Help please
#1 The term "endosymbiotic" means...
A. inside and helping each other
B. inside and attacking another
C. outside and attacking another
D. outside and helping each other

#2 The most difficult step for science to explain about how early life formed is...
A. how molecules could self replicate.
B. how selectively permeable membranes formed.
C. how organic molecules formed.
D. how nucleic acids like DNA began working with amino acids to make proteins.

Answers

Answer 1

Answer:

#1 [A. inside and helping each other

#2 [D. how nucleic acids like DNA began working with amino acids to make proteins


Related Questions

how does acyl coa get across the inner mitochondrial membrane?

Answers

Answer:

Explanation:

Heres where to get your answer

https://www.info.com/serp?q=website%20medical&segment=info.0546&s1aid=3788024678&s1cid=11804561937&s1agid=114484240723&s1kid=kwd-944088888&utm_source=adwords&gclid=CjwKCAiAm7OMBhAQEiwArvGi3IMQUyr3aRG07nCggQt-8rAAgyPT3rJedCcJxTAl1ve9LJwgIxq21RoC4yQQAvD_BwE

Which result is most likely to occur due to orographic uplift?

tornado formation

development of hurricanes

cloud formation and precipitation

clear skies and fair weather

Answers

The most likely result to occur due to orographic uplift is cloud formation and precipitation.

The correct answer would be cloud formation and precipitation.

The most likely result to occur due to orographic uplift is cloud formation and precipitation. Orographic uplift refers to the lifting of air as it encounters a mountain or elevated terrain. As the air is forced to rise, it undergoes adiabatic cooling, which can lead to the condensation of water vapor and the formation of clouds.

When moist air encounters a mountain or any elevated obstacle, it is forced to rise along the windward side. As the air ascends, it cools adiabatically, meaning the temperature decreases as it expands due to decreasing atmospheric pressure. As the air cools, its ability to hold moisture decreases, leading to the condensation of water vapor and the formation of clouds. This process is known as orographic lifting, and it is responsible for the creation of clouds and subsequent precipitation on the windward side of the mountain.

The type of clouds that form due to orographic uplift depends on various factors such as temperature, humidity, and stability of the air. Examples of clouds that can form in this process include stratiform clouds (layered clouds) or cumuliform clouds (puffy, vertically-developed clouds). The presence of moisture in the air, combined with the lifting effect of the terrain, promotes the development of clouds and precipitation.

While orographic uplift can enhance atmospheric instability and contribute to localized weather patterns, it is not directly associated with tornado formation or the development of hurricanes. Tornadoes typically form within severe thunderstorms, while hurricanes are large-scale tropical cyclones that form over warm ocean waters. Clear skies and fair weather are less likely outcomes when encountering orographic uplift, as the lifting of air and subsequent cloud formation often result in increased atmospheric moisture and the potential for precipitation.

In summary, orographic uplift primarily leads to cloud formation and precipitation as moist air is forced to rise over mountains or elevated terrain. This process is responsible for the creation of clouds and can contribute to localized weather patterns and enhanced precipitation in the vicinity of the uplifted region.

For more such information on: orographic uplift https://brainly.com/question/7953085

#SPJ8

Which of the following best represents the amino acid sequence found in normal adults with the HBB gene?
- His, Gly, Asp, Gly, Gin, Leu. Leu
- Val, His, Leu, Thr, Pro, Glu, Glu
- Val, Gly, Asp. Thr, Pro, Glu, Glu
- Leu, Glu, Asp, Gly, Gin, Leu, Leu

Which of the following best represents the amino acid sequence found in normal adults with the HBB gene?-

Answers

Val, His, Leu, Thr, Pro, Glu, Glu

The sequence 'Val, His, Leu, Thr, Pro, Glu, Glu' best represents the amino acid sequence found in normal adults with the HBB gene.

What is a mutation?

A mutation is any alteration in the genetic material of an organism, which can alter the protein that is commonly synthesized.

A missense mutation is a type of mutation that alters the amino acid sequence during translation.

Moreover, the HBB gene is a gene required to produce hemoglobin, which is a fundamental protein to transport oxygen in the blood.

In conclusion, the sequence 'Val, His, Leu, Thr, Pro, Glu, Glu' best represents the amino acid sequence found in normal adults with the HBB gene.

Learn more in:

https://brainly.com/question/14809959

an organism that invades a region can have negative consequences and not region what kinds of shifts can take place?

Answers

Invasive species provoke significant damages in the structure of native ecosystems. They also cause economical and socio-cultural problems.

------------------------------------

When talking about dispersion we refer to the change in a species´ range or distribution area.

When a species move and establish in a new area out of their original distribution range, they might be considered exotic or invasive, according to their

reproductive rate, population growth, and interaction with native species.

The introduction of invasive species has ecological, economic, socio-cultural consequences. Once an invasive species has been established, it overgrows. In the new areas, these species have less environmental pressure and better conditions than in their origin area -fewer predators, more resources, better nitches-, and these factors favor their establishment. They interact with native species by competing for resources such -water, place, radiation, exposure, shelter, food, etcetera-. They provoke significant damages in the structure of native ecosystems, causing severe damage in endemic species. They produce ecological imbalances in the trophic chains and the dynamics of communities. Invasive species are uncontrollable.

As they expand, they can also affect human in an economical manner and has socio-cultural effects. Many invasive species might cause crops loss by eating cultures. They attack farm animals. They affect buildings and other structures or ships by eating wood. They might even attack humans and cause health problems.  

----------------------------------

Related link: https://brainly.com/question/22117564?referrer=searchResults

 

 

 

By what molecular mechanism does CAP protein activate lac operon transcription?
(A)CAP helps recruit RNA polymerase to the promoter due to an allosteric interaction with RNAP when glucose levels are low and lactose levels are high.

Answers

The catabolite activator protein (CAP) is a regulatory protein that activates the transcription of the lactose (lac) operon in bacteria by binding to a specific DNA sequence in the promoter region of the operon.

The lac operon encodes enzymes that are involved in the metabolism of lactose and related sugars.

Under low glucose and high lactose conditions, cyclic AMP (cAMP) levels increase in the cell. CAP binds to cAMP, which causes a conformational change in the protein, enabling it to bind to a specific DNA sequence upstream of the lac operon promoter, known as the CAP binding site.

The binding of CAP to the CAP binding site induces a conformational change in the DNA, which facilitates the binding of RNA polymerase (RNAP) to the promoter region. This allows RNAP to initiate transcription of the lac operon genes.

CAP acts as a positive regulator of lac operon transcription by enhancing the recruitment of RNAP to the promoter region in response to increased levels of lactose. When glucose is low, the cell must rely on lactose for energy, and the activation of the lac operon by CAP ensures that the necessary enzymes are produced to metabolize lactose efficiently.

Overall, the activation of lac operon transcription by CAP involves an allosteric interaction between the protein and cAMP, which enables CAP to bind to the CAP binding site and induce a conformational change in the DNA, facilitating the recruitment of RNAP to the promoter region and initiating transcription of the lactose metabolic genes.

To learn more about catabolite activator protein refer here:

https://brainly.com/question/31688486

#SPJ11

According to the conceptual model of optimal foraging, as foraging effort increases:
a. net energy gain increases linearly.
b. the profitability of the food item increases.
c. the total energy obtained eventually becomes negative.
d. cumulative energy investment in foraging increases at a constant rate.

Answers

According to the conceptual model of optimal foraging, as foraging effort increases, **the profitability of the food item increases**.

The optimal foraging theory suggests that organisms maximize their energy intake while minimizing the energy expended during foraging. As foraging effort increases, individuals are likely to target more profitable food items that offer higher energy gain relative to the energy invested in obtaining them. This can involve selecting food sources that are more abundant, easier to capture, or require less time and energy to handle and consume. By prioritizing more profitable food items, organisms can enhance their overall energy gain and maximize their foraging efficiency.

Learn more about optimal foraging here:

https://brainly.com/question/31169107

#SPJ11

a paralysis that is limited to one arm would be called: unilateral. bilateral. multilateral. tetralateral.

Answers

Most frequently, injury to the neurological system, specifically the spinal cord, results in paralysis. Hence the answer is a paralysis that is limited to one arm would be called unilateral.

Additional significant causes include multiple sclerosis, spina bifida, poliomyelitis, stroke, trauma inflicting nerve damage, cerebral palsy, peripheral neuropathy, Parkinson's disease, ALS, and Guillain-Barré syndrome. Temporary paralysis occurs during REM sleep, and paralysis spells can occur when this system is dysregulated throughout the day. Additionally, medications like curare that disrupt nerve activity may result in paralysis. A purposeful restriction or inhibition of mobility caused by pain, clumsiness, orgasm, or any other cause other than real muscular paralysis is known as pseudoparalysis. It might be a sign of congenital syphilis in a newborn.

To learn more about paralysis click on the given link: https://brainly.com/question/7249786

#SPJ4

can someone please help me ASAP ​

can someone please help me ASAP

Answers

Answer:

Explanation:

4

Stage _____ of NREM sleep represents the beginning of actual sleep.

A. One
B. Two
C. Three
D. Four

Answers

Answer: B. Two

Explanation:

     During the first stage, your body starts relaxing and falling into sleep. This is the lightest stage of sleep. You can wake easily during this stage, and are not "fully" asleep.

     During the second stage, your body deepens into it's sleep, your heart rate decreases, your body temperature decreases, and more. This is the stage that "represents the beginning of actual sleep" which is the answer to your question.

     During the third stage, your body is in a deeper state of sleep. Your muscles relax further, your breathing rate slows, and more.

     During the fourth stage, your heart rate and body temperature rise again. Your brain is a bit more active, and your muscles start to "wake up" slowly again.

  Read more about NREM sleep here:

https://brainly.com/question/14410334

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Answers

The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.

In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.

In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.

The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.

It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.

For more such answers on RNA

https://brainly.com/question/13939644

#SPJ8

which of the following statements concerning whittaker's representation of his biome scheme is false? which of the following statements concerning whittaker's representation of his biome scheme is false? plants in temperate rain forests are not water limited. tundra represents an extreme biome. subtropical deserts are wetter than woodlands and shrublands. tropical rain forests represent an extreme biome. temperate rain forests have high rainfall and low temperatures.

Answers

The false statement concerning Whittaker's representation of his biome scheme is "Subtropical deserts are wetter than woodlands and shrublands."

Whittaker's biome scheme is based on the combination of temperature and precipitation to classify biomes. Temperate rain forests have high rainfall and low temperatures, while tundra represents an extreme biome with very low temperatures and low precipitation. Tropical rain forests also represent an extreme biome with high temperatures and high precipitation. However, the statement that plants in temperate rain forests are not water-limited is true.

The false statement implies that subtropical deserts are wetter than woodlands and shrublands, which is not accurate. In reality, subtropical deserts are characterized by low precipitation, while woodlands and shrublands have higher precipitation levels. This demonstrates the importance of accurately understanding the characteristics of different biomes and the factors that define them.

Learn more about precipitation  here:

https://brainly.com/question/18109776

#SPJ11

HELPThe Punnett square shows the possible genotypecombinations of two parents who are homozygous fora trait.WWW WWWwWWWWwWhat is the probability of the parents having a childthat is heterozygous for this trait?O 0%O 25%O 75%O 100%

HELPThe Punnett square shows the possible genotypecombinations of two parents who are homozygous fora

Answers

As we can see in the punnet square we have a recessive homozygous and a dominant homozygous, in the possible combinations that can have the offspring, that is to say the letters inside square we can see that all are heterozygus, e

help i need help help me

help i need help help me

Answers

Answer:

horsetail is a seedless vascular plant

club moss is a seedless vascular plant

Fern is a seedless vascular plant

Moss is a non vascular plant

Liverwort is a non vascular plant

Hornwort is a non vascular plant

What characteristics of eukaryotic cell gives them greater capacity for specialization than prokaryotic cells?​Explain your answer.

Answers

Answer:Eukaryotic cells are generally much larger than prokaryotic cells, frequently having a cell volume at least a thousandfold greater. The compartmentalization provided by cytoplasmic organelles is what allows eukaryotic cells to function efficiently.

Explanation:

Does metamorphosis occur in thyme plant's life cycle?

Answers

Answer:

In addition, although the term metamorphosis is generally not applied to plants

Answer:

i dont think so

Explanation:

can someone send a link on this topic or help me do it in any way?? its due tomorrow

can someone send a link on this topic or help me do it in any way?? its due tomorrow

Answers

Answer:

You should explain more...

Explanation:

Cells that do not have clearly defined nucleus and no organized chloroplasts, mitochondria, or other organelles are
O Eukaryotic
ukaryotining
O Prokaryotic
Plants
O Fungi
Animals

Answers

Answer:

One of the main differences between prokaryotic and eukaryotic cells is the nucleus. Prokaryotic cells lack an organized nucleus while eukaryotic cells contain membrane-bound nuclei (and organelles ) that house the cell's DNA and direct the synthesis of ribosomes and proteins.

3. How does the function (or job) of dystrophin change when the structure changes?​

Answers

Answer:

Individuals with BMD genetic mutations make dystrophin that is partially functional, which protects their muscles from degenerating as badly or as quickly as in DMD. The dystrophin protein transfers the force of muscle contraction from the inside of the muscle cell outward to the cell membrane.

Explanation:

The adaptations of a pelican include its long, pouch-like beak. Why is the beak of the pelican an example of an adaptation?

A.

The beak is a unique feature that is found only in pelicans.

B.

All birds have beaks, but the beaks vary among different species.

C.

The shape and structure of the beak have remained the same over many generations.

D.

The shape and structure of the beak are inherited and help the pelican survive in its environment

Answers

Answer:

D. The shape and structure of the beak are inherited and help the pelican survive in its environment

Explanation:

Hope this helps!

Given the following three mRNA sequences, 2 code for the same protein. Which two?
#1. AGU UUA GCA ACG AGA UCA
#2 UCG CUA GCG ACC AGU UCA
#3 AGC CUC GCC ACU CGU AGU

Answers

Answer:

#2 & #3

Explanation:

both have the same amino acids. like leucine

Knowing that more than one codon codes for the same amino acid during protein building, we can affirm that sequences #2 and #3 code for the same protein.

How does translation occur?

During protein synthesis, the ribosome reads mRNA molecules from the 5' to 3' extremes.

While doing it, tRNA recognizes the codons of the molecules and adds the correct amino acids.

Codons are short sequences of three nucleotides that code for one amino acid.

So the sequence of codons determines the sequence of amino acids in the building protein.

There are 64 possible codons,

The start codon AUG is the most common sequence used by eukaryotic cells and placed near the 5' extreme of the molecule.

The end codons are UAA, UAG, UGA. They indicate where to stop protein synthesis.

The remaining codons code for one amino acid in the protein. Since there are only 20 amino acids in nature, more than one codon codes for the same amino acid.

Knowing this, we can build the protein by reading the mRNA sequences.

#1. AGU UUA GCA ACG AGA UCA

     Met    Leu   Ala   Thr   Arg   Ser

#2 UCG CUA GCG ACC AGU UCA

       Ser   Leu   Ala   Thr    Ser    Ser

#3 AGC CUC GCC ACU CGU AGU

       Ser   Leu   Ala   Thr   Arg    Ser

Sequences 2 and 3 code for the same protein.

You will learn more about translation at

https://brainly.com/question/19535415

https://brainly.com/question/13275770

Muscular dystrophy is a sex-linked recessive disorder that causes the muscles to slowly weaken. Which of the following circumstances would a male child most likely show the trait coded for by the recessive allele?
Group of answer choices

A recessive allele is located on a autosomal chromosome.

A dominant allele is found on the Y chromosome.

A dominant allele is inherited from the father.

A recessive allele is inherited on the X gamete.

Answers

For a se_x-linked recessive disorder such a s muscular dystrophy to occur in a male child, a recessive allele is inherited on the X gamete

What are se_x-linked recessive disorders?

Se_x-linked recessive disorders are disorders which occurs as a result of a defective gene found on the X chromosomes.

Se_x-linked recessive disorders are usually present on the X-chromosomes and affects mostly boys because they receive their X-chromosomes from their mothers.

For a se_x-linked recessive disorder such a s muscular dystrophy to occur in a male child, a recessive allele is inherited on the X gamete.

Learn more about se_x-linked recessive disorders at: https://brainly.com/question/9418183

What is environmental science to you?

Answers

Answer:

Environmental science is a multidisciplinary field that explores the dynamics between Earth systems, flora, fauna and humans. It involves research on air, water, soil, food, and wildlife to help understand system processes, identify environmental damage or hazards, and develop solutions to environmental concerns.

Answer:

having to do with the earth and animals

Explanation:

having to do with the earth and animals

if the alle B represents black fur and
alle b represents white fur what would be the genotype of animal with white fur

Answers

Answer:bb
And for black fur to be present you would need a genotype of either Bb or BB.

Answer:

The genotypes would have to be "bb".

Explanation:

If the dominant allele B is present in a genotype (a genotype is the two letters to represent the trait) then the organism will always be black.

BB= black

Bb= black

bb= white. This is because there is no "B" to dominate the genotype.

Please give me brainiest I am trying to get one !!!!

protein denaturation can be brought about by all of the following except:

Answers

Protein denaturation can be brought about by all of the following except cooling the protein.

Protein denaturation is the breakdown or unfolding of a protein's structure, which results in the loss of its functional capabilities.

Denaturation can be triggered by a variety of circumstances, including heating the protein, exposing it to a strong acid, and treating it with disulfide bond-breaking chemicals.

These circumstances have the potential to disturb the non-covalent interactions and disulfide bonds that contribute to the folded structure of the protein.

As a result, chilling the protein is an exception among the mentioned choices because it is not a factor that generally causes protein denaturation.

For more details regarding protein denaturation, visit:

https://brainly.com/question/33442790

#SPJ12

Your question seems incomplete, the probable complete question is:

Protein denaturation can be brought about by all of the following except: cooling the protein heating the protein placing the protein in a strong acid, which disrupts hydrogen bonding treating the protein with compounds that break disulfide bonds

In Fast Plants Green leaves are dominant, yellow are recessive:

Cross two heterozygous green leaf fast plants, and match the phenotype and genotype with the probable outcome.

This is just like Mendel's experiment crossing two Hybrid Tall pea plants and seeing the recessive short gene show up

Answers

Students may investigate the features Mendel tested and then cross two pea plants to observe what offspring they create in this area of the online lab.

Mendel's experiment:

"Plant five pea plants and see what they look like," Mendel advises pupils. The animated Mendel plants and waters five pea plants when students click the "Plant" button. Each pea plant shoots quite fast. The learner may view the pea pod's color, shape, and form, as well as the color and form of the mature seed, by moving the pointer over the plants.

Although the plants are selected at random each time the application is run, all of the numerous varieties of pea plants may be observed in these growing peas. Mendel quizzes the pupils on how many distinctive characteristics they notice in the plants after they have grown five plants

He shows there are seven distinct qualities :

Pea form (round or wrinkled)Pea green (green or yellow)Shaped like a pod (constricted or inflated)Pod hue (green or yellow)floral hue (purple or white)plant height (tall or dwarf)Arrangement of flowers (axial or terminal)

They can cross any plant with itself or with another plant using the five plants they raised. The way that qualities are passed down to future generations may start to show certain patterns to students. They might know, for instance, that a plant with white flowers crossed with itself or another plant with white flowers will only produce plants with white flowers, whereas a plant with purple flowers crossed with itself or another plant with purple flowers will occasionally produce plants with white flowers. You could discover that by encouraging students to focus on specific characteristics during their experiments, they start to see these patterns on their own.

Hence, all about Mendel's experiment

To learn more about Mendel's Experiment click on the link

https://brainly.com/question/24519638

#SPJ1

In Fast Plants Green leaves are dominant, yellow are recessive: Cross two heterozygous green leaf fast

Which person is least likely to be concerned about potential long-term side
effects of genetically modified (GM) food?
A. A wealthy mother
B. The owner of an organic farm
C. A biology researcher
D. A child who is starving

Answers

i think it would be d

How are prokaryotes and eukaryotes the same

Answers

Answer:

Both have selectively permeable plasma membranes surrounding their cells which act as barriers for entering molecules.

Both carry ribosomes for protein synthesis

Both have a semi fluid jelly like substance called cytosol ( cytoplasm) in which subcellular organelles are suspended in.

Both carry DNA as their genetic material

What kind of compound
does NOT contain carbon or
living properties?
A. plant leaves
B. inorganic
C. organic
D. microorganisms

Answers

Answer:

I think it's option C. Organic

Once your body identifies and knows how to fight a virus, it produces __________ that attach to the virus and destroy it.

Answers

Answer:

Antibodies

Hope it helps you

Why do cows moo? And how do cows moo? I will reward the best answer brainliest

Answers

Cows moo as a means of communication. They use different types of moos to convey various messages such as seeking contact with others, expressing hunger, showing distress, or communicating their presence to their offspring. Cows produce sounds through vocalization by expelling air through their vocal cords and manipulating their larynx and mouth to create the characteristic "moo" sound.

Cows moo as a form of vocal communication. They use their vocalizations to convey various messages to other cows and to communicate with their calves, herd members, and even farmers.

The primary reasons why cows moo include:

Social Interaction: Cows use moos to establish contact and maintain social bonds with other cows. It helps them locate and communicate with each other within the herd.

Maternal Communication: Mother cows use different types of moos to communicate with their calves, guiding them, or calling them to nurse.

Expressing Distress: Cows may moo louder and with higher intensity when they are in pain, stressed, or facing discomfort. This helps alert others that something is wrong.

The mooing sound is produced by vibrations of the vocal cords located in the cow's larynx or voice box. Air from the lungs passes through the vocal cords, causing them to vibrate, producing a distinct sound. Cows have a unique vocal range, and the pitch and tone of their moo can vary based on individual characteristics and the context in which it is used.

Overall, mooing is an essential means of communication for cows, allowing them to express their needs, and emotions, and establish social connections within their herd.

For more such answers on Cows

https://brainly.com/question/30286448

#SPJ8

Other Questions
The volume of this rectangular prism is 8 cubic feet. What is the surface area? Find the limit if it exists: lim X-3 : x+3 x2-3x A. 1 B. O C. 1/3 D. Does not exist PLEASE HELP FAST WILL MARK AS BRAINLIEST 3. How does modern evolutionary theory differ from Darwin's theory proposed in the 19th century? A group of piano students love their teacher and develop apassion for music because of him. One day, after a concertfeaturing Chopin's music, they notice that the teacher haschanged. Instead of making the lessons fun andinstructive, he begins to enforce greater discipline. Somestudents wonder whether they should continue, whileothers begin to thrive because of the challenge. By the endof the year, the teacher has fewer students, but they aremore talented and hardworking. Years later, the studentswho had continued with the teacher find careers in themusic industry.How does the story's structure most clearly affect the author's message?OA. It uses problem and solution to demonstrate that all problemshave easy solutions.B. It uses compare and contrast to show that hard work leads togreatness.O c. It uses cause and effect to illustrate that some risks are worthtakingO D. It uses chronological order to indicate the steps the teacher tookto alienate his students. If 75% of an iceberg's height is hidden below the surface of the water, what is the total height ofan iceberg that reaches 450 feet above the surface of the ocean? two factors on which the weight of a body depends jorden claims that x^2+3=12 is exponential equation. is jorden correct Which scenario is an example of extrinsic motivation? What two basic geologic processes contributed to the formation of folded mountain ranges like in Glacier National Park? Which of the lines is a line of symmetry for the object?A. AB and CDB. CD and EFC. EF and GHD. AB only PLEASE HELPPPYour country has a dry, desert climate, and your neighbors have a warm,rainy climate.Your country is able to grow oranges at a cost of 35 cents a pound, andyour neighbors can grow them for 10 cents a pound.Most citizens in your country are trained in the service industry, and mostof your neighbors' citizens are trained in agriculture and farming.SKILLSYou are the president of a small country and you are hoping to invest in a new industry. You have theopportunity to invest in growing oranges to export overseas or you could let your neighbors take over thatindustry while you invest in producing something else.Based on the information in the table above, would you rather invest in growing oranges in your country orinvest in something else? Explain your decision in a short paragraph. Why though ? Why just today why not tomorrow Both DNA and RNA are made of subunits or building blocks called_______.Question 1 options:NucleotidesAmino AcidsProteinsEnzymes When is the only time to abbreviate on a job application?Question 3 options:In the Personal Information sectionIn the Position & Availability sectionOnly when space is limitedSignature section (a) There is a case in Malaysia which involves a dismissal. The dismissed employee was hired on a contract. The end date of the contract has since lapsed. The employee is claiming wrongful dismissal. The employee claims that the employee was dismissed without reason after having been suspended. The employer argues that the dismissal happens on the end date of the contract and is thus legal. The employee has argued that the suspension prevented appropriate observance of the employment contract. The suspension happened before the end date of the contract. Thus far, these are the only facts that have been revealed; there may be others as the case is further investigated.(i) The circumstances around the suspension has yet to be fully investigated. Assume at least two facts that will be revealed from this investigation. Hint #I: consider also whether there has been any justification by the employer for the suspension or not. Hint #2: consider also any cause for the suspension. Hint #3: the duration of the suspension should also be considered.(ii) From the facts in parts (i), predict the ruling that the court would make. Note: every fact must be used to justify the ruling. Hint: depending on the combination of facts, the case can also be moot, i.e. not for the court to decide on. Example Solution: (i) Fact #1: The employee was suspended pending investigation by the employer for an incident allegedly involving the employee. Fact #2: The investigation by the employer about the incident has not been concluded by the time of the dismissal. Fact #3: The investigation by the employer about the incident has yet to be concluded during this court case. (Lecturer's Note: This particular was added in order to fit the answer for part (iii).) (ii) The court rules in the favour of the employee, i.e. the dismissal was wrongful. (Fact #1) A suspension pending investigation means that the employee is not able to carry out work when suspended. (Fact #2) The dismissal is an action taken during suspension; a suspension pending investigation can only lead to action after the investigation has been completed. (Fact #3) There has yet to be any conclusive reason for the suspension. Since the employee is not able to carry out work during the suspension and the employer has suspended the employee pending investigation, the employment contract was not being observed by either party. Therefore, the dismissal at the end date of the contract is not legal.With the question and answer provided, answer the following question:1) Determine what LAW apply in this case2) Determine the award, punishment and/or recommendation that the court would make after the rulling. Factor the trinomial, or state that the trinomial is prime.y2-9y+14Please help Which recommendation would be most suitable for a 40-year old client whose main objective is retirement income and preservation of capital? Someone please help !!!!!!!!!!! Will mark Brianliest !!!!!!!!!!!!!!!! When Acme Dynamite produces 200 units of output, its variable cost is $3,000, and its fixed cost is $500. It sells each unit of output for $30. When Acme Dynamite produces 200 units of output, its profit is A. $2,000 B. $6,000 C. S2,500 D. $3,000 bute I was wondering if you could show How you got the answer. And its not 6 I already tried TvT. Im looking for the surface area of the prism