Heat is a measure of _____________ _____________.
A)kinetic energy
B)potential energy
C)thermal energy

Answers

Answer 1

Answer:

C)thermal energy

Explanation:

Answer 2

Answer:

thermal energy

Explanation:


Related Questions

what happens directly after metaphase

Answers

Answer:The third phase of mitosis, following metaphase and preceding telophase, is anaphase. Since the sister chromatids began attaching to centrosomes on opposite ends of the cell in metaphase, they're prepped and ready to start separating and forming genetically-identical daughter chromosomes during anaphase.

Explanation:

Answer:

The next phase is anaphase. The chromatids separate at the centromere. The spindle fibers begin to pull them to opposite sides of the cell.

Explanation:

Name 2 tructure ,viible with a light microcope, which ditinguih plant cell from animal cell

Answers

The cell wall and the vacuoles are the two features that can be seen under a "light microscope."

The cell membrane is present underneath the cellulose-based cell wall in plant cells, but only the cell membrane is present in animal cells. The plant cell is larger than the animal cell because it has more vacuoles than the animal cell does, which makes them different in size. Additionally, the vacuoles occupy a "large volume" of the cell.

To learn more about cell click here:

https://brainly.com/question/14957605

#SPJ4


1. What are the similarities between all cells?

Answers

Answer:

Similarities between all cells.

*All cells contains a cell membrane.*All cells have a vacoule.*All cells contains cytoplasm.Hope it helps.

drag each label to the appropriate position to indicate which muscle is being identified.
Medial rectus muscle Musle responsible for crossing one's eyes Lateral rectus m. Interior rectus m Superior oblique m. Inferior oblique m Damage to the trochlear nerve causes inability to contract this muscle Superior rectus m. Inability for this eyeball to look right would indicate dysfunction of this muscle Muscle responsible for looking up Damage to cranial nerve VI causes inability to contract this muscle

Answers

The muscular structure of the eye is made up of six muscles that are attached to the sclera of each eye and are responsible for all eye movements.

We associate the identified muscles with the concepts or functions performed by each one, as follows:

1) Medial rectus muscle: muscle responsible for crossing the eyes.

2) Lateral rectus muscle: The inability of this eyeball to look to the right would indicate a dysfunction of this muscle.

3) Superior oblique muscle: Trochlear nerve injury results in the inability to contract this muscle.

4) Superior rectus muscle: Muscle responsible for looking upward

5) Cranial nerve VI damage: Causes inability to contract the lateral rectus muscle.

The orbicularis oculi muscles are located around the eyes and are located under the skin.  The six extraocular muscles that are responsible for moving the eyes are as follows:

Superior rectus Inferior rectus Medial rectusLateral rectus Superior oblique Inferior obliques

Learn more about muscular structure of the eye at https://brainly.com/question/4074166

#SPJ11

2. SEP Use Mathematics Using the Math
Toolbox table, complete the equation below
to calculate how much more blood flows per
minute to the skeletal muscles during intense
exercise than during rest.
exercising =
resting = 1,200 cm³/minute
1,200
cm³/minute
4.CC
bla

Answers

Answer:

Explanation:

To calculate how much more blood flows per minute to the skeletal muscles during intense exercise than during rest, we need to use the following formula:

exercising - resting = increased blood flow

Substituting the given values, we get:

exercising - resting = increased blood flow

exercising - 1,200 cm³/minute = 4.CC

To solve for exercising, we need to isolate the variable on one side of the equation. Adding 1,200 cm³/minute to both sides, we get:

exercising - 1,200 cm³/minute + 1,200 cm³/minute = 4.CC + 1,200 cm³/minute

exercising = 4.CC + 1,200 cm³/minute

Therefore, the equation to calculate how much more blood flows per minute to the skeletal muscles during intense exercise than during rest is:

exercising = 4.CC + 1,200 cm³/minute

what method did jesus use to lead the rabbis to a clearer understanding of God's plan? ​

Answers

Jesus used the parables to lead the rabbis to a clearer understanding of God's plan.

In christian religion, Jesus used a method of teaching called parables to expatiate a most topics he handled. This was for the better understanding of God's plans.

The parables are defined as the short stories that demonstrates a moral lesson.

A typical example of a parable used by Jesus is the parable of the lost coin.

Here Jesus told a story of a woman that had ten coins and lost one of them. He said that the woman searched carefully until she finds it. she went ahead to call her neighbors to rejoice with her as she has found the lost coin.

In this parable, Jesus passed a clearer understanding of God's plan for a repented sinner. HE said that there is rejoicing in the presence of God over one sinner who repents.

Learn more here:

https://brainly.com/question/13254758

What types of energy occurs when a grapefruit falls from a tree? TRUE OF FALSE: Combustion reactions occur in the presence of oxygen gas. * Energy is the ability to do work. * A renewable energy source is one that is replaceable. * Light energy is emitted by certain organisms such as fireflies and glow-worms. Sound energy cannot travel through air Heat energy cannot travel through a liquid for example water.

Answers

Answer:

The energy conversions that occur when a grapefruit falls from a tree is;

Potential energy ---> kinetic energy ---> potential energy

Combustion reactions occur in the presence of oxygen gas- True

Energy is the ability to do work - True

A renewable energy source is one that is replaceable - True

Light energy is emitted by certain organisms such as fireflies and glow-worms - True

Sound energy cannot travel through air - False

Heat energy cannot travel through a liquid for example water - False

Explanation:

According to the first law of thermodynamics, energy can not be created nor destroyed but is converted from one form to another. When a grapefruit falls from a tree, the energy conversion is as follows;

Potential energy ---> kinetic energy ---> potential energy

Combustion reaction refers to a reaction where a substance is burnt in oxygen to produce heat and light.

Energy is defined in science as the ability to do work. Renewable energy can be replaced. A typical example is solar energy.

Light energy is emitted by certain organisms such as fireflies and glow-worms.

Sound is a mechanical wave hence it must be transmitted through a medium. The medium through which sound waves are transmitted is air.

Heat travels through any thermal conductor. Water is an example of a good thermal conductor. Heat indeed travels through different liquids.

in her work astroculture (shelf life) bioartist suzanne anker experiments with growing plants in artificial light for use in .

Answers

In her work "Astroculture (Shelf Life)," bioartist Suzanne Anker experiments with growing plants in artificial light for use in artistic and scientific purposes.

Suzanne Anker's artwork "Astroculture (Shelf Life)" involves her exploration of growing plants in controlled environments using artificial light. This process allows her to study the effects of different lighting conditions on plant growth and investigate the possibilities of sustainable cultivation. Anker's work blurs the boundaries between art and science, as she combines artistic expression with scientific inquiry. The plants grown in artificial light serve as both subjects and materials for her artistic creations, highlighting the intersections between nature, technology, and human intervention.

You can learn more about Astroculture at

https://brainly.com/question/30025156

#SPJ11

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Answers

The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.

In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.

In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.

The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.

It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.

For more such answers on RNA

https://brainly.com/question/13939644

#SPJ8

cancer is a disease in which cells?
A. grow and divide on controllably.
B. die before they can mature
C. start producing DNA.
D. die during Mitosis

Answers

A grow and divide uncontrollably.

Answer:

A

Explanation:

cancer cells divide uncontrollably

A chromosomes contains ________ and ___________organic molecule ​

Answers

Answer:

A chromosome consists of DNA and genetic organic molecules.

The crab Lynda tell Ella ya carries a pair of sea anemones on its claw. The crab uses the sea anemones stinging tentacles as protection and the sea an enemy obtain small food particles released by the crab as it feeds which type of symbolic relationship does this best illustrate

Answers

Answer: Mutualism

Explanation: The relationship between the crab and the sea anemone describes mutualism, a type of symbiotic relationship.

Mutualism describes the ecological interaction between two or more species that benefits both; typically involving the exchange of substances or services between both.

It plays a key role in ecology and is thought to have driven the evolution of much of the diversity currently in existence today.

¿Es normal el efecto invernadero?

Answers

Answer:

i think it is

Explanation:

its because greenhouse effect is a natural process which warms the Earth's surface. When the Sun's energy reaches the Earth's atmosphere, some of it is reflected back to space and the rest is absorbed and re-radiated by greenhouse gases.

The male grouse makes a drumming noise by using its wings to beat the air. What is the behavior communicating?

Answers

Answer:echolocation i think

Explanation:

Larger SI units of measurements that we'd use to measure a football field are …..

Answers

A football field would be best measured in feet, yards, or meters.

Hope my answer helped u :)

Answer:

Larger SI units of measurements that we'd use to measure a football field are

feet, yards, or meters

Explanation:

(b) The table shows the percentage of gases in air as it is breathed in and breathed out. carbon dioxide other gases gas oxygen breathed in % 0.04 78.96 21.00 breathed out % 78.96 Predict the percentages of carbon dioxide and oxygen in breathed out air. Write your answers in the table. ​

Answers

The percentage of other gases remains constant, as they are not consumed or produced during respiration.

During inhalation, the percentage of oxygen in the air is 21.00%, while during exhalation, a significant portion of it is used up by the body's cells in cellular respiration. Therefore, the percentage of oxygen in exhaled air is only 78.96%.

During cellular respiration, carbon dioxide is produced as a waste product, and it accumulates in the body. When we exhale, we release this carbon dioxide into the air, which increases the percentage of carbon dioxide in exhaled air to 4.00%.

Learn more about gases, here:

https://brainly.com/question/30449090

#SPJ1

Which of the following correctly indicates the order in which mitosis occurs?

A, B, C, D
B, A, C, D
C, B, A, D
A, C, B, D
Other:______________________________

Which of the following correctly indicates the order in which mitosis occurs?A, B, C, DB, A, C, DC, B,

Answers

Based on my knowledge I would say C, B, A, D

the chromosomes replicate themselves, then they line up at the metaphase plate, then they begin to pull apart to form daughter cells

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

What are the effects of the following in controlling the pollution (20 Marks)

a) Non-conventional energy resources

b) Bio-degradable waste

Answers

Non-conventional energy resources: Reduce emissions, dependence on fossil fuels, and improve air quality; biodegradable waste: divert landfill waste, produce renewable energy, enrich soil, prevent water contamination.

Non-conventional energy resources like solar and wind power reduce greenhouse gas emissions, lower dependence on fossil fuels, and enhance air quality by reducing pollutants. Biodegradable waste management diverts waste from landfills, reducing methane emissions, and can be utilized to generate renewable energy.

Additionally, composting biodegradable waste enriches soil, promoting sustainable agriculture and reducing reliance on chemical fertilizers. Proper waste management prevents water contamination by minimizing organic pollutants and nutrient runoff. By adopting these practices, we can mitigate climate change, improve air quality, produce clean energy, support sustainable agriculture, and protect water resources, leading to a healthier and more sustainable environment.

To learn more about biodegradable follow the link:

https://brainly.com/question/16613893

#SPJ4

after muscular exercise , which blood vessel carries the highest concentration of carbon dioxide ?

Answers

Answer:

The Pulmonary artery

Explanation:

because it carries blood that has oxygen that has been used by body cells which give out CO2, the blood then gets to heart by Vena Cava and then it is carried to by pulmonary artery to lungs and then co2 is expelled out of lungs and O2 is taken in.

Together, erosion and deposition help shape sand dunes, ____ and deltas.

Answers

Together, erosion and deposition help shape sand dunes, canyons, and deltas.

A classification system is shown below. Which characteristic places the king snake in a different class than the giant panda?:

A: It is not a mammal

B: It does not have a spine

C: It eats other animals

D: It sheds its skin​

A classification system is shown below. Which characteristic places the king snake in a different class

Answers

Answer:

A. A snake is not a mammal

Explanation:

as far as the other options are concerned they are shared by the other animals and as for D the scientific names have nothing to do with shedding skin

What is a destructive force? give me some examples. plsssssss i neeeed help

Answers

Answer: Destructive Force: Weathering

The process of breaking down rocks and land is due to forces such as gravity, wind, water, and ice. When it rains, rocks are washed down a mountain or down a stream. Soils are washed away. The ocean beats against a cliff and breaks it apart. Destructive Forces: processes that destroy landforms.

Ex. landslides, volcanic eruptions, earthquakes, floods.

Explanation: Research

What is Meaning of green revolution

Answers

\(\bold{Hello}\)~

\(\color{green}\huge\bold\star \mathcal{ \: Answer \: }\star \)

What is Meaning of green revolution?Green revolution is defined as an increase in crop production because of the use of new varieties of seeds, the use of pesticides and new agricultural techniques.

\(\color{green}\bold\star \mathcal{ \: Hopeithelps \: }\star \)

\(\bold{-Kei}\)~

What was the experience like traveling west on the wagon trail?

Answers

Answer:

horrific.

Explanation:

not only did some people end up running out of food, but they saw their loved ones die from disease, being too cold, malnutrition, the ride was obviously not at all smooth, there could have been massive snow/rain storms. not a good time.

please mark as brainlest.

Describe what a neutral atom is

Answers

It is an atom with a charge of 0 because a positive atom would be +1 charge and a negative atom would be -1 charge. So neutral would just be 0

Suppose a population of mostly sand-colored crabs migrates from a sand beach to a pebble beach and evolves a darker, speckled coloration that closely resembles the pebble beach. This is an example of

Answers

The given scenario of sand-colored crabs migrating to a pebble beach and evolving a darker, speckled coloration that closely resembles the pebble beach is an example of Natural Selection.

What is Natural Selection?

Natural selection is a process by which the individuals of a species that are best suited to their environment survive and reproduce most successfully, while those that are poorly adapted do not survive and reproduce. It is a natural process that results in the survival of the fittest organisms.

Natural selection is the process that enables organisms to adjust to changes in their environment over time. It happens because the environment changes constantly, and the organisms that are better adapted to these changes will survive and reproduce, passing on their advantageous characteristics to their offspring. This leads to the evolution of new species that are better adapted to their environment, allowing them to survive and thrive.

learn more about Natural Selection here

https://brainly.com/question/23929271

#SPJ11

How is the process of protein synthesis similar to the process of programming a computer? How is it different?

Answers

Answer:

Protein synthesis is the process in which cells make proteins. It occurs in two stages: transcription and translation. ... Translation occurs at the ribosome, which consists of rRNA and proteins. In translation, the instructions in mRNA are read, and tRNA brings the correct sequence of amino acids to the ribosome.

Both the synthesis of proteins and computer programming entail a series of instructions that lead to a particular output.  While programming a computer and making proteins have some parallels, they are essentially separate activities that take place in different domains and use different tools and procedures.

What are the similarities and differences between proteins and computer programming?

Similarities between proteins and computer programming:

Protein synthesis and computer programming both involve a series of instructions that are carried out in a particular order to get the intended result.Both processes need input data to produce output, and both processes require input data.Both methods rely on a language or code that is used to specify the instructions.

Differences between proteins and computer programming:

Protein synthesis is a biological process that takes place inside of cells, whereas computer programming is a human-made activity that takes place inside of a machine.DNA and RNA are used in protein synthesis, just as a programming language is used in computer programming.Ribosomes, tRNA, and amino acids are used in protein synthesis to create proteins, whereas compilers, interpreters, and machine code are used to create programme for computers.

Therefore, both the synthesis of proteins and computer programming entail a series of instructions that lead to a particular output.

Learn more about Protein synthesis, here:

https://brainly.com/question/29763759

#SPJ2

Why do you think pigs have similar endocrine glands to humans? Do you think
fish have similar endocrine glands to humans? Why or why not?

Answers

Answer:

Pigs have similar endocrine glands (such as the pituitary gland, pancreas, and adrenal gland) to humans because they are both mammals, and share many common biological similarities, including a complex nervous system, respiratory system, and cardiovascular system. This similarity also extends to their hormone systems.

On the other hand, fish do have endocrine glands, but they are not necessarily similar to those found in humans. Fish have a completely different set of hormones, and their endocrine glands serve very different functions than those found in humans. While some hormones may be similar between fish and humans, their endocrine systems are too distinct for a direct comparison.

NEED HELP ASAP PLEASEEE!!
Which item is NOT part of an effort to reduce health care workers exposure to hazardous chemicals?
A: protective storage
B: sterilization agents
C: pre-measured doses
D: needleless administration

Answers

Answer:

D: needleless administration

Explanation:

Answer: sterilization agents

Explanation:

Just the assignment

Other Questions
When collecting temperature as a function of time for the reaction of KOH with HCL, which time is most significant ______ integrate advertisements as billboards, logos, or storefronts inside a game. the economic model of aggregate demand and aggregate supply helps explain the: responses shifts in real gdp and the price level. shifts in real gdp and the price level. the price of different products in the market. the price of different products in the market. expansion and contraction in individual markets. expansion and contraction in individual markets. three goals of economic policy which are economic growth, high inflation, and full employment. Students will recover faster from common viral illnesses (e.g., a cold) if they continue the same level of training with no additional rest. Property rights are well established for O a. private goods. O b. public goods. O c. common resources. Od. both (b) and (c). d+6cC=8 D=4 I need help please DIRECTIONS: Rewrite the following sentences correcting the misplaced modifier.1. Jessica figured what is wrong in the sentence after a few minutes.2. After seeing its, expression, Moira and Meinard gave the food to the dog on a large plate.3. The hunter waited for the birds from the tree with a bow and arrow.4. Lorna put all the books inside her cabinet that she bought from the bookstore.5. Sandy finally buys the clothes pondering about its price. Select the suitable process for the following: - Materials removal from two parallel vertical surfaces. O Milling - Straddle O Extrusion process In Act II of Julius Caesar, what does Cassius mean when he says, "Mark Antony, so well beloved of Caesar, should outlive Caesar. We shall find of him a shrewd contriver."? After Caesar is killed, Antony should appoint the new ruler of Rome. Antony is a good candidate to rule Rome when Caesar is gone. Antony should be the leader of the plot to overthrow and kill Caesar. Even if they kill Caesar, Antony will be just as difficult to control. compare the carboniferous period to the devonian period. thanks for answering :] When the price of candy bars decreased from $0.75 to $0.60, the quantity demanded changed from 5,000 per day to 5,500 per day. In this price range, the price-elasticity coefficient (based on the midpoint formula) for candy bars is Find the value of x.60 130The value of x is type your answer... ski incorporated owns 30 percent of snow incorporated, both of which are domestic c corporations. snow pays ski a dividend of $20,000 in 2022. what is the amount of ski's dividend's received deduction, assuming the taxable income limitation does not apply? ________ strategies regard a city, state, country, or other locale as a brand. Simulations of portions of the left temporal love of the brain during surgery will cause the patient to? Find the lateral area of a regular hexagonal pyramid with a base edge of 9 centimeters and a lateral height of 7 centimeters. How many racial categories did the 1850 u. S. Census make available?. Please please help me suggest a way in which asif could have measured the ph solution In the logistic equation dN/dt = rN ((K-N)/k) , r is a measure of the populations intrinsic rate of increase. It is determined by which of the following? A) birth rate and death ratesB) dispersionC) densityD) carrying capacityE) life history