Harlow's experiments were very controversial and some cite them as one of the causes of the animal rights movement. Last week you learned

about the different research methods used by psychologists: experiments, natural observation, case studies, and surveys.

Do you think Harlow could have studied the question of motherhood in a more ethical manner? If so, what method could he have used instead?

If not, write a post defending Harlow's choice to conduct his experiment in this way.

Answers

Answer 1

The correct answer to this open question is the following.

I think Harlow could have contemplated a different approach in studying the question of motherhood in a more ethical manner. However, he never thought of doing damage to the animals on purpose.

When you do research, there could have been methods that are questionable but that is when you have to look for the intention is the scientist. When dealing with animals, you have to be very careful to never make them suffer. Now, regarding psychological suffering, here we have a controversial issue.

So after these considerations, Harlow's choice to do his research was good for that time. He had the support of the University of Wisconsin, in Madison WI. The rhesus macaque never suffered from physical damage. I think the fact that Harlow would use two inanimate mothers for the experiment, was the best approach at that time, although it is understandable that people who loved animals began to question his methods and started some protests.


Related Questions

what are five functions of recreational Institution?​

Answers

Answer:

1.political institution

2.religious institution

3.educational institution

4.economic institution

5.recreational institution

Explanation:

Hope it helps for you

Answer:

organized system of social relationships for satisfying human desire of entertainment, amusement and play. an area of land containing sleeping accommodations and facilities used for both passive and active forms of recreation, which without limiting the generality of the foregoing, shall include, but shall not be limited to the following: children's camp, religious camp, institutional camp,

Explanation:

A woman was jogging along a jogging path. Suddenly, a driver pulled out of an alley perpendicular to the jogging path and failed to stop at a stop sign. He hit her with his car, injuring her. The woman sued the driver. A city code provided that drivers must stop at all stop signs perpendicular to the jogging path.

On the basis of which standard of care will the driver be judged?

A) Strict liability, because an automobile is an inherently dangerous instrument.
B) That of a reasonable and prudent person under the facts of this situation.
C) The standard set by the city code.
D) The doctrine of res ipsa loquitur, because it can be presumed that nobody would fail to stop at a stop sign in the absence of negligence.

Answers

Answer:

C). The standard set by the city code.

Explanation:

As per the given descriptions, the driver will be judged on the basis of 'the standard norms set under the city regulations.' Since the city code clearly declares that the drivers are required to stop at every signboard of stop, the driver will be charged under the violation of the city code that also led to the injury of the woman. The verdict will be given on the basis of the common regulations of the city and the respective punishments for the violations or breaches of different laws under these codes. Thus, option C is the correct answer.

ways of making country beautiful​

Answers

Answer:

be a loyal citizen. seRioSly,that is all it takes.

Why was the goal of the constitutional convention?

Answers

Answer:

The convention was divided over the issue of state representation in Congress, as more populated states sought proportional legislation, and smaller states wanted equal representation.

Explanation:

Which of the following best describes an advantage of federalism?

Answers

Answer: System of cooperation

Explanation:
If it's not, it's just easier to see with the answer choices.

What effect did the king family have on the fate of king's mother's killer.

Answers

Answer: The King's family saved his life and spared him the death penalty. Alberta Williams King, the mother of Martin Luther King, Jr. was shot and killed during a church service by Marcus Wayne Chenault six years after the association of her son (1974)

which cultural traits are commonly found among the people of brazil?

Answers

Answer:

Strong family ties and follow Roman Catholic Traditions.

Explanation:

A physical therapist prepares to assess the balance of a patient with a neurological disorder. the most appropriate method to asses the vestibular component of balance would be?

Answers

Applying a perturbation to change the body's center of gravity is the most suitable way to evaluate the vestibular component of balance.

Perturbation is described as "a disruption in motion that raises the likelihood of a breakdown in the [human movement system]" in NASM Essentials of Sports Performance Training (2019). By exposing individuals to postural perturbations frequently, perturbation training seeks to improve reactive balance control. New research suggests that perturbation training lowers the rate of falls in those with neurological diseases like Parkinson's disease.

One of the most adaptable fitness methods you've ever heard of is perturbation-based balance training. It is advertised as a tool to help elderly persons and others with neurological disorders avoid falling, but it can also help recreational and professional athletes avoid injury and hasten recovery.

To learn more about Perturbation:

https://brainly.com/question/13112482

#SPJ4

what is querrying in agriculture?​

Answers

Answer:

The infomediary logs the problem that the farmer is facing. This entails the several categories such as pest and disease, seed information, fertilizer information etc. ... The infomediary then records farmer's query regarding pest and diseases through the application along with symptoms and other details.

Explanation:

Penny's grandmother has specific instructions that the money she left for Penny should only go to Penny's biological children. Penny wants to follow her grandmothers wishes and asks you to recommend at least three strategies that she can use to make sure Penny's grandmother's instructions are followed.

Answers

Penny can ensure her grandmother's wishes are followed by creating a will or trust, communicating with family, and seeking professional advice. This will preserve the intended legacy for her children.

To ensure that Penny's grandmother's instructions are followed regarding the allocation of the money, Penny can consider implementing the following strategies:

1. Establish a legally binding will or trust: Penny should consult with an attorney specializing in estate planning to create a will or trust that clearly outlines her grandmother's instructions. By including specific language in the document, Penny can ensure that the money is designated only for her biological children.

2. Communicate with family members: Penny should have open and honest conversations with her family members, specifically her immediate relatives and potential beneficiaries. By clearly explaining her grandmother's wishes and intentions, Penny can gain their understanding and support in upholding these instructions.

3. Seek professional advice: Penny can consult with a financial advisor or estate planner to ensure that the money is managed appropriately and in accordance with her grandmother's instructions.

These professionals can provide guidance on investment strategies, tax implications, and other financial considerations to protect and preserve the assets for the benefit of Penny's biological children.

In conclusion, by establishing a legally binding will or trust, communicating with family members, and seeking professional advice, Penny can effectively ensure that her grandmother's instructions regarding the allocation of the money are followed.

These strategies provide a comprehensive approach to honoring her grandmother's wishes and preserving the intended legacy for Penny's biological children.

To know more about will refer here:

https://brainly.com/question/33111602#

#SPJ11

Imagine yourself as the president’s chief of staff. In this lesson, you will research a humanitarian crisis and write a five-paragraph persuasive essay styled as a report for the president of the United States from you, his chief of staff. Using the resources within the lesson, you will choose the three executive departments and/or independent agencies that you believe are best suited to aid the United Nations in securing basic human rights around the world, and request that the president ask Congress to increase its funding. Your report should begin with an introduction briefly discussing the humanitarian crisis you have researched and why the United States should provide help as required by the Universal Declaration of Human Rights. The body of your report should describe the basic duties and functions of each of the departments/agencies you have chosen, and how each department/agency could help serve at least two elements included in the United Nations Declaration of Human Rights.


DOES ANYONE HAVE THIS DONE PLS I NEED IT !!

Answers

The humanitarian crisis that has been researched here would be the lack of freedom and rights for the women in Iran.

What is meant by humanitarian crisis?

This is the term that has to do with the fact that there is the existence of a crisis that has to do with the events that are threatening in terms of the health of persons or the safety of the people of a particular community.

This is the humanitarian conflict6 that requires the help of the United States because women are denied their rights and the freedoms that they have in the Iran society. They are not allowed the ability to dress as they would or appear like they want to be seen.

Read more on humanitarian crisis here:

https://brainly.com/question/12706792

#SPJ1

what was the Chinese dynasty?

Answers

Answer:

Image result for what was the Chinese dynasty?

Historians typically consider the following dynasties to have unified China proper: the Qin dynasty, the Western Han, the Xin dynasty, the Eastern Han, the Western Jin, the Sui dynasty, the Tang dynasty, the Wu Zhou, the Northern Song, the Yuan dynasty, the Ming dynasty, and the Qing dynasty.

Explanation:

Answer: The Chinese dynasty was the bloodline of rulers. There was many dynasties in China, the first being the Qin dynasty, and the last being the Qing dynasty. The dynasty family would rule China, their bloodline succeeding them.

Explanation:

Which statements correctly describe the regions of Africa? Check all that apply. Ethiopia is in Eastern Africa. Cairo is in Southern Africa. Egypt is in Northern Africa. Cape Town is a city in Southern Africa. Nigeria is in Northern Africa.

Answers

Answer:

Ethiopia is in the east, Cairo is NOT in Southern Africa, Egypt is in Northern Africa, and Cape Town is in South Africa. Also Nigeria is more so west, but can be northern depending on how your teacher wants it.

Explanation:

Check a map.

The correct option is A, C, and D. The following statements correctly describe the regions of Africa.

Ethiopia is in Eastern Africa.Egypt is in Northern Africa. Cape Town is a city in Southern Africa.

What is Africa's nickname?

Africa is the oldest continent on Earth that has been inhabited, earning it the moniker "Mother Continent."

East Africa, which is made up of Kenya, Tanzania, and Uganda, and the Horn of Africa, which includes Somalia, Djibouti, Eritrea, and Ethiopia, is an area of sub-Saharan Africa that is located in the easternmost part of the continent.

A land bridge created by the Sinai Peninsula connects the Arab Republic of Egypt to the southwest of Asia and the northeast of Africa.

Cape Town is a port city, the national legislative center of South Africa, and the seat of the Western Cape province.

Thus, A, C, and D are the proper choices. The regions of Africa are accurately described in the mentioned above.

Learn more about Regions of Africa here:

https://brainly.com/question/447621

#SPJ2

What do you mean by 'Charkha Movement launched by Tulsi Meher? What were their objectives? ​

Answers

Answer:

life

Explanation:

i just know it

PLSSS need this to pass course!!!
What does the cartoon reveal about the limitations of states’ power?
Federal law is supreme over state law. Federal law includes oversight of state law. State legislatures need permission from the federal government to pass laws. State legislatures are unable to pass laws that do not align with the federal agenda.

PLSSS need this to pass course!!!What does the cartoon reveal about the limitations of states power?

Answers

From this cartoon what we can agree with is that Federal law is supreme over state law.

What is shown in this cartoon?

The supremacy of the Federal powers is shown in this cartoon. We can see that the states are at logger heads with the federal government because they want to set their own laws with the federal government.

From the reaction in the last part, the state is still unable to do so because the government did not agree.

Read more on the supremacy clause of the government here:

https://brainly.com/question/1481445

#SPJ1

What is popular culture?
A. Merchandise that is sold on the Internet but not in stores
B. Commercial culture, which is mass-produced for mass
consumption
C. Materials that are handcrafted for personal use
D. Programs that are informative but not interesting

Answers

Answer:

B

Explanation:

Im not completely sure but im pretty sure thats what pop culture means..

The Bill of Rights is to the US Constitution as the ______ is to the NC Constitution.

A. Constitutional principles
B. Declaration of Independence
C. The Ordinances of the Convention
D. Declaration of Rights

Answers

The Bill of Rights is to the US Constitution as the Constitutional principles is to the NC Constitution. (0ption A)

What is The Bill of Rights and the  Constitutional principles about?

Both the phrases "constitution" and "bill of rights" describe the rights and authority granted to citizens in the nation

The rights guaranteed by the constitution grant local, state, or federal governments a limited amount of authority to amend the law, impose restrictions on businesses, enlarge rights, and safeguard the public.

The first ten amendments to the US constitution are regarded as the Bill of Rights.

Hence, these amendments legislation provides protection for fundamental liberties and rights such the right to keep and bear weapons, the right to free speech, and the right of the people and the states.

Learn more about  Constitution from

brainly.com/question/453546

#SPJ1

Can someone plz help ?

Can someone plz help ?

Answers

Answer:

urbanization - process in which there is an increase in the number of people living and working in a city or metropolitan area. urban sprawl.

rubal - of or relating to the country, country people or life, or agriculture. How to use rural in a sentence.

urban - "related to a city". In that sense, the term may refer to: Urban area, geographical area distinct from rural areas. Urban culture, the culture of towns and cities, sometimes used as a euphemism for African-American culture.

What is the graduation rate of college athletes in football?

Which advanced search would likely produce the best research material?

graduation rate + college
college football + athletes
graduation rate + college football
college athletes + football

Answers

The best search query for finding research material on the graduation rate of college athletes in football would be "graduation rate + college football".

What is athletes?

Athletes are individuals who participate in competitive physical activities, either as a profession or as a hobby. They train and compete in rigorous physical activities to develop and improve their skills, strength and endurance. Athletes compete with others in their chosen sport or activity to win awards, medals, and recognition. They often represent their countries in international events and strive for excellence in their athletic pursuits. Athletes must be highly disciplined and focused on their goals and objectives in order to reach their full potential. By setting and achieving goals, athletes can reach new levels of personal and professional success.

This query will return results that focus specifically on the graduation rate of college athletes in football, which should provide the most relevant and accurate information on the topic.

To learn more about athletes
https://brainly.com/question/31354892
#SPJ1

True or False: Prince Henry was an explorer himself.

Has to be answered right now

Answers

Prince Henry was an explorer himself - False. Despite the fact that he was not an explorer in the slightest, he is credited for starting what is known as "The Age of Discovery," a tremendous age of exploration.

Why did Prince Henry go on his expedition?

Prince Henry's missions were sent out for a number of reasons. Along with expanding his geographic knowledge and possibly discovering a maritime route to the East, he sought to encounter alleged Christian allies. But he also wished to discover gold. From sub-Saharan Africa, gold artifacts had been travelling to Europe for millennia.

What role did Prince Henry play in global exploration?

Prince Henry obtained the nickname "the Navigator" because of the knowledgeable team of designers and marine specialists he put together to create new ships, maps, and navigational tools. Henry then provided funding for missions to sail the high seas and explore the coast of West Africa using this knowledge.

To know more about prince Henry visit:

https://brainly.com/question/13798000

#SPJ1

If tax revenues are not enough to cover budgeted expenses, the US government must __________.
A.
print money
B.
sell stock
C.
redo the budget
D.
borrow money

Answers

Answer: The answer is D the government must borrow money.

Explanation:

WILL GIVE BRAINLIEST
Which technological advance revolutionized water and railway transportation?

A. Clinton’s Erie Canal
B. Fulton’s steam engine
C. Army Corps of Engineers
D. Cumberland Road

Answers

B. Fulton's Steam Engine

Explanation:

I believe it is B because there were steamboats and steam powered trains as a result.

Astronomers were people who A. animals and their movements B. studied plants C. studied the planets and stars​

Answers

Answer:

C

Explanation:

astro means space or something like that

Answer:

C. Studied the planets and stars.

Explanation:

The definition of an Astronomer is "an expert of or student in astronomy" and the definition of astronomy is "a natural science that studies celestial objects and phenomena"

20 points please help ASAP!
Which statement best describes the message and the creator of this poster from the president told election of 1952? Look at the picture above for the answers and picture please!

20 points please help ASAP!Which statement best describes the message and the creator of this poster

Answers

Answer:

c

Explanation:

ksenia is excited about going to her first sorority formal next month. however, she is concerned that she does not have anything appropriate to wear. since realizing that she needs to get a new dress, ksenia has started paying attention to advertisements, looking at fashion magazines, visiting retail stores, and browsing the web for the latest fashions. ksenia is engaged in:

Answers

Ksenia is looking for external information search.

When a person who is unfamiliar with a product conducts an external search, they consult personal, public, or sources that are heavily influenced by marketers for information.

When a customer is motivated to look for more information throughout the buyer selection process, they may just have heightened attention or engage in an active information search. if you pay attention to things like vehicle conversations, friend's automobiles, and automotive commercials.

By using external data sources, you could gain more insight into what your rivals are doing. You can also learn how market dynamics, consumer behavior's trends, and even the weather can affect your performance.

To learn more about external information search

https://brainly.com/question/8874251

#SPJ4

a researcher has recorded that on the playground, boys are more likely to use physical aggression to get what they want, but that girls are more likely to use verbal aggression to get what they want. this researcher most likely employed a(n) research method.

Answers

A researcher has recorded that on the playground, boys are more likely to use physical aggression to get what they want, but that girls are more likely to use verbal aggression to get what they want. this researcher most likely employed a(n)  observational research method.

Several different types of non-experimental studies in which behavior is routinely observed and documented are collectively referred to as observational studies. A variable or combination of variables must be described to be the focus of an observational study.

A broad goal is to capture the moment of a particular characteristic of a person, group, or environment. No causal conclusions can be drawn from the observational studies, as nothing was modified or controlled as previously described and they are non-experimental. They may be quantitative or both, but data collected in observational studies are often qualitative (mixed method) in nature. Observational studies rely on population samples in which the independent variable is uncontrolled for ethical reasons, personal interference and possibly limitations. Therefore, researchers observe selected populations without manipulation or intervention.

Learn about observational method:

https://brainly.com/question/28844830

#SPJ4

Which of the following best summarizes the relationship of the church and government of the Massachusetts Bay Colony? The government was initially democratic but periodically referred to the church in matters of punishment. They made no distinction between affairs of the state and affairs of the church. They did not believe the Bible should determine punishment in any crime. They believed in the importance of the separation of church and state due to the oppression Puritans felt in England.

Answers

They did not differentiate between church- and state-related matters.

How were the Puritan church and government related in Massachusetts?

The Puritans in Massachusetts Bay advocated for the separation of the state from God, but not between the church and the state.In the government, the Congregational Church lacked any legitimate authority.No government position could be held by ministers.

In what ways did religion influence the government of the Massachusetts colony?

Politics and religion were never separated. Only those who demonstrated that they belonged to the predestined elect were eligible to become full members of the Puritan church. Through the town meeting system, only full church members could participate in government.

Learn more about Massachusetts here:

https://brainly.com/question/13675633

#SPJ1

What are the main powers of congress

Answers

Answer:

Make laws, Declare war , raise and provide public money, impeach and try federal officers, approve presidential appointnments

Explanation:

list five rights protected by the constitution

Answers

Answer:

1. General

2.Criminal trials

3.Civil trials

4. Appeals

5. Nonauthority

Right to counsel , right to a speedy and public trial , right to bear arms , freedom of speech, commerce clause

How does the current system of mass incarceration in the United States mirror earlier systems of racialized social control?

Answers

The current system of mass incarceration in the United States is rooted in earlier systems of racialized social control, particularly those that emerged in the aftermath of slavery and during the Jim Crow era.

What is the article on this?

During the late 19th and early 20th centuries, Southern states implemented a range of laws and practices to maintain white supremacy and control the movements and behavior of black Americans. These included vagrancy laws, which made it a crime for a person to be unemployed and without a fixed residence, and the use of chain gangs, which forced black prisoners to perform hard labor.

In the 1960s and 1970s, as the civil rights movement gained momentum, a new system of social control emerged. This system was fueled by the "War on Drugs," which was launched by President Richard Nixon in 1971. The War on Drugs was a response to rising drug use, particularly among black Americans, and was used to justify harsher sentencing laws and increased police presence in minority communities.

The result of these policies was a dramatic increase in the number of people incarcerated in the United States. Today, the US has the highest rate of incarceration in the world, with over 2.3 million people behind bars. Black Americans are disproportionately represented in the US prison population, making up only 13% of the population but 40% of the prison population.

The parallels between the current system of mass incarceration and earlier systems of racialized social control are clear. Both have been used to maintain white supremacy and control the movements and behavior of black Americans. Both have relied on the criminalization of behaviors that are associated with poverty and racial marginalization. And both have had devastating consequences for black communities, including the loss of voting rights, employment opportunities, and access to social services.

Learn more about slavery at:

https://brainly.com/question/567921

#SPJ1

Other Questions
2a- 1-4 1/3a+ 7-a consider the linear expression what are the like terms in the expression simplify the linear expression For a reader to - two or more things,the reader must consider how the things are different. which is not a correct name to name an angle Please helppp!!! I have this question for geometry and I cant figure it out. "answer two significant figuresA 1500 kg car rolling on a horizontal surface has speed v=76 km/h when it strikes a horizontal coiled spring and is brought to rest in a distance of 2.2 m. Part A What is the spring constant of the spring? Calculate the molarity of lemonade as prepared using the instructions on the back of the container. 583 grams makes 8 quarts. (1 quart = 964.35 mL) PLEASE HELP ASAP WILL GIVE BRAINLIEST!!Describe the path of the electric current through your circuit.Here is my circuit: The temperature T in degrees Celsius varies with position (x,y), in centimeters, on the surface of a flat metal plate. Let T=x^3-3xy^2. Determine the direction and magnitude of the maximum decrease of temperature at the point (1, 0.5). Express each of the given sentences using set notations or functions. 1. Set N is the set of counting numbers less than or equal to 7 . 3. The number 9 is the square root of 81 . 5. The number y is a prime and less than 18. 7. The number x is an even positive number divisible by 4 . 9. Set C is the set of all pure imaginary numbers above the horizontal axis A mono 44.kHZ audio file consumes approximately 5 MB of disk space per minute, what about a 88.2 kHz,16 bit audio file? Using the LCI NREL database, calculate the energy required to produce 1 kg polystyrene resin (CTR) and carbon dioxide released. Using CRADLE-TO-GATE LIFE CYCLE INVENTORY OF NINE PLASTIC RESINS AND FOUR POLYURETHANE PRECURSORS determine the energy required to produce 1 kg general purpose polystyrene resin and carbon dioxide released (process and fuel related). Which set of ordered pairs does not represent a function?A. { (3, 2), (2, 3), (4, 1), (1, 4) }B. { (3, 2), (3, 4), (4, 1), (4, 3) }C. { (3, 2), (4, 3), (5, 4), (6, 5) }D. { (3, 2), (6, 2), (9, 2), (12, 2) } if someone asks you to go to the shop and buy vegetables which are not gm products, how would be able to respond? 2.) Consider a channel considering the subsequent addition of two Bernoulli se- quences B(pi), i = 1,2. a) Determine the resulting bit-error ratio. b) What is the capacity? Rolf, an individual, filed a voluntary petition in bankruptcy. Rolf will not be allowed to go bankrupt if Rolf..... Multiple Choice a. Made preferential transfers to certain creditors within 90 days of filing the petition. b. Filed a fraudulent federal income tax return two years prior to filing the petition.c. Obtained a loan by using financial statements that Rolf knew were false. d. Unjustifiably failed to preserve Rolf's books and records. . ............. was a strong wind yesterday. Many people ............. and cannot go home. a) There, are stranded b) Here, were stranded c) It, are stranded d) It, were stranded Use the vertical line test to determine whether or not the graph is a graph in which y is a function of x. Complement proteins in their intact and nonactivated form act as opsonins by binding to microorganisms and promoting phagocytosis is called:_______ May someone help me with this :) Four relatively recent fossil species were recovered, and when the DNA was extracted, investigators observed that Species W and Z both had long finger bones, and species X and Y had short finger bones. Based upon this information and the hypothetical molecular data below, sequenced from common regions in one gene of their DNA, which two species are the most closely related to each other?Species W:AACATTGCTTTTGTAACGAASpecies X:AACCGCGCGTTTGGCGCGCASpecies Y:AGCAGCGCTTTCGTCGCGAASpecies Z:AACCGCGCTTTTGGCGCGAAA) Species X and ZB) Species W and ZC) Species Y and ZD) Species X and Y