in miles per gallon for a car that travels 585 miles on 18 gallons of gas? (Your answer does not need miles per gallon at the end.) * Your answer Mrs.cooper painted 1/3 of her wall in 3/4 hour if she works at the same rate what portion of the wall will she paint in one hour Which warehouse ownership type provides the advantage of providing the client with the option of obtaining specialized services tailor-made to suit their needs without the disadvantage of high startup costs?. In a police ballistics test, 2.00-g bullet traveling at 700 m/s suddenly hits and becomes embedded in a stationary 5.00-kg wood block. What is the speed of the block immediately after the bullet has stopped moving relative to the block The simple interest formula is I=Prt, where / is the interest, P is the principal, is the interest rate, and t is the time. What is the interest if the principal is $10,000, the interest rate is 2%, and the time is 8 years? I 0 I 1 I 2 I 3I 4 The best method of notifying the BON about reportable violations by a nurse of the NPA and board rules is to Residents living in a highly contaminated area of Hunters Hill, NSW were exposed to radiation from buried Uranium and Thorium over the course of many years. Their health symptoms (attributed to the exposure) include non-heritable bowel cancers and rashes. Which of the following hazards encompass the symptoms of these environmental contaminants?A. Carcinogenic and teratogenicB. Mutagenic and carcinogenicC. Cytotoxic and mutagenicD. Carcinogenic and cytotoxicE. All of the above rewrite the equation of a circle given below in standard formx - 18x+ y + 8y + 28 = 0 1. Hung is .. student in my class.A. goodB. betterC. the bestD. a best 1. Todos los das, los estudiantes (leer) sus libros de texto. A common approximation for1+x is 1+ 0.5 x, when x is small. Use the degree 1 Taylor polynomial of f(x)=1+x with remainder to determine a formula of form1+x = 1+ 0.5 x E. Evaluate E for the case of approximating1.02. Use a calculator to compare the actual error to your error bound E. the physiological effects depicted on the mannequin and sliders on the right In what ways did the industrial revolution negatively impact the environment of it's urban centers 4 students decide to share 7 small pizzas equally. How much pizza will each student get?