hardship disability under the american jobs creation act of 2004 (ajca), all of the following are allowable reasons to begin distributions under a nonqualified deferred compensation plan (nqdc) except

Answers

Answer 1

Annuities, mutual funds, stocks, and other types of investments are permitted in non-qualified accounts.

What is the advantage of nonqualified deferred compensation plans?

One tax benefit of deferring this income is that you only pay Social Security and Medicare taxes on that component of your remuneration in the year you postpone it, which allows it to potentially grow tax-deferred until you get it.

A nonqualified deferred compensation plan is a type of retirement arrangement that enables a select group of highly compensated employees to benefit from tax advantages by deferring a higher proportion of their pay (and current income taxes) than is permitted under an IRS-approved qualified retirement arrangement.

A nonqualified plan might be a valuable perk that could aid in your efforts to attract and keep top staff. You might profit from nonqualified deferrals because, as the company's owner, you are most likely among the highest paid employees.

A NQDC plan must be created by: Put your strategy in writing: Imagine it as a contract between you and your worker. Include the deferred amount and the date your company will pay it. Select the timing: The circumstances under which your company will pay an employee's deferred wages must be determined.

To learn more about compensation plan, visit:

https://brainly.com/question/27323344?referrer=searchResults

#SPJ4


Related Questions

What is a document called that is filed with the court to state the position of the plaintiff or the defendant in a lawsuit and ask for relief from the court?.

Answers

the Pleading document is filed with the court to state the position of the plaintiff or the defendant in a lawsuit and ask for relief from the court.

What is a pleading document?

Pleadings are the formal legal paperwork that parties must file with the court to begin a case. Typical pleadings include a statement of claim and defense. These types of documents detail your unique claim or defense as well as the facts that support it. In the pleadings, the court and the other parties should be informed of the case's key issues that need to be resolved. This article explains the function of pleadings and the information they include. In the pleadings, all relevant factual assertions that the parties will need to substantiate at trial are made. It's important to remember that a party must include in its pleadings any fact or detail that can surprise the other party or undermine the other party's position.

To know more about the pleading document visit:- brainly.com/question/20814132

#SPJ4

Liebeck v. McDonald's

Do you agree with the end result of this case? Why or why not?

Answers

Liebeck v. McDonald's is a famous case that revolves around a woman named Stella Liebeck who was severely burned by a cup of hot coffee she purchased from McDonald's. She sued McDonald's for serving coffee that was too hot and received a substantial monetary settlement.

In my opinion, the end result of this case was fair. While some may argue that Liebeck should have known that the coffee was hot, the truth is that McDonald's was serving coffee that was significantly hotter than industry standards, which made it more dangerous. The coffee was so hot that it caused third-degree burns on Liebeck's legs and required extensive medical treatment.

The monetary settlement that Liebeck received was not only meant to compensate her for her medical expenses and suffering but also to send a message to McDonald's and other companies to prioritize customer safety over profits. In the end, the case brought attention to the need for companies to adhere to safety standards and provided justice for Liebeck's injuries.

Know more about third-degree burns here:

https://brainly.com/question/30592567

#SPJ11

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT

Answers

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

Give your own view on human trafficking in South Africa

Answers

Answer: Human trafficing is a harsh this that must be stopped that hurts many people and family as well.But trafficking is a reality in South Africa. ... This means victims are trafficked from here to other countries; foreign victims are moved through the country to other areas for exploitation, while foreign victims are brought to the country as their final destination. It is real and I pray it will be stopped!  

Explanation:The University of Johannesburg reports that trafficking occurs at a slightly higher rate for girls than boys, with 55.5% of all trafficked people in South Africa being female, and 44.5% being male. It is estimated that more than three-quarters of all victims are between the ages of 12–25.

Human trafficking in South Africa occurs as a practice of forced labor and exploitation among exported and imported men, women, and children.

What do you mean by human trafficking?

Human trafficking refers to the unlawful act of coercing people so that benefits can be received from their work or service.

Human trafficking in South Africa is a practice of forced labor and exploitation of trafficked men, women, and many children.

Learn more about human trafficking here:

https://brainly.com/question/24024401

#SPJ2

What is the circumference of this circle? 8 × pi 9 × pi 12 × pi 16 × pi

Answers

Answer:

2πr

Explanation:

circumference of this Circle is 2πr

Answer:

First square the radius to give 64 and multiply it by Pi (3.14) to give 201.06... Now divide 201.06 by 4 to give 50.3 cm^2 rounded to

Explanation:

One of the seven principles of the North American Model for Wildlife
Conservation states that wildlife is an international resource. What does this
mean?
A
Wildlife found in the United States and
Canada is owned by North Americans,
B
Dead game animals may be sold throughout
North American without being regulated.
C
Hunting and fishing are managed
cooperatively across state and province
boundaries.
D
Only those persons who have a valid
passport may hunt legally.
lo

Answers

Answer:

C  Hunting and fishing are managed  cooperatively across state and province  boundaries.

Explanation:

According to the North American Model for Wildlife  Conservation, wildlife is a an international resource. No party has exclusive right over it and, therefore, should be shared across state and province boundaries.It advocates that hunting and fishing should be open and free to all citizen regardless of status, or land ownership. However, it also advocates that these activities should be practiced within legal limits and not for commercial purposes.

Considering the North American Model for Wildlife.

Conservation states that wildlife is an international resource. This implies that "Hunting and fishing are managed cooperatively across state and province boundaries."

This conservation of wildlife deals with the management of the wildlife such that there wouldn't be the extinction of wildlife animals.

Also, being international, means, such management should be done beyond individual boundaries of States and provinces across North America, including the United States, Canada, and Mexico.

Hence, in this case, the correct answer is option C "Hunting and fishing are managed cooperatively across state and province boundaries."

Learn more here: https://brainly.com/question/6333981

Explain how Congress could have addressed the increasing cost of insulin prior to 2017.

Answers

Prior to 2017, Congress has complete authority to enact legislation that covers both biologics and certain chemically created goods, such as insulin.  The cost of insulin would have been lower if this legislation and the Biologics Price Competition and Innovation Act had been approved together in 2009.

What is Congress?

Generally, The legislative body of the federal government of the United States of America is known as the United States Congress. It is bicameral, meaning that it is made up of two chambers: the House of Representatives, which is the lower body, and the Senate, which is the upper body. It has its meetings at the Capitol Building in Washington, District of Columbia.

Before 2017, Congress has all of the authority necessary to enact a statute that will not only encompass the chemically created items but also certain chemically produced biologics, such as insulin.

If this legislation and the Biologics Price Competition and Innovation Act had been approved in 2009 together, the cost of insulin may have been brought down to a more reasonable level.

Read more about Congress

https://brainly.com/question/4736734

#SPJ1

Case 4.3, Taylor v. Baseball Club of Seattle, L.P., involved a Mariners fan, Delinda Middleton Taylor, who was injured by a baseball that entered the stands during team warm-ups. The issue in the case was a. whether the risk of injury from an errant baseball was foreseeable to a reasonable person with Taylor's familiarity with baseball. b. whether the ball was thrown into the stands intentionally. c. whether Taylor suffered a legally recognizable injury. d. false imprisonment.

Answers

Answer:

a

Explanation:

Taylor v Baseball club of seattle case was filed by Taylor against Baseball club of Seattle for being negligent. The baseball club in their defence argued that Taylor was quite familiar with the game and the fact that there is a chance that a ball can hit a spectator.

a man buy a land for $ 1,500 after 15 years sold it for $ 45,000 how much he owes the IRS?

Answers

30 or soemthing girl

According to blackmun’s decision, why did the crèche display violate the establishment clause?.

Answers

According to Blackmun's decision, the crèche display violate the establishment clause because it was located inside a county building.

They argued that the presentations violated the primary change's status quo Clause, which says “Congress shall make no law respecting an established order of religion…” The established order Clause changed intended to prevent the government from establishing a national church, or from interfering in the political opinions of church buildings.

The establishment clause prohibits the government from "organizing" a faith. An appropriate definition of "establishment" is doubtful. Historically, it was supposed to prohibit country-backed church buildings, such as the Church of England.

Learn more about the establishment clause here https://brainly.com/question/14225350

#SPJ4

Imagine two young men who commit an act of vandalism. One of them gets caught and goes to jail, but the other is not identified and goes to college. There is a probability that the one who goes to jail may become a criminal while there is possibly an equal probability that the one who goes to college will have a successful life. What does this suggest about the present system? How could one improve it?

Answers

Answer:

This suggest that the current system needs to be improved. Ask the person who was put in jail if he had anyone working with him, in exchange the criminal who was put in jail could have 3-5 years off his sentence.

Explanation:

Pls mark Brainliest with the crown

Dora is driving 15 mph over the speed limit on a busy, crowded street. Paul jaywalks in the middle of the block and as he steps into the street is hit by Dora. In a contributory negligence state, the jury or judge will most likely apportion some percentage of negligence to Dora and some percentage to Paul, and award damages on that basis. A) true XX B) false

Answers

Answer:

True

Explanation:

Contributory negligence in a car accident says that when a pedestrian is jaywalking on the road they are violating traffick regulations.

When they get hit by a car they are not entitled to any financial compensation by the owner of the vehicle.

The person that is harmed does not get any compensation because they were negligent.

However in this scenario Dora was also driving 15 mph above the speed limit.

Since both Dora and Paul were violating traffick laws, the judge will most likely apportion a percentage of the negligence to Dora and some to Paul

Which of the following statements is a fundamental part of supply-side economics?

The economy will only reach equilibrium and prosperity through the self-regulation of the free market.

The government should reduce taxes to promote economic growth by increasing aggregate supply.

The federal government should have a balanced budget every year to protect economic growth.

The government can use deficit spending to increase aggregate demand and pull the economy out of recession.

Answers

The statement that is a fundamental part of supply-side economics is option B. The government should reduce taxes to promote economic growth by increasing aggregate supply.

What is supply-side economic?

Supply-side economics is a macroeconomic theory that projects economic growth can be most effectively fostered by lowering taxes, decreasing regulation, and allowing free trade.

Therefore, the correct answer is as given above.

learn more about supply-side economic: https://brainly.com/question/11773466

#SPJ1

T
F
1. LAW CONSISTS OF RULES THAT GOVERNS/CONTROLS/REGULATES THE
BEHAVIOR/CONDUCT OF THE INDIVIDUAL, THE GROUP, ENTITY/BUSINESS, OR
GOVERNMENT IN SOCIETY AND THAT ARE ENFORCEABLE IN A COURT SYSTEM

Answers

Answer:

True

Explanation:

the law is above everything and everyone in a country thus it controls every aspect of society, government, groups, code of conduct of people and business

which supreme court case in 1869 voted texas’s secession from the union

Answers

There is no Supreme Court case in 1869 that voted Texas' secession from the Union. Instead, Texas seceded from the Union on February 1, 1861, by a secession convention held at the Independence Convention. This led to the Civil War, which lasted from 1861 to 1865.

The Supreme Court had a few cases that dealt with secession and the Civil War, but none voted for Texas' secession.The Supreme Court cases that dealt with the Civil War include:Ex parte Merryman (1861): This case dealt with the suspension of the writ of habeas corpus by President Abraham Lincoln. The Supreme Court ruled that only Congress has the power to suspend the writ of habeas corpus, not the President. However, Lincoln ignored the ruling and continued to suspend the writ of habeas corpus.Ex parte Milligan (1866): This case dealt with the trial by military tribunal of Lambdin P. Milligan, who was accused of aiding the Confederacy during the Civil War.

The Supreme Court ruled that the military tribunal had no jurisdiction to try Milligan because civil courts were still functioning in Indiana, where Milligan was from.Texas v. White (1869): This case dealt with the ownership of U.S. government bonds that were sold by Texas during the Civil War. The Supreme Court ruled that Texas had never actually seceded from the Union, so it still remained a part of the United States. Therefore, the bonds sold by Texas were void, and the federal government had the right to take possession of them.

To know more about Texas' secession visit-

brainly.com/question/30246213

#SPJ11

the idea of ____ remains very popular in the south and the west.

Answers

The idea of "states' rights" remains very popular in the south and the west.

The concept of states' rights is based on the idea that the federal government should have limited power and that individual states should have more autonomy to govern themselves. This idea was central to the political debates leading up to the American Civil War, with southern states arguing for the right to secede from the Union and maintain their own institutions, such as slavery. While the Civil War settled the issue of secession, the concept of states' rights has continued to be an important part of political discourse in the United States.

The popularity of states' rights tends to be strongest in regions with a history of political conservatism and libertarianism, such as the south and the west.

To know more about American Civil War, click here:

https://brainly.com/question/769992

#SPJ11

The Legislative Branch of the United States is NOT entrusted with which of the powers listed below?

Answers

It should be: Command of the Armed Forces is the right answer

Explain the process of empowerment and delegation in criminal justice organizations. Include the role of trust related to delegation and empowerment.

Answers

The process of empowerment and delegation in criminal justice organizations will be from top to bottom or we can say it is from superior to subordinate.

What is delegation?Delegation refers to the shift of authority as well as power from superior to subordinate. Delegation is giving another person the authority to perform a particular activity. It is the process of distributing and delegating work to others and is therefore one of the central concepts of business management.Delegation is the transfer of responsibility for a particular task from one person to another. From a management perspective, delegation occurs when managers assign specific tasks to employees.Hire someone to direct your subordinates and tell them exactly what to do to organize surveys, collect feedback and report back to you so you can make informed decisions.

Thus, by delegating power, authority, and responsibility one can easily empower the criminal justice organizations as one superior is not burdened with all the work instead it is distributed and transferred to every subordinate.

To know more about delegation refer to:

https://brainly.com/question/27823193

#SPJ10

When turning you should give the proper signal

Answers

Yes at least 10 seconds before u turn

in some legal actions, a group or class of individuals with common interests file a suit on behalf of everyone who shares the interest. this is called

Answers

In some legal actions, a group or class of individuals with common interests file a suit on behalf of everyone who shares the interest. This is called a "class action lawsuit."

A class action lawsuit is a legal mechanism that allows a representative group of plaintiffs, known as the class, to bring a lawsuit on behalf of a larger group of individuals who have similar claims or have been similarly affected by a particular issue or harm. The purpose of a class action is to efficiently resolve disputes that involve a large number of people with common legal issues, rather than having each individual file a separate lawsuit.

Class actions are commonly used in cases involving consumer protection, product liability, securities fraud, employment discrimination, and other areas where a group of individuals has suffered harm or damages. By consolidating the claims into a single lawsuit, class actions can promote judicial efficiency, provide access to justice for individuals who may not have the resources to pursue individual claims, and ensure consistent treatment for all members of the class.

To know more about class action lawsuits, click here: brainly.com/question/31229402

#SPJ11

why were the federal courts a central focus of political battles in the early 1800s?

Answers

The federal courts were a central focus of political battles in the early 1800s due to several factors:

Judicial Review: The establishment of judicial review by the Supreme Court in the landmark case Marbury v. Madison (1803) empowered the federal courts to interpret the Constitution and declare laws unconstitutional. This expanded role of the judiciary in checking the actions of the other branches of government led to debates and disagreements over the proper scope of judicial power.

Party Politics: The early 1800s witnessed intense political rivalries and the formation of political parties, particularly between the Federalists and the Democratic-Republicans. The appointment of federal judges, including Supreme Court justices, became a contentious issue as each party sought to shape the federal judiciary in their ideological favor.

Expansion of Federal Jurisdiction: The federal courts' jurisdiction expanded during this period, covering a wide range of cases, including disputes involving states' rights, commerce, and constitutional interpretation. This broader jurisdiction gave the federal courts the power to influence and shape important legal and policy issues, making their decisions highly significant.

Judicial Independence: The concept of judicial independence, ensuring that judges make decisions impartially and free from political interference, became a subject of debate. Critics accused federal judges, particularly those appointed by the outgoing Federalist administration, of partisan bias and sought to curb their influence.

These factors combined to make the federal courts a central focus of political battles in the early 1800s. The desire to shape the judiciary, ideological disagreements over the role of the federal government, and concerns about judicial independence all contributed to the intense political debates surrounding the federal courts during this period.

Learn more about federal courts  here:

https://brainly.com/question/31037815

#SPJ11

Crime is _______-_______ because criminals will react selectively to the characteristics of an individual criminal act. A.offender-specific B.offense-specific C. reward- specific D. risk-specific

Answers

Crime is offense-specific because criminals will react selectively to the characteristics of an individual criminal act. This means that criminals will take into account the specific details of a potential crime.  

Such as the type of victim, location, and potential consequences, before deciding whether or not to commit the crime. Offense-specific crime prevention strategies aim to make it harder or less desirable for criminals to commit specific types of crimes. For example, increasing lighting in high crime areas or adding security cameras to deter potential burglars. It is important for law enforcement agencies to understand the characteristics of specific criminal acts in order to develop effective prevention strategies. By focusing on offense-specific prevention, law enforcement can work to reduce crime rates and keep communities safe.

To know more about criminal acts

https://brainly.com/question/6203610

#SPJ11

the rationale for attempt crimes focuses on what two types of danger?

Answers

Dangerous conduct and dangerous people
The rationale for attempt crimes focuses on two types of danger: the danger of the completed crime and the danger of the attempt itself.

Helen, a regular customer, needs to send money to her grandsons best friend after receiving an emergency call.


Their car broke down while traveling across country. What could you say/ask to determine if Helen is a victim of fraud

Answers

Helen, a regular customer, needs to send money to her grandsons best friend after receiving an emergency call. Their car broke down while traveling across country. We can ask her the following questions:

-Is your grandchild all right? Why didn't he call you directly?

- Do you get to visit or speak with your grandson and his buddy frequently? Aren't you blessed to be so near to them?

We must assess the situation and pose the inquiry in order to determine whether or not Helen is a scam victim. It is quite improbable that her grandson's best friend will call her for assistance rather than the grandchild himself. Because they are so close and frequently interact, they are familiar enough with one another to ask for such assistance, so why not the grandson. If their grandchild can ask for assistance himself and they know their friends well, then the claim is legitimate; otherwise, she may have fallen victim to deception.

We can learn more about such situations here:
https://brainly.com/question/15540434#

#SPJ4

describe wilson and brown's typologies of police and explain how each might perceive the role of discretion.

Answers

Wilson and Brown's typologies of policing describe two different views of the role of police in society.

Wilson's "watchman" view emphasizes the importance of maintaining social order through low-key, minimal intervention, while Brown's "legalistic" view emphasizes strict adherence to the law and aggressive enforcement.

In terms of discretion, the watchman view may be more likely to allow for a wider use of discretion, allowing officers to use their own judgment in certain situations to maintain social order in a low-key manner.

On the other hand, the legalistic view may limit the use of discretion, requiring officers to strictly enforce the law without deviation.

This difference in perception of the role of discretion reflects a broader difference in the way each typology views the role of police in society and the balance between order maintenance and enforcement.

To know more about aggressive enforcement click on the link below:

https://brainly.com/question/7162257#

#SPJ11

the fact that some arsonists are motivated by severe emotional turmoil, antisocial behavior, and psychopathology, supports the claim that arson should be viewed as:
a. a social work problem. b. an intellectual problem.
c. a mental health problem. d. a medical problem.

Answers

The argument that arson should be considered a (an) mental health issue is supported by the observation that some arsonists are driven by intense emotional upheaval, antisocial behavior, and psychopathology.

Which arsonist has the most notoriety?But for certain people, using fire in a negative or destructive way is possible. In 2005, Thomas Sweatt was taken into custody after his identify as the country's most prolific serial arsonist was made public. At least four individuals were killed as a result of his admission to having committed over 340 arsons.Those who purposefully set a house or car on fire are known as arsonists. pyromaniac, firestarter, incendiary are some synonyms. More antonyms for arsonist.The word comes from Law French arsoun (late 13th century), Old French arsion, and Late Latin rsinem, which means "to burn," or (acc.) from the verb ardre. The word "burning" was known as "baernet" in Old English, and Edward Coke has been accused of burning (1640).

To learn more about arsonists, refer to:

https://brainly.com/question/3788903

Which of the following is an example of redistributive policy?a. the Federal-Aid Highway Actb. the Hope Scholarshipc. the Clean Air Actd. the Hawley-Smoot Acte. Head Start

Answers

An example of redistributive policy is the Head Start program. This program is designed to provide early childhood education, health, and nutrition services to low-income families.

An example of redistributive policy is the Head Start program. This program is designed to provide early childhood education, health, and nutrition services to low-income families. The aim is to improve the life chances of disadvantaged children by providing them with quality early education and care. This program is redistributive in nature because it takes money from taxpayers and redistributes it to low-income families. The Hawley-Smoot Act, on the other hand, was a protectionist tariff law that raised tariffs on imported goods, which led to a decrease in international trade and contributed to the Great Depression. The Federal-Aid Highway Act, the Hope Scholarship, and the Clean Air Act are all examples of policies aimed at providing public goods or promoting private investment, rather than redistributing wealth. In summary, redistributive policies aim to redistribute wealth from the rich to the poor, while other policies have different objectives.

To know more about redistributive policy visit: https://brainly.com/question/28347382

#SPJ11

There can be no liberty if the same man or same group has executive, legislative, and judicial control.


This statement describes the principle of --


Republicanism

Limited Government

Federalism

Separation of power

Answers

Answer:

I think it the second one, Limited Government

Explanation:

Hope that worked

separations powers powers i believe


Division of labor is a characteristic of
a. Home-craft business
b. Classroom education
C. Assembly line production
d. Entrepreneurship

Answers

Answer:

d. entrepreneurship

Explanation:

i did the question have a good day may i get brainlest?

your answer is d. entrepreneurship

WILL GIVE BRAINLYIST!
What Enlightenment ideal does this quote show? "That whenever any
Form of Government becomes destructive of these ends, it is the Right of
the People to alter or to abolish it, and to institute new Government .
Declaration of Independence 1776


A.stare decusis
B. federalism
C. separation of powers
D. socal contract

Answers

Answer:

Its D. social contract

Explanation:

Just did the quiz and C was incorrect

Other Questions
What is the temperature of an incandescent lamp filament which of the following best describes the purpose of standardization? the purpose is... group of answer choices to precisely and accurately determine the concentration of a solution. to precisely and accurately determine the volume of a solution. to calibrate the ph sensor using solutions of precisely known hydronium concentration. to calibrate volume markings on a buret. to precisely and accurately determine the acidity constant for an acidic analyte. g what describes lines that run north and south PLEASE ANSWER COMPLETELY!! WILL MARK BRINALIEST!! all friendships will encompass affective components; however, not all friendships will exhibit or express those affective components in the same way. At the end of the trial, the judge will tell the jury the law that applies to the case and which issues they must decide. this is known as jury________________. Explain how Raphael is characterized based on the way Squeaky describes him. The difference if a number and 6 is -11. What is the number?(A) 17(B) -5(C) 5(D) -17 For each of the following situations involving marginal cost (MC) and marginal benefit (MB), indicate whether it would be best to produce more, fewer, or the current number of units. a. 3,000 units at which MC = $10 and MB = $13: b. 11 units at which MC = $4 and MB = $3: Which of the following is the greatest factor that determines climate in any given location?landscape, ocean currents, latitude, wind patterns Find an approximation to (sqrt 3) correct to within 104 using the Bisection method (Hint: Consider f(x) = x 2 3.) (Use your computer code). The channels through which advertising is carried to prospective customers; includesnewspapers, magazines, radio, television, outdoor advertising, direct mail, social media, and the internet.advertising media what is the function of the cloacal fin on the bony fish I need help with this question Write the equation of the line through (5,3) prep to y=1/2x+3 Proper species survive by LIVING ON ROVKS AND MINERALS Why is it important the order we write the vertices of a triangle in a congruent statement? SELECT ALL THAT APPLY! The middle letter is the vertex of the angle. The order tells us what sides are congruent. The order does not matter The order tells us what angles are congruent. Dilate a square with vertices $\left(0,\ 0\right)$(0, 0) , $\left(0,\ 4\right)$(0, 4) , $\left(4,\ 4\right)$(4, 4) , and $\left(4,\ 0\right)$(4, 0) using the scale factor $k=0. 5$k=0. 5. What is the value of the ratio (new to original) of the perimeters? the areas? What is the slope and y intercept of 3x-4y=-16 Select ALL the correct answers.Which two statements accurately describe how the pace impacts tension in the excerpt?A. A fast pace at the beginning builds tension around the missing necklace.B. A fast pace in the middle builds tension as readers learn about MadameLoisel's difficult life.C. A slow pace in the middle eases tension as readers learn about MadamLoisel's difficult life.D. A fast pace at the end slows tension between the women as MadamLoisel learns the diamond necklace was not real.E. A slow pace at the beginning builds tension around the missing necklace.F. A slow pace at the end builds tension between the women as MadamLoisel learns the diamond necklace was not real.