You are not happy living in your apartment with noisy neighbors upstairs. They party all night often past your building's 10pm curfew. You have complained many times and your landlord has done nothing to help. What violation of landlord duties can you use to attempt to escape this lease?
The violation of landlord duties that you can use to step in is the Noise Violations
What are Noise Violations?
Noise Violations can be defined as an item that constitutes the lease violation of an apartment, it involves creating noise and disturbing the peace of other tenants in a building.
It should be noted that after several complaints, it is the responsibility of the landlord to step in and make things right.
Learn more about lease violations here
https://brainly.com/question/330262
#SPJ1
The Magna Carta was the first document to do which of the following? A. limit government’s power B. require taxes from citizens C. gave president's veto power D. guarantee women equal rights
Answer:
A
Explanation:
it put into writing the principle that the king and his government was not above the law.
In the case Boynton v. Virginia (1960), the Supreme Court ruled that segregation at a bus stop restaurant was illegal based on the Interstate Commerce Act. What explains how this case is similar to Brown v. Board of Education of Topeka (1954) ?
In the case of Boynton v. Virginia (1960), the Supreme Court ruled that segregation at a bus stop restaurant was illegal based on the Interstate Commerce Act.
This case is similar to Brown v. Board of Education of Topeka (1954) because both cases involved the issue of segregation and the legality of segregation in different contexts. In Brown v. Board of Education of Topeka, the Supreme Court ruled that segregation in public schools was unconstitutional because it violated the Equal Protection Clause of the 14th Amendment. Similarly, in Boynton v. Virginia,
The Supreme Court ruled that segregation in a bus stop restaurant was illegal because it violated the Interstate Commerce Act, which prohibited discrimination on the basis of race or color in any facility that was part of interstate commerce. Both cases reflect the Supreme Court's increasing willingness to strike down segregation and discrimination based on race, and both cases played important roles in the broader civil rights movement in the United States.
For more such questions on Interstate Commerce Act
https://brainly.com/question/16979634
#SPJ11
the state of california passes a law to restrict emissions form motor vehicles. thee emissions may also be regulated by
The emissions may also be regulated by A. other states and the federal government.
What is an emission?It shoul be noted that something that has been released or emitted into the environment is referred to as an emission. Emissions include car exhaust, burps, and radio broadcasts.
Because the excessive amount of carbon dioxide released into the atmosphere has become a major issue and has a direct impact on global warming, specific regulations that limit the amount of carbon dioxide released by factories have been implemented. These restrictions are referred to as 'carbon offsets.
In this case, it's important for states to regulate them.
Learn more about emissions on:
https://brainly.com/question/14275614
#SPJ1
Complete question
The state of california passes a law to restrict emissions form motor vehicles. The emissions may also be regulated by
a. other states and the federal government.
b. no other government.
c. the federal government only.
d. other states only.
The Constitution limits the executive branch from declaring war by giving that power to
the judicial branch.
the legislative branch.
the leader of the Senate.
the leader of the House.
Answer: The Legislative branch
Explanation: Just trust me bro
Answer: The answer is:
B: the legislative branch.
Explanation:
Edge 2023
Hope :}
Don't trust random people on the internet.
if u have 10 cookies then your friend takes 2 what do you have.
Answer:
Hello There!!
Explanation:
The answer is 8 because you had 10 and your friend takes 2 off from the 10.(10-2=8)
hope this helps, have a great day!!
~Pinky~
Discuss criticisms of separation of powers
Answer:
One criticism of separated powers is that it can also result in weak government, especially if the legislative and executive branches are controlled by different political parties.
Explanation:
Answer:
The criticisms of the doctrine of separation of powers are: Complete separation is not possible, Complete separation is not desirable, Impracticable in itself, and Separation of powers can lead to deadlocks and inefficiency.
Please give me brainliest - you get 25% as well! I swear!
How do the rule of law and the Constitution relate to DNA
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT
Answer:
The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.
Which of the following prizes or awards are subject to income tax?
A) Cash scholarship used to pay tuition
B) New car won on a game show
C) Cash award to a college professor for outstanding teachingB) New car won on a game show
C) Cash award to a college professor for outstanding teaching
Answer:
B) New car won on a game show
The 4th, 5th, 6th & 8th Amendments are sources of criminal law, specifically ____________________ criminal law.
Explanation:
These amendments include the fourth, fifth, sixth, eighth, and the fourteenth amendments. Their purpose is meant to ensure that people are treated fairly if suspected or arrested for crimes.
The esophagus, which leads to the stomach,
can be damaged by even one acute alcohol
consumption episode.
true or false
Answer:true
Explanation:
The innocent non-breaching parfy to a contract is entitled to a. punitive damages b. reformation c. the benefi of the bargain: dian injunction QUESTION 42 In order to colloct consequential damages, the innocont non-bieaching party must a. notify the other party in advance; b. prowe traudulent misepresentation, ciask the court for specific perfomance d. rescind the contract QUESTION 43 a. duress b. fraust c. butfory di undis infucence
The innocent non-breaching party to a contract is entitled to the benefit of the bargain. In order to collect consequential damages, the innocent non-breaching party must notify the other party in advance.
The benefit of the bargain refers to the right of the innocent non-breaching party to be put in the position they would have been in if the contract had been performed as agreed. This includes recovering any financial losses or damages incurred as a result of the breach. Consequential damages, on the other hand, are a type of damages that arise from the specific circumstances of the breach and are not directly caused by the breach itself. In order to recover consequential damages, the innocent non-breaching party typically needs to provide notice to the breaching party of the potential consequences or risks involved in case of a breach. This requirement allows the breaching party to be aware of the potential damages they may be liable for.
In summary, the innocent non-breaching party is entitled to the benefit of the bargain, and to collect consequential damages, they must provide advance notice to the breaching party.
To know more about non-breaching party, click here:
https://brainly.com/question/14454694
#SPJ11
Who is allowed to hunt in the United States?
Answer: All hunters must possess a valid state hunting license. All hunters 16 years or older must possess a Migratory Bird Hunting Stamp while hunting migratory waterfowl. All hunters must comply with current Federal Migratory Bird Regulations.
Explanation:
Always unload a firearm before:
Answer:
Storage, cleaning and travel
Explanation:
took a course
Mississippi has adopted the rule that an employee is acting within the scope of their employment if force is intentionally used and that use of force is not unexpected by the employer. (Mar-Jac Poultry MS, LLC v. Love). If a cashier were to tackle a suspected shoplifter, do you believe that behavior would be unexpected by the employer?
Answer:
Yes but no really.
Explanation:
This behavior would not be expected by a employer but if you really think about it the Employer would rather be shocked and if it was a shop lifter they would be rewarded as because of there braveness to stop a shop lifter if that is what you are referring to.
At the balance sheet date, a business owes a mortgage note payable of $375,000, the terms of which provide for monthly payments of $1,250. How should the liability be classified on the balance sheet?
Current liability:
Long-term liability:
The liability on the balance sheet should be classified as the long-term liability.
Long-term liability, which is also called as the long-term debts, are debts which a company owes to the third-party creditors which are payable beyond 12 months. So, this tends to distinguish them from current liabilities, which a company must pay within 12 months.
On the balance sheet, the long-term liabilities tend to appear along with the current liabilities. Long-term liabilities thus include loans and notes or bonds payable. Whereas, liabilities such as bonds issued by a company are usually reported at an amortised cost on the balance sheet.
Hence, option B is correct.
To learn more about the balance sheet here:
https://brainly.com/question/26323001
#SPJ1
A _________________________ are minor offenses of the law. these can include jaywalking, lettering, or parking in a restricted zone. an infraction normally results in a ticket, which requires the person to pay a fine.
misdemeanor
infraction
felony
penal code
Answer:
Minor offense means any unlawful act that is a status offense or would be a misdemeanor, infraction, or violation of a municipal or county ordinance if the youth were an adult.
Ano ang kahulugan ng talos-tanod
Answer:
Here is the answer..
TALOS-TANOD
A criticism of interest-group pluralism is its class bias in favor of those with greater financial resources.
The best description of the ideal of pluralism is that interests should be free to compete with each other for governmental influence.
When a renown political scientist said, "The heavenly chorus of interest groups sing with a distinctly upper class accent," he meant that
the theory of pluralism ignores the fact that the wealthy are better organized than the poor.
The Teamsters and the AFL-CIO are examples of what kind of interest group?
a labor group
The National League of Cities is a good example of a public sector interest group.
Approximately how many members does the AARP have?
35,000,000
Interest groups most effectively serve
the upper classes.
What are political parties more capable of doing than interest groups?
organizing people on a massive scale
Which of the following are lobbyists NOT required by federal law to disclose?
All of the above must be publicly disclosed.
(who they are working for; how much they are paid; who they are lobbying)
What is the most important and beneficial resource that lobbyists provide government officials?
information
When interest groups take out advertisements and hold marches, these are examples of
mobilizing public opinion.
In recent years, the religious Right has had great affect on American politics through
grassroots mobilization.
What is the primary function of a political action committee?
to raise and distribute money to election campaigns
The fact that interest groups favor the wealthy and well educated can be understood as a reflection of what eternal dilemma in American politics?
Liberty is often inconsistent with equality. What contemporary political scientists call an interest group, James Madison called a/an
faction.
Interest groups, also known as factions, are organizations with a common interest that seek to influence government policies or decisions.
They are not explicitly part of the government, but they often act as a form of representative democracy by allowing citizens to have a voice in the political process.
Interest groups can be beneficial in that they help bring attention to specific issues, mobilize public opinion, and provide information to government officials.
However, they can also be problematic in that they often favor the wealthy and well-educated and are therefore biased in favor of the upper classes. This unequal representation can undermine the principles of democracy and create a lack of accountability in government. Ultimately, interest groups can be both beneficial and problematic, depending on how they are utilized and who benefits from their influence.
Learn more about factions:
https://brainly.com/question/25628707
#SPJ4
Niki donated 4 5/8 pounds of beans to the food drive and Annie donated 3 2/3 pounds of beans to the food drive. Together, how much food did they donate?
Answer: 8⁷/₂₄ pounds of beans.
Explanation:
First convert both fractions to improper fractions.
4 ⁵/₈ = 37/8
3²/₃ = 11/3
Find the lowest common multiple of 3 and 8 which is 24.
Use 24 as the denominator and add the fractions by multiplying the numerator by the result you get from dividing 24 by the denominator:
\(= \frac{111 + 88}{24} \\\\= \frac{199}{24} \\\\= 8\frac{7}{24} pounds of beans\)
pwease pick me as brainliset :((((((((((((((((((((((((((((((((((((((((((((((((((
Complete the following sentence using the most appropriate words.
The base pairing in DNA is specific. Adenine pairs with_________
and cytosine pairs with _________
.
Answer:
The four different bases pair together in a way known as complementary pairing. Adenine always pairs with thymine, and cytosine always pairs with guanine.
Explanation:
Answer:
thymine then guanine.
Explanation:
Being charged with identity theft in a court of law:____.a. is only a state misdemeanor b. is always a federal crime c. results in prison penalties up to 20 years d. results in a maximum fine of $300,000
Being charged with identity theft in a court of law - results in a maximum fine of $300,000
The unauthorized seizure of another person's property with the purpose to permanently rob them of it is considered theft in law. This might include real assets like cash or personal property as well as intangible assets like trade secrets or private data. Depending on the jurisdiction and the specifics of the incident, theft is a serious felony that may be punished with fines or imprisonment.
The maximum sentence for identity theft in federal court is 15 years in federal prison, but identity theft cases sometimes also involve other counts that might lengthen the prison term.
For such more question on theft:
brainly.com/question/30293258
#SPJ4
if a bill is given to the president, what are his/her options to do with the bill?
The president has three main options when they receive a bill: 1. Sign the bill. 2. Veto the bill. 3. Take no action.
The president has three main options when they receive a bill:
1. Sign the bill: If the president agrees with the bill, they can sign it, which turns it into law. This is the most straightforward option.
2. Veto the bill: If the president disagrees with the bill, they can veto it, which sends it back to Congress with their objections. Congress can then attempt to override the veto with a two-thirds majority vote in both the House and the Senate. If they succeed, the bill becomes law despite the president's veto.
3. Take no action: If the president neither signs nor vetoes the bill within ten days (excluding Sundays) while Congress is in session, the bill automatically becomes law. However, if Congress adjourns within those ten days and the president takes no action, it results in a "pocket veto," and the bill does not become law.
These are the primary options a president has when presented with a bill.
Know more about the president here:
https://brainly.com/question/924435
#SPJ11
What is a great concern requiring increased oversight? a Ability of bureau to criticize the president b Ability of bureau to create own rules c Ability of bureau to make policy d Ability of bureau to spend unlimited funds
A great concern requiring increased oversight is the ability of a bureau to spend unlimited funds. Option D is correct.
The ability of a bureau or agency to spend unlimited funds can be a significant concern that requires increased oversight. Unrestrained spending without proper checks and balances can lead to financial mismanagement, waste, and potential abuse of resources.
Overspending can also contribute to budget deficits, accumulating debt, and an inefficient allocation of taxpayer funds. Increased oversight is necessary to ensure responsible fiscal practices, transparency, and accountability in the use of public resources.
It helps prevent excessive spending, promotes financial discipline, and ensures that funds are allocated in line with the bureau's objectives and priorities while avoiding fiscal imbalances.
Therefore, option D is correct.
Learn more about unlimited funds https://brainly.com/question/25845070
#SPJ11
what is not considered a casualty event, regardless of whether a casualty loss or gain will be allowed?
Answer:
Generally, you may deduct casualty and theft losses relating to your home, household items, and vehicles on your federal income tax return if the loss is caused by a federally declared disaster declared by the President. You may not deduct casualty and theft losses covered by insurance, unless you file a timely claim for reimbursement and you reduce the loss by the amount of any reimbursement or expected reimbursement.
Explanation:
Name three observations about fluids at a crime scene which will enable an investigator to make reasonable predictions about what took place.
Answer & Explanation:
1.DNA, Saliva/ Semen (Can Be Tested)
2.Blood Splatter (Can Make A Prediction)
3.Drinks Such As Beer (Can Predict If They Were Under The Influence)
Can people get divorced without hiring an attorney.
An individual’s BAC depends on a persons
An individual’s BAC depends on a persons number of drinks. the he more you drink, the higher the BAC.
Effects of various blood alcohol concentrations on the body:
Blood alcohol levels depend on a variety of variables, including the quantity of drinks consumed, body weight, gender (females have greater blood alcohol levels than males when they consume the same amount of alcohol), and number of drinks. Furthermore, drinking alcohol with meals and sipping it as opposed to consuming it quickly lowers the peak blood alcohol level.
Food not only lowers blood alcohol levels but also encourages the liver to eliminate them. Alcohol dehydrogenase converts alcohol first into acetaldehyde, which is then converted into acetate by aldehyde dehydrogenase.
Learn more about BAC , here;
https://brainly.com/question/32115406
#SPJ6
What time is long run aggregate supply set to?
One Month
One Year
10 Years
O None of the Above
The time that the long run aggregate supply is set to is D. None of the Above
What is the long-run aggregate supply?The long-run aggregate supply (LRAS) curve depicts the relationship between price level and real GDP that would be supplied if all prices, including nominal wages, were fully flexible; prices can change along the LRAS, but output cannot because it reflects full employment output.
Labor changes, capital changes, natural resource changes, and technological changes are all factors that affect long-run aggregate supply. It should be noted that there's no set time for the curve.
In conclusion, the correct option is D.
Learn more about supply on:
https://brainly.com/question/4803223
#SPJ1