Forecasting that tries a variety of computer models and selects the best one for a particular application is referred as:.

Answers

Answer 1

Model selection is the method of selecting one of the models from a collection of different models.

These models may be mathematically represented in the form of differential equations or other forms. It aids in the selection of the best model from a set of models for a specific dataset. It is used in forecasting to pick the best model based on a set of historical data.In the process of model selection, the best model is chosen by comparing different models' predictions on a particular dataset.

This comparison is made using various statistical parameters such as standard error, root mean square error (RMSE), mean absolute percentage error (MAPE), and others. The model that provides the lowest error rate is selected as the best model.

To know more about models visit:-

https://brainly.com/question/32804230

#SPJ11


Related Questions

During a cience invetigation, ix tudent divided 15 pound following oil, write the equation that how how many pound of potting oil i each tudent
received

Answers

Each student received 2.5 pounds of potting soil, weighing between 2 and 3.

Equation

15/6 = P, where P is the weight of each student.

P = 2.5

The word "potting soil" refers to a variety of soil types, each with a unique composition and structure that is best suited for plants in pots and other decorative containers. In contrast to, say, the heavier dark garden soil, potting soil is light.

Peat is one of the major ingredients in potting soil. Peat is a natural raw material that has been used for ages and is derived from plant residues. Coir is yet another crucial component of potting soil. Peat may be combined with items like lime, coir, bark, compost, sand, and fertilizers, depending on the intended application.

To learn more about potting soil, please refer:

https://brainly.com/question/15142653

#SPJ4

The complete question is:

During a science investigation, six students divided 15 pounds of potting soil equally. Write an equation that shows how many pounds is a potting soil each student received.

Equation: 15/6 = P

Between which two whole numbers does your answer lie?

Emilio is photographing a series of hills on his uncle's farm. He remembers that he needs to try to add a foreground to his image to make it appear three dimensional. How is he MOST LIKELY to add this foreground? A. B. C. D. He might change his position to include some foreground items such as rocks or grasses. He might tilt his camera up to better capture the tops of the hills. He might add some framing trees in the middleground of his image. He might circle around to the side of the hills to capture the cows standing on top. PLS HELP!!​

Answers

Emilio is photographing a series of hills on his uncle's farm. He remembers that he needs to try to add a foreground to his image to make it appear three-dimensional. He is most likely to add this foreground Option A. He might change his position to include some foreground items such as rocks or grasses.

The foreground of an image is usually the element that is closest to the viewer. The foreground is often used to add depth to an image. If a photographer wants to create a 3D appearance in his image, he must ensure that the image has a foreground, mid-ground, and background. It is possible to include a foreground in a photo by modifying the angle of the shot and including elements in the foreground.

Emilio might change his position to include some foreground items such as rocks or grasses. By doing so, he will be adding depth to his image. Another way to add foreground to an image is to use framing trees in the middle ground of the image, but this may not provide the depth required. Tilt his camera up to better capture the tops of the hills or circling around to the side of the hills to capture the cows standing on top are not recommended, as the question seeks to add a foreground.

Therefore, Emilio is most likely to add the foreground by changing his position to include some foreground items such as rocks or grasses. Therefore, the correct option is A.

The question was incomplete, Find the full content below:

Emilio is photographing a series of hills on his uncle's farm. He remembers that he needs to try to add a foreground to his image to make it appear three-dimensional. How is he MOST LIKELY to add this foreground?

A. He might change his position to include some foreground items such as rocks or grasses.

B. He might tilt his camera up to better capture the tops of the hills.

C. He might add some framing trees in the middle ground of his image.

D. He might circle around to the side of the hills to capture the cows standing on top.

Know more about Three-dimensional here:

https://brainly.com/question/28504776

#SPJ8

Which scenario describes the highest level of productivity? A. Producing $50 chairs using resources that cost $400 B. Producing a 100 chairs using resources that cost $200 C. Producing 15 chairs using resources that cost $150 D. Producing 5 chairs using resources that cost $100

Answers

The highest level of productivity should be option B.

Calculation of highest productivity:

For A. The cost should be $400 for 50 chairs so per chair should be = $400 ÷ 50 = 8.

For B. The cost should be $200 for 100 chairs so per chair should be  = $200 ÷ 100 = 2

For C. The cost should be $150 for 15 chairs so per chair should be = $150 ÷ 15 = 10

For D. The cost should be $100 for 5 chairs so per chair should be  = $100 ÷ 5 = 20.

Based on this, option b should be considered.

Learn more about the cost here: https://brainly.com/question/19817278

Time Left:0:39:31
Question 3 (1 point)
Listen
Ayden Marie Lochner: Attempt 1
Amgen, the largest biotechnology company in the world, donates millions of dollars
annually to raise the value of science literacy in the community and attract bright
young minds into the field of science. Since Amgen, as an employer would benefit
from this philanthropy, it would be characterized as strategic giving.
True
False
Question 4 (1 point)
4) Listen

Answers

Amgen, the largest biotechnology company in the world, donates millions of dollars annually to raise the value of science literacy in the community and attract bright young minds into the field of science. Since Amgen, as an employer would benefit from this philanthropy, it would be characterized as strategic giving. This statement is True.

Biotechnology is the application of biology to problem-solving and product-making processes. The most popular method is genetic engineering, which enables researchers to change an organism's DNA as they see fit.

In order to apply organisms, cells, their components, and molecular counterparts to create goods and services, biotechnology integrates natural sciences and engineering sciences. Károly Ereky used the word "biotechnology" in 1919 to describe the utilization of living organisms in the creation of goods from raw materials.

The term "biotechnology" refers to a broad range of techniques used to alter living things for human benefit. These techniques date back to the domestication of animals and the cultivation of plants, as well as "improvements" made to them through breeding programs that use artificial selection and hybridization. Along with cell and tissue culture technology, modern applications now include genetic engineering.

Learn more about biotechnology here:

https://brainly.com/question/16536830

#SPJ9

Drag each option to the correct location.
Match the scenarios to the factors that affect the labor market.
foreign direct investment
outsourcing
immigration

Answers

Each scenario should be matched to the factors that affect the labor market as follows:

Immigration: Carlos is moving from Mexico to the United States because he got a job in a bank. He had his interview last month, and the bank agreed to hire him because he was willing to work for 10% less than most American workers, even though he has the same qualifications.Foreign direct investment: A US supermarket chain is going to open a few supermarkets in Europe because a recent survey showed that the chain has a huge potential for profits in Europe.Outsourcing: A renowned US information technology firm has recently signed a contract with a company based in the Philippines. The Filipino company will handle the accounts of the US firm. The US firm made this decision to reduce labor costs.

What is immigration?

Immigration can be defined as the movement of a group of people from one geographical region to another geographical destination such as a city, especially in search of any of the following:

Good governanceSecurityBetter living conditions.WorkJobsSocial amenities

What is a foreign direct investment?

A foreign direct investment (FDI) simply refers to a type of investment which is made by an individual or business organization (investor) into an investment market that is located in another country.

In conclusion, an example of foreign direct investment (FDI) is a US supermarket chain that is planning to open a few supermarkets in a country in Europe.

Read more on immigration here: brainly.com/question/9809956

#SPJ1

Drag each option to the correct location.Match the scenarios to the factors that affect the labor market.foreign

Answer:

Post Test: Free Market and Businesses

Unit: 2

Economics

Question #12

__________________________________________________________

This is 100% right because I took the test

Go to explanation for picture with answers

l

l

Explanation:

Here's the picture and I hope this helped!

Have a nice day!

Drag each option to the correct location.Match the scenarios to the factors that affect the labor market.foreign

QUESTION 4: ENVIRONMENTAL ISSUES
4.1. Read the scenario below and answer the questions that follow.

NAZIM MANUFACTURERS (NM) Nazim Manufacturers specialises in the manufacturing of furniture and cutlery. Farida, the CEO, provides all the equipment that is necessary to perform the work. The employees of NM use prescribed safety equipment. NM also encourages employees to do regular health checks. The employees of NM requested their colleagues Jan, Elsie, Thula and Craig to ensure that NM complies with COIDA.

4.1.1. Quote the responsibilities of the employer, employee and the business in protecting human health and safety in the workplace from the scenario above. (3) ​

Answers

Environmental issues are results of human interest in the biophysical environment, most customarily of that are dangerous results that purpose environmental degradation.

Main modern Environmental issues may encompass weather change, pollutants, environmental degradation, and useful resource depletion. The conservation motion lobbies for the protection of endangered species and protection of any ecologically precious herbal areas, genetically modified foods, and international warming.

These encompass pollutants, overpopulation, waste disposal, weather alternatives, worldwide warming, the greenhouse effect, and many others.

The listing of Environmental issues in our surroundings goes on, however, there are 3 major ones that affect the general public overall: international warming and climate change; water pollutants and ocean acidification; and lack of biodiversity.

Learn more about Environmental issues here: https://brainly.com/question/13840139

#SPJ9

which type of financial institution is associated with very high pay for employees, but also very long hours and a high level of stress?

Answers

Investment Banks is the type of financial institution which is associated with very high pay for employees, but also very long hours and a high level of stress.

Employment is a relationship between two parties that regulates the provision of paid labor services. Usually, on a contractual basis, one party, the employer, which may be a corporation, nonprofit organization, cooperative or any other entity, pays the other party, the employee, in exchange for the performance of the assigned work.

Workers work in exchange for wages, which may be paid by the hour, as a wage, or as an annual salary, depending on the type of work the worker performs, prevailing industry conditions and bargaining power between parties.

To know more about Employees here-

https://brainly.com/question/18633637

#SPJ4

Maxine and her friend Alice share a love of listening to music from England. They spend
plenty of sleepovers listening to their favorite bands and are always sharing new songs or
artists with each other.
One day, Alice excitedly tells Maxine her dad bought her tickets to a huge music festival in
England where some of their favorite bands will play. Plus, she has a ticket for Maxine, and
Alice's dad said he'll cover half of Maxine's airfare. The other half is only $412. Maxine feels
like this is a once-in-a-lifetime opportunity. Should Maxine use her emergency fund to take this super rare opportunity? Explain your reasoning.

Answers

Based on the given information Maxine should not use her emergency fund to take this super rare opportunity as it is intended to use in an unforeseen situation.

What is an emergency fund?

An emergency fund is said to be savings that an individual intended do in order to meet challenges that are not predictable and unforeseen for them.

An emergency fund shouldn't be used for a planned vacation or other predictable expenses; rather, it should only be used in the event of an unexpected event. You don't have to deprive yourself of small comforts in life.

In the given case, the music concert is not an unforeseen event is a planned vacation so the emergency fund should not be utilized.

Learn more about the emergency fund, here:

https://brainly.com/question/28639079

#SPJ1

Pete, a human resource intern, was given an assignment by his manager that meant he must obtain information from other departments to complete it, but some departments refused to share information with an intern. Pete was frustrated because he did not have the power to get the information he needed. In the context of this situation, Pete's manager made the mistake of

Answers

Answer:

assigning responsibility without delegating adequate authority.

Explanation:

Since in the situation it is given that the some department deny to share the information with an intern due to which pete got frustated so here the manager of the pete should done the mistake of responsibility assigning that should be without delegating to the adqequate authority

So as per the given situation, the above statement should be the answer


Opportunity Cost
in order to
v something else.
Opportunity cost is what must be
Opportunity cost forces consume
lucers to make
received
given up
replaced

Answers

I don’t fully understand that in order to help you.

definition of the term small business​

Answers

Answer:

make me brainalist and keep smiling dude

Explanation:

Small business is defined as a privately owned corporation, partnership, or sole proprietorship that has fewer employees and less annual revenue than a corporation or regular-sized business.

If the government imposes a price ceiling below the monopolist's average cost curve, then in the long run the regulation makes:consumers better off.consumers worse off.the monopolist better off.None of the statements is correct.

Answers

If the government imposes a price ceiling below the monopolist's average cost curve, then in the long run the regulation makes "consumers worse off.."

The correct option is consumers worse off.

In the long run, the regulation makes consumers worse off if the government imposes a price ceiling below the monopolist's average cost curve. The price ceiling causes the monopolist to decrease their production since the price that they are getting from the consumers is less than what they are willing to produce at, which causes a shortage in the market.

The consumer surplus is reduced because they are not able to purchase as much of the good as they would like at a lower price, and they are not willing to pay the price at which the monopolist is willing to produce the good. Therefore, the consumers are worse off.

For more such questions on price ceiling

brainly.com/question/28018539

#SPJ11

What are the functions of the Hospital Incident Command System (HICS) in disaster management? Select all that apply.
To standardize disaster operations
To establish an emergency operations center (EOC)
Hospital incident commander
Medical command physician

Answers

The functions of the Hospital Incident Command System (HICS) in disaster management involve standardizing disaster operations, establishing an EOC, and designating key roles such as the Hospital Incident Commander and Medical Command Physician.

The Hospital Incident Command System (HICS) is a standardized framework and organizational structure used in healthcare facilities to manage incidents and coordinate emergency response efforts.

The functions of HICS in disaster management include the following:

1. To standardize disaster operations: HICS provides a standardized approach to managing emergencies by creating a common framework for communication and coordination between various responding agencies and personnel.

2. To establish an emergency operations center (EOC): HICS helps hospitals in setting up an EOC, which serves as the central command and control center for coordinating resources, information, and decision-making during a disaster event.

3. Hospital incident commander: The Hospital Incident Commander is a key role within the HICS structure. This individual is responsible for overseeing the overall response to the incident, making critical decisions, and coordinating efforts between different departments within the hospital and external agencies.

4. Medical command physician: The Medical Command Physician is another essential role in the HICS structure. This individual is responsible for providing medical oversight and guidance during a disaster event, ensuring that the hospital's response is appropriate, safe, and effective in managing the needs of affected patients.

Learn more about the emergency operations center: https://brainly.com/question/14331925

#SPJ11

What is less liquid, Cash or Stocks and why?

Answers

Cash is considered to be highly liquid because it's already in its most liquid form and doesn't need to be converted, while money you have in stocks is slightly less liquid because there are more steps involved in converting it to cash.

How do those who study workplace ergonomics help decrease workplace injury?.

Answers

Workplace injuries are used to prevent musculoskeletal problems at work. Ergonomics aids in the prevention of workplace injuries such as occupational diseases, accidents, mental stress, and major strains.

What is Ergonomics?

"Law of Work" is the most basic definition of ergonomics. Ergonomics is defined as the link between individuals and their workplace environment, with a focus on the workers' physical capabilities and comfort.

Workplace environment is healthy; employees should not be physically forced to perform duties; 8 hours of work per day is sufficient; otherwise, employees may experience mental stress as well as major workplace strains or injuries.

As a result, if workers are exposed to these known risk factors for MSDs, they are more likely to be injured at work.

Learn more about workplace ergonomics , here:

https://brainly.com/question/14870262

#SPJ1

to conduct business, congress needs to have a certain number of members present. how many members are needed?

Answers

There are presently 435 voting representatives. 5 delegates and one resident commissioner function as non-voting members of the residence, although they can vote in committee.

Representatives should be 25 years old and must have been U.S. residents for at least 7 years.

The constitution prescribes that the Senate be composed of two senators from each kingdom (therefore, the Senate currently has a hundred participants) and that a senator needs to be at least thirty years of age, have been a citizen of the us for nine years, and, while elected, be a resident of the state

Each nation retained "each power...which isn't always by way of this confederation expressly delegated to America. The Articles of Confederation additionally mentioned a Congress with representation now not based on population – every nation might have one vote in Congress.

Learn more about commissioner here: https://brainly.com/question/27996002

#SPJ4

An engineer at a manufacturing plant is investigating part failures identified during product installations at distributed sites. The engineer has narrowed it down to two (2) production lines A and B. She wants to perform a hypothesis test to determine whether the mean failure rate of product identified differs from production line A when compared to B.
if u1 = mean failure rate from production line 1 and u2 = mean failure rate from production line 2
Determine the null and alternative hypothesis for the proposed test?
1: u1 = u2 and Ha: u1 > u2
2: u1 = u2 and Ha: u1 = u2
3: u1 = u2 and Ha: u1 < u2

Answers

An engineer at a manufacturing plant is investigating part failures identified during product installations at distributed sites. The engineer has narrowed it down to two (2) production lines A and B. She wants to perform a hypothesis test to determine whether the mean failure rate of product identified differs from production line A when compared to B.

If u1 = mean failure rate from production line 1 and u2 = mean failure rate from production line 2, the null and alternative hypothesis for the proposed test are as follows:

Null hypothesis: The mean failure rate of the product identified does not differ when compared between production line A and B

u1 = u2

Alternative hypothesis: The mean failure rate of the product identified differs when compared between production line A and B.Ha: u1 ≠ u2

Note: In this case, the null hypothesis, is the mean failure rate of the product identified does not differ when compared between production line A and B. The alternative hypothesis is defined as the mean failure rate of the product identified differs when compared between production line A and B.

Determine null and alternative hypothesis: https://brainly.com/question/33654125

#SPJ11

Analyzing Finance Workers' Qualities, Skills, and Abilities.

According to the video, what qualities, skills, and abilities do workers in this career cluster need? Check ALL that apply.

a. physical strength for working outdoors and traveling
b. communication skills for explaining complex concepts
c. leadership skills for persuading others to take action
d. the ability to inspire others
e. the ability to be unemotional about business
f. the ability to be comfortable in an office setting

Answers

The qualities, skills, and abilities which workers in this career cluster need are:

B. Communication skills for explaining complex conceptsE. The ability to be unemotional about business F. The ability to be comfortable in an office setting

According to the given question, we are meant to show the abilities, skills which workers that were displayed on video needs to have if they are to thrive in their chosen profession.

As a result of this, we can see that the workers in this particular career cluster needs communication skills, emotional intelligence and ability to be comfortable in an office setting.

Therefore, the correct answers are options B, E and F

Read more here:

https://brainly.com/question/18752438

Answer:

B.E.F

Explanation:

A responsible managing employee is required through the Contractor's state license board to work at least?

Answers

Answer:

32hours or 80% of the complete working hours per week of the business

Explanation:

When construction companies engage in contracts were materials and labor can cost $500 and above, they are expected to have a license. If the business does not have a license, it can qualify for a license if it decides to employ someone with the required license. The employed individual will be known as the responsible managing employee.

The contractors state license board requires such an employee to be a full and recognized employee of that business and to have at least 32hours or 80% of the sum of the working hours expended by the business.

explain four reason international countries choose jamaica to do business

Answers

The four reasons international countries choose Jamaica to do business are below in the below segment.

Although Jamaica seems to be a mid-income country with the highest average class, its low unemployment level has been one of the nation's most slow-growing economies.Considering Jamaica's economy's significance for commercial transactions, trade may be a major driving force for population development.For almost all such renewable sources, such as the production of energy, Jamaica consumes gasoline (petroleum).Another important feature of attention was knowledge and awareness-raising of trade trends among personal and corporate players but also civilized society.

Learn more:

https://brainly.com/question/867182

A large bakery buys flour in 25 kg bags. The bakery uses an average of' 4,860 bags a year. Preparing an order and receiving a shipment of flour bags involves a cost of $10 per order. Annual holding cost is $5 per flour bag. a) Determine the economic order quantity.
b) What is the average number of bags on hand (i.e., in inventory)?
c) How many orders per year will there be?
d)Calculate the total annual cost of ordering and holding flour.
e)If ordering costs were to increase by 50 percent order, by what percentage would the EOQ change?

Answers

a) Economic Order Quantity(EQO):Economic Order Quantity can be calculated using the following formula. \(EOQ = \sqrt{\frac{2DS}{H}}\)Where D = Annual Demand in Units S = Ordering Cost per Order H = Annual Holding Cost per UnitThen EOQ will be: \(EOQ

= \sqrt{\frac{2*4,860*10}{5}}\)= \(\sqrt{19,440}\) = \(139.28\) (approx.)The economic order quantity is 139 bags.b) Average Number of Bags on Hand:To find out the average number of bags on hand, we can use the following formula: \(Average\ number\ of\ bags\ on\ hand = \frac{EOQ}{2}\)= \(\frac{139}{2}\) = \(69.5\) (approx.)The average number of bags on hand is 69.5 bags.c)

Number of Orders per Year:We can find the number of orders per year by using the following formula: \(Number\ of\ Orders\ per\ Year = \frac{D}{EOQ}\)= \(\frac{4,860}{139}\) = \(34.89\) (approx.)So, there will be 34 orders per year.d) Total Annual Cost of Ordering and Holding Flour:Total Annual Cost of Ordering and Holding Flour can be calculated using the following formula:

To know more about Economic visit:

https://brainly.com/question/14355320

#SPJ11

To examine
the weekly payroll of all employees, one would look at the:

Answers

To examine the weekly payroll of all employees, one would look at the: d. payroll register.

What is the payroll register?

The payroll register is a book or record that is used to fill in the details of all the employees and their payment logs. A record of this register is often kept in good condition in case of any future discrepancies that will have to be resolved.

A person who wants to examine the weekly payroll of all employees in an organization must be able to look at the payroll register to know what is obtainable. There, he would find the names of the employees, their job roles and payment record.

Options:

a. W-4

b. employee earnings record

c. W-2

d. payroll register.

Learn more about the payroll register here:

https://brainly.com/question/24265652

#SPJ1

PLEASE HELP!!!
Money going out of a business is called _BLANK_.

A. income
B. expenses

Answers

Answer:

Expenses

Explanation:

Which tools allow economists to determine if the allocation of resources determined by free markets is desirable?.

Answers

Consumer and producer surplus.

1.How might an individual’s personal dilemma about teamwork be intensified
or reduced in a virtual or remote team? As a virtual or remote team leader,
what would you do to manage the dilemmas felt by members?
2. Discuss the relationship between team cohesiveness and performance. As a
leader, can you think of specific ways you would encourage norms of cohesiveness
and collaboration?
3. What style of handling conflict do you typically use? Can you think of instances
where a different style might have been more productive?

Answers

An individual's personal dilemma about teamwork can be intensified or reduced in a virtual or remote team based on factors such as limited communication, lack of trust, and feelings of isolation.

As a virtual team leader, it is important to address these dilemmas by fostering a sense of belonging, implementing regular team-building activities, and facilitating effective communication through virtual platforms. In a virtual or remote team, an individual's personal dilemma about teamwork can be intensified due to the absence of face-to-face interaction and physical presence. This can make it challenging for team members to establish trust and build rapport, leading to feelings of isolation and detachment. Additionally, communication barriers such as time zone differences, language barriers, and reliance on technology can further intensify the challenges of effective collaboration in a virtual setting. To manage these dilemmas, as a virtual team leader, it is crucial to create a sense of belonging and team identity. This can be achieved through regular team-building activities that encourage virtual social interaction and bonding. Providing opportunities for informal communication and fostering a supportive team culture can help reduce feelings of isolation and increase team cohesion. Clear and consistent communication is also essential to keep team members informed about their roles, responsibilities, and progress. Providing training and support on virtual collaboration tools can improve team members' confidence and effectiveness in working together remotely. Overall, actively addressing and managing the dilemmas felt by virtual team members can contribute to a more cohesive and productive team environment.

To learn more about  individual's personal dilemma, Click here:

https://brainly.com/question/28592253

#SPJ11

which word best describes the writing process in business writing ?

Answers

Answer: Brainstorm Pre-write. Write rough draft. Peer-review. Revise ideas. Edit Publish Establish constructive purposes for student writing. Find real audiences, beyond the teacher, for students' writing

Difference between assets and liabilities.

Answers

Answer:

see below

Explanation:

Assets are the things a person or a company owns. They are items precious to a business or an individual. Assets are things that can be assigned a monetary value. They are in the form of cash, properties, money market securities, machinery, plants and equipment, intellectual property rights, and many others.

Liabilities are money a  business or person owes others. They are loans, debts, and obligations that need to be paid. Common liabilities include bank loans, unpaid utilities, and creditors such as suppliers.

A partner of a corporation buys all the shares of the company. What status will this partnership acquire?

Answers

Adding a buyout clause to an agreement that states that over time, the partner's shares will be purchased in order to finally eliminate their interest in the company is how a partnership buyout operates.

What is a partnership buyout?

A partnership buyout is when a company's director buys out their partner's shares and ends a partnership arrangement, or gradually buys out the co-director until the full share has been acquired.

Working with a partner involves dividing up management duties and collaborating to bring in new business, but as operating the business gets easier, you can have aspirations to become a solo director and assume control of the business. This can be facilitated by buying out a co-director and ending a partnership arrangement.

Learn more about partnerships, from:

brainly.com/question/13034193

#SPJ1

in a decision table, all of the alternatives are listed down the left side of the table, while all of the possible outcomes or states of nature are listed across the top. true false

Answers

In a decision table, all of the alternatives are listed down the left side of the table, while all of the possible outcomes or states of nature are listed across the top. decision theory.

The statement is true.

A good decision considers all alternatives.

Can decision makers control states of nature?

State of nature cannot be controlled in a situation requiring decision-making. This component is out of the decision maker's hands. The definition of a state of nature is a set of future events that are mutually exclusive and collectively exhaustive and outside of the decision maker's control.

Risk is a state in which a decision-maker is aware of all the outcomes that could result from the choice they are making as well as the likelihood of each outcome.

To learn more about nature visit:

https://brainly.com/question/25917497

#SPJ4

A list of reasons on why could it take 36 years and $61,060 to pay off a $10,000 credit card dept.

Help I need the answer fast​

Answers

Answer:

This is due to compound interest on the credit card bills.

Explanation:

Credit card debt of $10,000 is repaid when its due. The bank lends the credit card amount and then charges interest on the debt amount. The compound interest is added to the debt amount and then future value of the debt is greater than the present value.

Other Questions
Which of the following is described by the text as a communication channel that flows within the chain of command or task responsibility defined by the organization?a.Upward communicationb.Horizontal communicationc.Diagonal communicationd.Downward communicatione.Formal communication what is the missing word in this sentence using irony,"The mechanic_____ a tire" Write a program that will read a file (data.txt). The file contains integer values. The program will read the file and create a list.Using list methods/functions, the program will display the numbers, the count of numbers, the sum of the numbers, the average of the numbers, the maximum integer, and the minimum of the numbers. (LOOK AT PICTURE BELOW PLS, PYTHON) What was the purpose of the intolerable act which excerpt best displays the function of dramatic structure in monster? HELPPLacey was looking at some data on World Cup soccer matches. She noticed a negative linear relationshipbetween the number of fans attending a match and the number of total goals scored in that match. Here iscomputer output from a least-squares regression analysis for using attendance (in thousands of fans) to predictthe total number of goals scored:PredictorCoefSE CoefTPConstant3.2600.14522.5350.000Attendance (thousands)-0.0090.003-3.3300.001Use this model to predict the total number of goals scored in a match with 90 thousand fans in attendance.You may round your answer to the nearest whole number of goals.goals Which term is defined as having more and more people living in and around cities than before?human rightsurbanizationmigrationurban planning Paul Diesel owns the Fredonia Barber Shop. He employs 7 barbers and pays each a base salary of $1.310 per month. One of the barbers serves as the manager and receives an extra $560 per month. In addit in the summer of 2017, connecticut senator christopher s. murphy took control of the senate floor for 15 hours to attempt to delay a vote. what is this senatorial tactic called? hey!! need this asap!! will mark brainliest! thank you in advance! Wel and George each have a packet of 20 seeds. They are planting seeds in different rows of a garden. Each row is 10 yards long. Wel plants a seed every 4 feet, starting 4 feet from the end of her row. George plants a seed every 2 yards, starting 2 yards from the end of his row. What is the greatest number of full rows that each person can plant using just their packet of seeds? Enter the answers in the boxes. Wei can plant full rows. George can plant full rows. Lisa has problems sleeping, so she goes to a sleep clinic. At the clinic the researchers measure her brain's electrical activity as she sleeps by using the technique of When completing a group project, what four steps shouldbe taken to ensure an effective first group meeting? Mr. Smith wrote the equation (16 2w )2 + [3y (3z )] on his board. He told his students the values of each variable: w =5, y =9, and z =3. What is the solution to Mr. Smiths equation? Which of the following nucleic acid complexes would undergo correction by the DNA mismatch repair system? UAGUCUUACAUUCCAUAUGG 3' (6%) Antisense 3' _ ATCAGAATGTAAGGTATACC-5' B. GTGCCCACGATTCAGTGGGC 3' (2%) Antisense 3' CACGGGTGCTAAGTCACCCG-5' GCGCCACGATTTAACGTGGC (62%) Anlisense 3' CGCGGTGCTAAGTTGCACCG-5' GGGCCCACGCUACGACGUUC 3' (28%) Anlisonse 3' CCCGAGTGCGATGCTGCAAG X How can an author's compositional choices affect a text?Choose *all* that apply.to influence a readerto compose literary art.to create deeper understanding of a conceptto better express purpose of writing Acrostics, acronyms, and rhymes are a few examples of __________. a. a visual strategy b. the misinformation effect c. memory reconstruction d. a mnemonic device Jasper Pernik is a currency speculator who enjoys "betting" on changes in the foreign currency exchange market. Currently the spot price for the Japanese yen is 129.87/$ and the 6 - month forward rate is 128.53/$. Jasper thinks the yen will move to 128.00/$ in the next six months. If Jasper buys $100,000 worth of yen at today's spot price and sells within the next six months at 128/$, he will earn a profit of: A. $101,460.94 B. $1460.94 C. $146.09 D. nothing; he will lose money Write a program to add two large integers with up to 300 digits. One approach is to treat each number as array, each of whose elements is a block of digits of that number. helpp ill give a brainiest