Fungal cells have more in common with Animal cells than they do with
Bacterial cells*

True or false

Answers

Answer 1

Answer:

True

Explanation:

Answer 2

Fungi are heterotrophic, like animals, they are more closely linked to animals than plants. Organisms classified as heterotrophs are unable to produce their own sustenance through photosynthesis.

What is common between Fungal cells and Animal cells?

Inner cell membrane and outer cell wall are the two layers that cover fungus cells.

These two layers resemble animals more so than vegetation. The cell membranes of fungus are composed of lipids and proteins, just like those of animals.

Fungal cells have a nucleus, a cell membrane, cytoplasm, and mitochondria, just like plant and animal cells do. While fungal cells have a cell wall, it is formed of chitin rather than cellulose, just like plant cells.

Therefore, fungal cells have more in common with animal cells is true.

Learn more about Fungal cells here:

https://brainly.com/question/3467098

#SPJ2


Related Questions

Do I have to wear mask in national parks

Answers

Answer:

yes so you want die of corona

Answer:

Yes...

Explanation:

As for safety you need to wear mask in national parks..

If possible than also wear hand gloves ..

Explain the process of the Greenhouse Effect. How does it happen?

Answers

The greenhouse effect is a natural process that warms the Earth’s surface. When the Sun’s energy reaches the Earth’s atmosphere, some of it is reflected back to space and the rest is absorbed and re-radiated by greenhouse gases.

Greenhouse gases include water vapour, carbon dioxide, methane, nitrous oxide, ozone and some artificial chemicals such as chlorofluorocarbons (CFCs).

The absorbed energy warms the atmosphere and the surface of the Earth. This process maintains the Earth’s temperature at around 33 degrees Celsius warmer than it would otherwise be, allowing life on Earth to exist.

Enhanced greenhouse effect

The problem we now face is that human activities – particularly burning fossil fuels (coal, oil and natural gas), agriculture and land clearing – are increasing the concentrations of greenhouse gases. This is the enhanced greenhouse effect, which is contributing to warming of the Earth. Greenhouse effect

Step 1: Solar radiation reaches the Earth's atmosphere - some of this is reflected back into space.

Step 2: The rest of the sun's energy is absorbed by the land and the oceans, heating the Earth.

Step 3: Heat radiates from Earth towards space.

Step 4: Some of this heat is trapped by greenhouse gases in the atmosphere, keeping the Earth warm enough to sustain life.

Step 5: Human activities such as burning fossil fuels, agriculture and land clearing are increasing the amount of greenhouse gases released into the atmosphere.

Step 6: This is trapping extra heat, and causing the Earth's temperature to rise.

Explanation:

The greenhouse effect is a natural process that warms the Earth's surface. When the Sun's energy reaches the Earth's atmosphere, some of it is reflected back to space and the rest is absorbed and re-radiated by greenhouse gases. ... The absorbed energy warms the atmosphere and the surface of the Earth.

compare and contrast prophase of mitosis and prophase of meiosis1?​

Answers

Answer:  

The homologous chromosomes pair together in prophase 1 of meiosis, but they do not during prophase 1 of mitosis. This is achieved by a process known as synapsis, where the similar chromosomes pair according to sequence similarity. The homologous chromosomes are held together by a protein structure known as the synaptonemal complex in a chromosome body known as a tetrad (because it contains 4 replicated chromosomes known as chromatids) or bivalent (if the organism is diploid). This pairing during prophase 1 of meiosis allows recombination to take place between the homologous chromosomes. This occurs early during prophase but the manifestation of recombination only becomes visible during the later stages of prophase 1 and in metaphase 1. Because the chromosomes adopt different structures during prophase 1 of meiosis, this stage is sub-divided into 5 stages: leptotene, zygotene, packytene, diplotene and diakinesis. It is during diplotene and diakinesis that the physical manifestation of recombination can be seen. This is the presence of chiasmata (chiasma, singular). These are the sites where recombination, or exchanges between homologous chromosomes, has taken place. By the end of prophase 1, it is only the chiasmata that holds the homologous chromosomes together. This constriction make the tetrads adopt a variety of structures, the shape of which depends upon the number of chiasmata formed. The tetrads stay in this conformation until metaphase 1. Synapsis, the formation of the synaptonemal complex, the formation of chiasmata does not take place during prophase 1 of mitosis and these processes represent the major differences between prophase of the two nuclear divisions.

Describe six different key issues and their impact on sport and active leisure.


Explain, using relevant examples, the impact of key issues on sport and active leisure.


Analyse the impact of key issues on a selected sport and active leisure activity or business.

Describe six different key issues and their impact on sport and active leisure.Explain, using relevant

Answers

1. Health and safety: Health and safety concerns can impact sports and active leisure activities in a number of ways. For example, a lack of proper safety equipment or training could lead to injuries or accidents. This could result in legal and financial consequences for the individuals or organizations involved.

2. Access and participation: Access and participation issues can impact who is able to participate in sports and active leisure activities. For example, a lack of facilities or resources in certain communities could make it difficult for people to engage in physical activity. This could lead to disparities in health outcomes or opportunities for physical activity.

3. Technology: Advances in technology can impact sports and active leisure activities in a number of ways. For example, new equipment or training techniques could improve performance or make activities more accessible. However, technology can also create new challenges or ethical dilemmas. For example, the use of performance-enhancing drugs or technology could create unfair advantages or health risks.

4. Globalization: Globalization can impact sports and active leisure activities by changing the way they are marketed, consumed, and regulated. For example, international competitions or events can create opportunities for athletes and organizations, but they can also create challenges related to cultural differences or regulatory standards.

5. Environment: Environmental issues can impact sports and active leisure activities in a number of ways. For example, climate change could impact the availability of certain activities or facilities. Environmental degradation or pollution could also impact the safety or quality of activities.

6. Social and cultural issues: Social and cultural issues can impact sports and active leisure activities in a number of ways. For example, discrimination or bias could impact who is able to participate or succeed in certain activities. Cultural differences could also create challenges related to communication or understanding.

The impact of these key issues on sport and active leisure can vary depending on the specific activity or context. For example, health and safety concerns might be more pressing in high-risk activities like extreme sports, while access and participation might be more pressing in communities with limited resources or opportunities. Similarly, the impact of technology might be more significant in sports that rely heavily on equipment or training techniques, while social and cultural issues might be more significant in activities that are closely tied to identity or community.

To analyze the impact of key issues on a selected sport or active leisure activity, it would be necessary to identify a specific example and examine the ways in which these issues are relevant. For example, one could examine the impact of health and safety

Answer:

Six key issues that impact sport and active leisure are:

Social influences: Social influences can impact sport and active leisure in a number of ways. For example, peer pressure can encourage people to participate in sport, while negative stereotypes can discourage people from participating. Social media can also play a role in influencing people's participation in sport, as it can provide inspiration and motivation, as well as a platform for sharing experiences and connecting with others.Economic influences: Economic influences can also impact sport and active leisure. For example, rising costs can make it more difficult for people to afford to participate in sport, while government funding can help to make sport more accessible. The economic impact of sport can also be significant, as it can generate revenue through ticket sales, sponsorships, and broadcasting rights.Healthy lifestyles: Sport and active leisure can play a significant role in promoting healthy lifestyles. For example, regular physical activity can help to reduce the risk of obesity, heart disease, and other chronic health conditions. Sport can also help to improve mental health and well-being.Fashion: Fashion can also impact sport and active leisure. For example, the popularity of certain sports can be influenced by the fashion associated with those sports. The fashion industry can also benefit from sport, as it can provide a platform for promoting new trends and products.Major events: Major sporting events can have a significant impact on sport and active leisure. For example, the Olympic Games can inspire people to participate in sport, while the FIFA World Cup can generate a great deal of excitement and interest in football. Major sporting events can also have a positive impact on the local economy, as they can attract visitors and generate revenue.Disability: Disability can impact sport and active leisure in a number of ways. For example, people with disabilities may face barriers to participation, such as lack of accessible facilities or lack of adapted equipment. However, there are a number of organizations that are working to make sport more accessible to people with disabilities. Sport can also be a valuable tool for people with disabilities, as it can help them to improve their physical and mental health, as well as their social skills.

Here are some examples of how these key issues have impacted sport and active leisure:

The rise of social media has led to an increase in participation in sports such as running and cycling, as people can use social media to connect with others who share their interests.The economic downturn of 2008 led to a decrease in government funding for sport, which made it more difficult for some people to participate in sport.The World Health Organization has identified physical inactivity as a major risk factor for chronic diseases, which has led to increased efforts to promote sport and active leisure as a way to improve public health.The popularity of sports such as yoga and Pilates has led to an increase in the demand for fitness clothing and accessories.The success of the British Paralympians at the 2012 Olympic Games has inspired many people with disabilities to participate in sport.

Here is an analysis of the impact of key issues on a selected sport and active leisure activity or business:

The sport of football has been impacted by a number of key issues, including the rise of social media, the economic downturn of 2008, and the growing popularity of women's football. Social media has helped to grow the fan base for football, as people can use social media to connect with other fans, share news and highlights, and discuss the latest transfer rumors. The economic downturn of 2008 led to a decrease in government funding for football, which made it more difficult for some clubs to operate. However, the popularity of football has helped to generate revenue through ticket sales, sponsorships, and broadcasting rights. The growing popularity of women's football has also had a positive impact on the sport, as it has led to increased participation, media coverage, and sponsorship opportunities.

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Answers

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

help please!! BRAINLIEST AND 10 points!!
Jose fears a bioterrorism attack with the Ebola virus but refuses to get a flu shot, even though he is more at risk of dying from the
flu. Jose has what perception
towards risk?

a. optimism bias

b. degree of controltion

c. catastrophe

d. Instant gratification

Answers

i think a, optimism bias. jose thinks he's immune to the flu, even though he is afraid of diseases in general.

optimism bias. jose thinks he's immune to the flu, even though he is afraid of diseases in general.

What is Optimism Bias?

The ​optimism bias is essentially a mistaken belief that our chances of experiencing negative events are lower and our chances of experiencing positive events are higher than those of our peers.

This phenomenon was initially described by Weinstein in 1980, who found that the majority of college students believed that their chances of developing a drinking problem or getting divorced were lower than their peers.

The optimism bias doesn’t mean that we have an overly sunny outlook on our own lives. It can also lead to poor decision-making, which can sometimes have disastrous results.

Therefore, optimism bias. jose thinks he's immune to the flu, even though he is afraid of diseases in general.

To learn more about optimism bias, refer to the link:

https://brainly.com/question/14766619

#SPJ6

What happens in meiosis during anaphase l

Answers

Answer:

Keep in mind meiosis produces sex cells

- During anaphase the sister chromatids move apart from each other then centromere moves first and the arms follow them, each daughter cell receives a chromatid from the father and another from the mother

Based on this food web, which organisms are direct sources of energy for secondary
consumers?

Based on this food web, which organisms are direct sources of energy for secondaryconsumers?

Answers

Answer:

The answer is Aphid, Bird, and Rabbit.

Why might it be important for population ecologists to know the factors that allowed the population to grow at exponential rates?

Answers

because they think they be cool with popularity when they look like fools

Listed in the Item Bank are key terms and expressions, each of which is associated with one of the columns. Drag and drop each item into the correct column. Order does not matter.

(Picture Posted)

Listed in the Item Bank are key terms and expressions, each of which is associated with one of the columns.

Answers

According to the question the Sexual Reproduction: Horse egg and sperm unite.

What is Reproduction?

Reproduction is the biological process by which organisms produce new individuals of their own kind. In most cases, it involves the fusion of two specialized reproductive cells, the female egg and the male sperm, to form a new and unique organism. Reproduction is a fundamental characteristic of all known life forms and is the process by which living things propagate their species. Asexual reproduction, which is reproduction without the fusion of gametes, is also common in some species, such as bacteria and plants. Reproduction is essential for the continuation of life on earth and is the foundation of the human population.

Asexual Reproduction: Bacteria divide by fission, A mushroom releases spores, A yeast cell develops a "bud", A pine tree releases pollen that gets trapped in a seed cone, Strawberry plant with runners.

Bacteria swap DNA during conjugation: Bacteria swap DNA during conjugation.

Gametes from protozoans fuse: Gametes from protozoans fuse.

To learn more about Reproduction
https://brainly.com/question/815744
#SPJ1

true or false animals eat plants or other animals that eat plants

Answers

Answer:

true i think?

Explanation:

I think it's true??

Pls Help I need help, I need a drawing of model


Throughout human existence we have relied on the oceans – for food, as a waste dump, for recreation, for economic opportunities and so on. However, it’s not only our activities in the marine environment that affect life in the sea – it’s also the things we do on land.

It is hardly unexpected that our actions are having an impact, given that more than half of the world's population currently resides within 100 kilometers of the coast. With our quick population growth, major technological advancements, and huge changes in land usage, human impacts have risen. New Zealand is not an exception when it comes to the effects of overfishing, pollution, and alien species on marine life.

The ocean and the creatures that dwell there are coming under growing pressure from human activity, both at sea and on land.

The ocean has probably always provided sustenance for people who live near the coast. However, many fish stocks all around the world have decreased dramatically as a result of improvements in fishing gear, bigger ships, and new tracking technologies. Many people now believe that the fish populations on the continental shelf have been over- or totally fished. Unsustainable fishing methods can harm the marine environment in other ways besides diminishing fish stocks. For instance, certain fishing methods like trawling and dredging can significantly harm marine habitats and creatures that live on the sea floor. Additionally, bycatch, or non-target species, are frequently caught using these approaches and discarded.

Answers

Unsustainable fishing practices refer to the use of different fishing techniques to catch or harvest fish at a rate that causes fish populations to decline over time.

Thus, In addition to being used as a technique for overfishing, which causes fish populations to decline at a rate that cannot be sustained, these tactics are seen to enable the destructive fishing practices that devastate ocean ecosystems.

These unsustainable fishing techniques can be carried out using anything from consumer-level gear like fishing rods and nets to commercial-grade machinery like bottom trawling.  

These fishing techniques are not sustainable since they are used in conjunction with rising fishing demands brought on by social behaviors like over-exploitation and over-fishing.

Thus, Unsustainable fishing practices refer to the use of different fishing techniques to catch or harvest fish at a rate that causes fish populations to decline over time.

Learn more about fishing techniques, refer to the link:

https://brainly.com/question/4800603

#SPJ1

Which of the following changes in the plasma me

Answers

The change to the plasma membrane would most likely increase membrane fluidity in humans is the decreased lipid raft content (option B).

What is plasma membrane?

Plasma membrane is the semipermeable membrane that surrounds the cytoplasm of a cell. Plasma membrane fluidity is a parameter describing the freedom of movement of protein and lipid constituents within the cell membrane.

The factors that affect the fluidity of the plasma membrane are as follows:

temperaturecholesterolthe kind of fatty acids in the phospholipids that form the cell membrane.

An increase in the cholesterol concentration generally decreases membrane fluidity, which is why lipid rafts have a much higher concentration of cholesterol than the surrounding membrane. This means that decreasing cholesterol content would make the membrane more fluid.

The complete question is as follows;

Which of the following changes to the plasma membrane would most likely increase membrane fluidity in humans?

A) Increased saturated fatty acid content

B) Decreased lipid raft content

C) Decreased phosphatidylcholine content

D) Decreased unsaturated fatty acid content

Learn more about membrane fluidity at: https://brainly.com/question/30609394

#SPJ1

1. Marco's little brother is watching a TV program about the gene that causes the genetic disease hemophilia. People with this disease cannot make a protein that is needed for blood to clot. After a few minutes, he turns to Marco and asks, "what exactly is a gene, anyway?"
Which of the following BEST describes a gene?
A. A gene is a random change to an organism's DNA.
B. A gene is a structure in a cell that contains the cell's chromosomes.
C. A gene is made of DNA and contains the instructions for building proteins.
D. A gene is a protein that makes up an organism's structure and helps it function.​

Answers

A gene can be described as being made up of DNA and it contains the instructions which are required for the building of the proteins.

The correct option is option C.

Genes are basically considered as the the functional units of heredity as they are basically composed of DNA, which is the nucleic acid responsible of the transmission of information from one generation to the other generation.

The chromosomes which are present in our body are basically made up of DNA which contain a number of genes. Each of the gene basically comprises of certain set of instructions which are required in order to perform a particular function or codes for some proteins.

Hence, the correct option is option C.

To know more about gene

https://brainly.com/question/29762819

#SPJ1

summarize the nature of science​

Answers

science is an attempt to explain natural phenomena. People from all cultures contribute to science. Scientific knowledge relies heavily, but not entirely on observation, experimental evidence, rational arguments and scepticism

1. What is the function of the mitochondria in a cell?
2. What is the difference between a prokaryotic cell and a eukaryotic cell?
3. What is the function of ribosomes in a cell?
4. What is the function of the endoplasmic reticulum in a cell?
5. What is the difference between a plant cell and an animal cell?
6. What is the function of the Golgi apparatus in a cell?
7. What is the function of lysosomes in a cell?
8. What is the function of the cytoskeleton in a cell?
9. What is the difference between passive and active transport?
10. What is osmosis?

Answers

Answer:

1. The mitochondria are responsible for producing energy in the form of ATP through cellular respiration.

2. Prokaryotic cells are smaller and do not have a nucleus or membrane-bound organelles, while eukaryotic cells are larger and have a nucleus and membrane-bound organelles.

3. Ribosomes are responsible for synthesizing proteins in the cell.

4. The endoplasmic reticulum is responsible for protein and lipid synthesis and transport within the cell.

5. Plant cells have cell walls, chloroplasts, and larger vacuoles, while animal cells do not have cell walls, chloroplasts, or large vacuoles.

6. The Golgi apparatus is responsible for modifying, sorting, and packaging proteins and lipids for transport within the cell or for secretion outside the cell.

7. Lysosomes are responsible for breaking down and digesting waste materials and cellular debris within the cell.

8. The cytoskeleton is responsible for maintaining cell shape, providing support and structure, and facilitating cell movement and division.

9. Passive transport does not require energy and involves the movement of molecules from an area of high concentration to an area of low concentration, while active transport requires energy and involves the movement of molecules from an area of low concentration to an area of high concentration.

10. Osmosis is the diffusion of water molecules across a selectively permeable membrane from an area of high water concentration to an area of low water concentration.

I hope these answers are helpful! Let me know if you have any more questions.

Answer:

1. The function of mitochondria in a cell is to produce energy in the form of ATP through cellular respiration. Mitochondria are also involved in other cellular processes such as apoptosis (programmed cell death), calcium signaling, and lipid metabolism.

2. Prokaryotic cells are smaller and simpler in structure than eukaryotic cells. Prokaryotic cells lack a nucleus and other membrane-bound organelles, while eukaryotic cells have a nucleus and various membrane-bound organelles.

3. Ribosomes are responsible for protein synthesis in a cell. They read the genetic code stored in messenger RNA (mRNA) and use it as a template to link amino acids together in the correct order to form a protein chain.

4. The endoplasmic reticulum (ER) is involved in protein synthesis, folding, and modification. It is also involved in lipid synthesis, calcium storage, and detoxification of drugs and toxins.

5. Plant cells have a cell wall, chloroplasts, and a large central vacuole, while animal cells lack these structures. Additionally, plant cells are typically larger than animal cells.

6. The Golgi apparatus is responsible for modifying, sorting, and packaging proteins and lipids for transport to their final destinations. It consists of a series of flattened sacs called cisternae.

7. Lysosomes are involved in the breakdown of cellular waste and debris, as well as the degradation of damaged or unneeded cellular components. They contain enzymes that can break down various biomolecules such as proteins, lipids, and nucleic acids.

8. The cytoskeleton is a network of protein fibers that provides structural support to the cell, helps maintain cell shape, and enables cell movement and division. It is made up of three main types of fibers: microfilaments, intermediate filaments, and microtubules.

9. Passive transport is the movement of molecules across a cell membrane without the input of energy, while active transport requires the input of energy to move molecules against their concentration gradient. Passive transport includes diffusion, osmosis, and facilitated diffusion, while active transport includes primary and secondary active transport.

10. Osmosis is the diffusion of water across a selectively permeable membrane from an area of high water concentration (low solute concentration) to an area of low water concentration (high solute concentration). It is a type of passive transport and is important for maintaining the water balance in cells.

Hope this helps!

What word means "between the dorsal wall and peritoneum” and refers to the location
of the kidneys?

Answers

Answer: The kidneys are situated in between posterior abdominal wall and partial peritoneum.

Explanation:

Kidneys are located at the dorsal side of the body of vertebrates including humans. These are located opposite to the spine. The location of the kidney is the retroperitoneal space that lies in between the posterior abdominal wall and partial peritoneum. Peritoneum is the serous membrane which forms the lining of the abdominal cavity. It also covers the kidneys from the dorsal side. The kidneys are well protected by muscles and fat at the dorsal side.

What is the cells of biology

Answers

Explanation:

Cell is the basic unit of life. group of cells form tissue and group of tissue form an organ.

have a nice day :)

Tests: Watch the following video https://youtu.be/f6c2cZfOULI Start at 3:20.
What are the independent and dependent variables in this experiment?
Independent:
Dependent:
What is the control and the constants to ensure test validity in this experiment?

Tests: Watch the following video https://youtu.be/f6c2cZfOULI Start at 3:20.What are the independent

Answers

According to the information, we can infer that the Independent variable: Temperature (specifically, the range of temperature). On the other hand, Dependent variable: Distribution of pikas. Additionally, Control: Pikas within their tolerance range of temperature and Constants: Other environmental factors, habitat conditions, and population of pikas.

What are the independent and dependent variables in this experiment?

In this experiment, the independent variable is the temperature, specifically the range of temperature. The researcher will manipulate and observe how different temperature ranges affect the distribution of pikas.

The dependent variable is the distribution of pikas. It refers to the geographical or spatial range in which pikas are found. The researcher will measure and analyze how the distribution of pikas changes in response to different temperature ranges.

What is control and the constants to ensure test validity in this experiment?

To ensure test validity, a control group of pikas within their tolerance range of temperature needs to be included. This group will experience temperatures within the range they can tolerate, providing a baseline for comparison. By comparing the distribution of pikas in different temperature ranges to the control group, the researcher can determine the impact of temperature on their distribution.

To maintain validity, other environmental factors such as altitude, precipitation, vegetation, and habitat conditions should be kept constant across the experimental groups. Additionally, the population of pikas being studied should be consistent, without any significant changes in population size or genetic composition throughout the experiment. These constants help isolate the effect of temperature on pika distribution and minimize confounding variables.

Learn more about experiments in: https://brainly.com/question/15088897
#SPJ1

John had two different colored rabbits that were brothers, one grey rabbit, and one that was white with black spots. Both of these rabbits' parents were only white and black. Explain the terminology and reasoning for these color differences the brothers compared to their parents.

Answers

Answer:

They recombine in the offspring, bringing the total gene count back up to two per trait per animal. This recombination of genetic material from parents into children is why we have such diversity among both people and rabbits.

Explanation:

I majored in Biology

During summer in the northern
hemisphere, the northern hemisphere is

A. gets the warm air from the southern hemisphere.
B. tilted closer to the sun.
C. directed away from the sun.
D. closer to the equator.

Answers

During summer in the northern hemisphere, the northern hemisphere is

B. tilted closer to the sun.

In the summer, is the Northern Hemisphere inclined toward the sun?

The Northern Hemisphere is tilted toward the Sun for half of the year due to the Earth's eccentric orbit; this is summer in the Northern Hemisphere and winter in the Southern Hemisphere. The Northern Hemisphere is tilted away from the Sun during the other half of the year, generating winter in the north and summer in the south.

The southern hemisphere of the planet is the exact opposite of the northern hemisphere in every way. In the southern hemisphere, it is winter while it is summer in the northern hemisphere.

Learn more about northern hemisphere refer

https://brainly.com/question/12609878

#SPJ13

Density is mass per unit of volume. Which pair of lab instruments would a student use to measure the density of seawater?
a caliper and a flask
a stopwatch and a beaker
a balance and a beaker
a meter stick and a temperature probe

Answers

Option C.  a balance and a beaker are the instruments used to measure the density of seawater.

Density is defined as the mass of an object divided by its volume. Measuring the density of seawater is critical to oceanography since the density of seawater varies based on salinity and temperature, both of which have significant implications for ocean circulation, marine organisms, and weather systems. The pair of laboratory instruments that a student would use to measure the density of seawater is a balance and a beaker.

The mass of seawater is measured using the balance, while the volume is measured using the beaker. Let's learn more about the measurement of density: Measurement of Density: To determine the density of an object or substance, we must first calculate its mass and volume using laboratory instruments such as a balance and a beaker. The mass of an object is the amount of matter it contains, which is measured in grams. A balance is a tool used to measure mass. The volume of an object is the amount of space it occupies, which is measured in liters.

A beaker or a graduated cylinder is used to measure volume. The density is obtained by dividing the mass by the volume. To determine the density of seawater, a student can collect a sample of seawater and place it in a beaker. The mass of the seawater sample is measured using a balance. The volume of the seawater is calculated by measuring the volume of the beaker before and after adding the seawater and subtracting the initial volume from the final volume. The student then calculates the density of the seawater by dividing the mass of the seawater by its volume.

In conclusion, a balance and a beaker are the instruments used to measure the density of seawater. Therefore the correct option is C

Know more about density of seawater here:

https://brainly.com/question/14698785

#SPJ8

How does modern classification differ from the systems used by Aristotle and Linnaeus?
A. It uses microscopes to examine tiny structures that organisms may have.
B. It looks at fossils and how modern organisms could be related to many of them.
C.All of the above are correct.
D. It looks at similarities and differences in DNA found in the cell of organisms.

Answers

D. Modern classification differs from the systems used by Aristotle and Linnaeus in that it looks at similarities and differences in DNA found in the cells of organisms. Aristotle and Linnaeus used primarily morphological characteristics (such as physical appearance) to classify organisms, whereas modern classification takes into account a wide range of information, including DNA sequences, embryonic development, and ecological relationships. Additionally, modern classification may use microscopes to examine tiny structures that organisms may have, but this is not a defining characteristic of modern classification. Similarly, while modern classification may look at fossils to understand the evolutionary relationships between organisms, this is not a defining characteristic of modern classification.

Mee: 5324611502 Pa: here​

Answers

Answer:

what is the question |=○

What is the area of the brain that stores memories associated with odors?

Answers

Answer: the olfactory bulb

Explanation:

Smells are handled by the olfactory bulb, the structure in the front of the brain that sends information to the other areas of the body's central command for further processing. Odors take a direct route to the limbic system, including the amygdala and the hippocampus, the regions related to emotion and memory.

The olfactory cortex receives information from the olfactory bulbs, which are responsible for processing and transmitting information about smells from the nose to the brain. When we smell something, the olfactory cortex helps to identify the odor and associate it with past experiences or memories. This is why certain smells can trigger vivid memories or emotions.

*IG:whis.sama_ent*

HELP PLSSSS

Explain the effects of the use of antibodies in the control of a disease?????

Answers

Answer:

Antibodies have three main functions: 1) Antibodies are secreted into the blood and mucosa, where they bind to and inactivate foreign substances such as pathogens and toxins (neutralization). 2) Antibodies activate the complement system to destroy bacterial cells by lysis (punching holes in the cell wall).

please what are the definitions to these in your own words​

please what are the definitions to these in your own words

Answers

Gravity: A force that keeps things in place sonit doesnt float around.

Mass: The amount of matter or substance that makes up an object

Weight: How heavy or light something is

Inertia: property of matter by which it continues in its existing state of rest or uniform motion in a straight line, unless that state is changed by an external force.

Part A
Which Of The Following Student-Drawn Cell Models Contain Two Chromosomes? Select All That Apply.

Part AWhich Of The Following Student-Drawn Cell Models Contain Two Chromosomes? Select All That Apply.

Answers

Answer:

the last one , the second to last one and the first one I am pretty sure

A, C and D are the student-Drawn Cell Models  that Contain Two Chromosomes.

Every cell in your body has DNA, which is the form in which your genetic code is stored. It creates your body's manual of operations. Each cell's nucleus contains chromosomes, which are structures that resemble threads and contain the DNA molecule.

A chromosome is referred to be a "homologous chromosome" if it has a similar genetic makeup but also includes replication-induced variations. Sister chromatids are the two halves of a certain chromosome that are joined at the centromere. Chromosomes known as "replication chromosomes" arise after the cell has undergone the process of DNA replication to prepare for cell division.

Learn more about chromosome, here:

https://brainly.com/question/30077641

#SPJ6

Drag and drop the molecules and numbers into the boxes to create a balanced chemical reaction.

Drag and drop the molecules and numbers into the boxes to create a balanced chemical reaction.

Answers

Answer:

H₂ + Cl₂ ---> 2 HCl

Explanation:

It looks like the reactants are not allowed to have coefficients (not enough boxes), so you need to pick reactants and products that satisfy this condition. The only ones that appear to fit are:

H₂ + Cl₂ ---> 2 HCl

Ventilation supply systems shall deliver the required rate to the breathing zone, which extends to __________ feet from the enclosing walls.

Answers

Answer:

The correct answer is "2".

Explanation:

The missing options of this question are:

a) 2

b) 3

c) 4

d) 6

The correct answer is option a) "2".

According to the Federal Emergency Management Agency (FEMA) of the United States of America, a breathing zone must be established in order to ensure a proper ventilation supply. The breathing zone is a region that must be kept among systems and the enclosing walls or the floor. In the case of enclosing walls, at least two feet (600 millimeters) must be kept. Regarding the floor, at least three feet must be kept above the floor.

Other Questions
What was the purpose of incubating your ubiquity plates upside down? A.to prevent contaminating B.to prevent condensation from forming on the agar surface C. incubating plates upside down is an aseptic technique D.to prevent organisms from over-growth Write the Python syntax for the following strings using the Concatenation process and print function The future belongs to those who believe in their dreams lip balm (figurative language) Please Answer ASAP !! Which map would you choose if you were going to create a presentation involving the sovereignty movement of Canadas second-most populated province? (USATESTPREP QUESTION) HELP ASAP PLS I RLLY NEED HELP A bug is moving along a straight path with velocity v(t)= t^2-6t+8 for t 0. Find the total distance traveled by the bug over interval [0,6]. If the Keynesian consumption function were C = 2.000 +0.8YD, what would the value of the tax multiplier be, and how much would equilibrium $output/$income. Y change if taxes were decreased by 200?O None of the other options O Tax multiplier = -9; change in Y = +$1,800. O Tax multiplier= -3: change in Y = +$600 O Tax multiplier = - 4: change in Y = + $800. O Tax multiplier = -4: change in Y +$160 Add.1.4+(1.2)Enter your answer, as a decimal, in the box. Read the following excerpt from President Ronald Reagans State of the Union speech in 1982. This speech was given after Reagan had been president for about a year. Then answer the question.In a paragraph of 35 sentences, summarize how Reagan changed the role of government and evaluate whether his policies benefited the country. Give 23 specific examples of policies during the Reagan era that addressed the problems Reagan mentioned in his Inaugural Address.Together, we not only cut the increase in government spending nearly in half, we brought about the largest tax reductions and the most sweeping changes in our tax structure since the beginning of this century. And because we indexed future taxes to the rate of inflation, we took away government's built-in profit on inflation and its hidden incentive to grow larger at the expense of American workers.Together, after 50 years of taking power away from the hands of the people in their States and local communities, we have started returning power and resources to them.Together, we have cut the growth of new Federal regulations nearly in half. In 1981 there were 23,000 fewer pages in the Federal Register, which lists new regulations, than there were in 1980. By deregulating oil we've come closer to achieving energy independence and helped bring down the cost of gasoline and heating fuel.No one pretends that the way ahead will be easy. In my Inaugural Address last year, I warned that the ills we suffer have come upon us over several decades. They will not go away in days, weeks, or months, but they will go away because we as Americans have the capacity now, as we've had it in the past, to do whatever needs to be done to preserve this last and greatest bastion of freedom.President Ronald Reagan's State of the Union speech, 1982The economy will face difficult moments in the months ahead. But the program for economic recovery that is in place will pull the economy out of its slump and put us on the road to prosperity and stable growth by the latter half of this year. And that is why I can report to you tonight that in the near future the state of the Union and the economy will be better much better if we summon the strength to continue on the course that we've charted. i cant figure this out In the given figure the value of c is The Lend-Lease Act was passed by Congress in 1941 primarily to1) assist Great Britain in World War II(2) stabilize the international banking system(3) maintain the traditional policy of strict neutrality toward Germany(4) encourage trade with Japan If your original network address with prefix is 172.16.0.0/16, what should your new network address with prefix be if you need 16 subnets? How did the Kansas-Nebraska Act affect the issue of enslavement? unit test What is a solution for a globes view _____ is the abnormal, compulsive intake of non-edible items such as laundry starch, burnt matches, clay, dirt, paint chips, and/or baking soda and is sometimes seen during pregnancy. Which quotation from the passage best shows how the narrator feels about her friend Lucy? A "Lucy Anguiano, Texas girl who smells like corn, like Frito Bandito chips, like tortillas, something like that warm smell of nixtamal" ( Paragraph 1) B "But me I like that Lucy, cornsmell hair and aqua flip-flops just like mine that we bought at the K-mart for only 79 cents same time. " ( Paragraph 2) C "Lucy got her arm stuck once and had to yell Maaa! and her mama had to put the machine in reverse and then her hand rolled back" ( Paragraph 4) D "I'm going to scratch your mosquito bites, Lucy, so they'll itch you, then put Mercurochrome smiley faces on them. " ( Paragraph 8) Ayuda operaciones y respuesta es para ahora Two sides of a parallelogram are 350 feet and 100 feet. The measure of the angle between these sides is 51. Find the area of the parallelogram to the nearest square foot. The process of monitoring, comparing, and correcting work performance is the management function known as ________.