Folk cultural groups that are isolated from one another generally will have...
A. little cultural interaction.
B. a lot of cultural interaction.​

Answers

Answer 1

Answer:

B.

Hope it helps ༼ つ ◕_◕ ༽つ

Answer 2

Answer:

a Lot of cultural interaction


Related Questions

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Answers

The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.

In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.

In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.

The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.

It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.

For more such answers on RNA

https://brainly.com/question/13939644

#SPJ8

what does Eukaryote mean?
(Biology)

Answers

Answer:

an organism consisting of a cell or cells in which the genetic material is DNA in the form of chromosomes contained within a distinct nucleus. Eukaryotes include all living organisms other than the eubacteria and archaebacteria.

Have a great day!!

Please rate and mark brainliest!!

Practice 1: Choose all the answer choices that represent the use of trees,
A Heat to cook food
В. Lumber to build homes
C. Materials to make tools
D .Fire to warm homes

Answers

Answer:

bc

Explanation:

trust mate i got an a plus i think or a normal a

Biomagnification is... concentration of a contaminant stays the same as you move to higher trophic concentration of a contaminant increases as you move to higher trophic level concentration of a contaminant increases as an individual grows concentration of a contaminant stays the same as an individual grows

Answers

Answer: Biomagnification refers to the process by which the concentration of a contaminant increases as you move to higher trophic levels in a food chain or food web. In other words, as organisms consume other organisms, the contaminants present in the prey accumulate and become more concentrated in the bodies of the predators.

To understand this process, let's consider an example involving a water ecosystem. Suppose a pollutant is released into the water, such as a pesticide or heavy metal. The primary producers, such as algae or aquatic plants, absorb small amounts of the contaminant from the water. As herbivorous organisms consume these primary producers, they ingest the contaminants along with their food.

Since the contaminant is not easily broken down or eliminated from the organisms' bodies, it accumulates over time. As a result, the concentration of the contaminant becomes higher in the herbivores than in the primary producers. Now, when carnivorous organisms consume the herbivores, they not only accumulate the contaminant from their own food but also from all the prey they have consumed. This leads to an even higher concentration of the contaminant in the carnivores.

Therefore, biomagnification describes the phenomenon where the concentration of a contaminant increases significantly as you move up the food chain or trophic levels. The highest concentration of contaminants is often found in top predators, such as large fish, birds of prey, or mammals, which can have adverse effects on their health and reproductive capabilities.

It's important to note that biomagnification primarily occurs for persistent and non-biodegradable contaminants that cannot be easily metabolized or excreted by organisms. These contaminants are often lipophilic (fat-soluble), which allows them to accumulate in fatty tissues and remain in the organism's body for long periods, leading to biomagnification.

Explanation:

A(n) _____ can change its genes over time as the environment changes.

Answers

Answer:

evolution is the answer

An organism can change its genes over time as the environment changes.

Why do herbaceous plants drop their leaves in hot and dry weather while woody plants remain erect

Answers

transpiration causes more water to be lost than is coming in, and the water balance within the plant can get thrown off. The dehydrated collapsing cells in the leaves and stems can no longer remain erect, and the plant begins to wilt.

which site should be monitored for a pulse to assess the status of circulation to the foot?

Answers

The site that should be monitored for a pulse to assess the status of circulation to the foot is the dorsalis pedis artery. This artery is located on the top of the foot, just lateral to the extensor hallucis longus tendon. The presence of a palpable pulse at this site indicates that blood is flowing to the foot and that the circulation is adequate.

However, if the pulse cannot be felt, it may indicate a blockage or narrowing of the artery, which could lead to poor circulation and potential complications. It is important for healthcare professionals to regularly assess the pulse at the dorsalis pedis artery in patients with diabetes, peripheral artery disease, or other conditions that can affect foot circulation.

Timely detection and treatment of circulation problems can help prevent serious complications such as foot ulcers, infections, and even amputations.

you know more about monitored for a pulse pls visit-

https://brainly.com/question/29557128

#SPJ11

What things need the nitrogen cycle?

Answers

Answer:

Plants, animals and bacteria need nitrogen to help them grow. Thanks to the nitrogen cycle, nitrogen gas in the atmosphere gets converted to a form they can use

Explanation:

A change in pH has the greatest impact on which life process?

A change in pH has the greatest impact on which life process?
A) synthesis
B) regulation
C) growth and development
D) transport

A change in pH has the greatest impact on which life process?A change in pH has the greatest impact on

Answers

A change in pH can have a significant impact on many life processes, but it has the greatest impact on regulation.

define pH ?

pH is a measure of the acidity or basicity of a solution. It is a logarithmic scale that ranges from 0 to 14, with 7 being neutral, values less than 7 being acidic, and values greater than 7 being basic or alkaline. The pH of a solution is determined by the concentration of hydrogen ions (H+) in the solution. A higher concentration of H+ ions in a solution corresponds to a lower pH and greater acidity, while a lower concentration of H+ ions corresponds to a higher pH and greater basicity.

A change in pH can have a significant impact on many life processes, but it has the greatest impact on regulation. pH is a measure of the acidity or basicity of a solution and plays a critical role in many biological processes, including enzyme function, protein structure, and the stability of cell membranes. A small change in pH can cause significant disruptions in these processes, which can lead to a range of physiological changes and health problems. For this reason, organisms have evolved various mechanisms for regulating their internal pH, including the release of buffers and the control of acid-base balance, in order to maintain a stable internal environment and ensure proper functioning.

To learn more about pH follow the given link: https://brainly.com/question/15565260

#SPJ1

What is the primary function of macrophages?

absorb oxygen and transfer it to body cells

consume pathogens and assist the immune system

accumulate at an injury and initiate the clotting process

contain metabolites and maintain a balance of fluids

Answers

Consume pathogens and assist the immune system. Macrophages are innate immune system effector cells that phagocytose bacteria and release both pro-inflammatory and antibacterial mediators.

Moreover, macrophages are crucial in the elimination of ill and damaged cells due to their programmed cell death. Early in an illness, the innate immune system eliminates and blocks microorganisms. Humans have an innate immunity that is essential for maintaining life. Invading pathogens and stressors are detected by innate immunity, which then eliminates them by inducing an inflammatory reaction. When innate immune cell receptors identify particular molecular patterns produced by infections or stressors, an inflammatory response is set off. Microorganisms produce pathogen-associated molecular patterns that are detected by pattern recognition receptors on innate immune cells and epithelial cells.

Learn more about macrophages here:

https://brainly.com/question/29694085

#SPJ4

The breaking and rearrangment of chemical bonds

Answers

Answer: where is the question?????

what is the main difference between plant and animal cell ​

Answers

Answer:

The vacuoles are different sizes.

Explanation:

I NEED HELP: Greenhouse Gases

I NEED HELP: Greenhouse Gases

Answers

1. 500
2. 9,000
3. The amount of carbon emissions increased
4. The emissions increased because the amount of fossil fuels being used increased. The fossil fuels are used by factories, cars, electricity and other used which is why the amount of carbon emissions increased from the 1900-2014

Donc
47. What are 2 ways that plants have adapted to life in this region?

Answers

1. Thicker walls due to a higher amount of carbon dioxide. If you research plants adaption to carbon dioxide levels or even climate change. You should have a few results

Drugs such as ativan and xanax, which depress central nervous system activity, can become addictive when used as an ongoing treatment. these drugs are referred to as ______________ drugs.

Answers

Drugs such as Ativan and Xanax, which can become addictive when used regularly, are referred to as benzodiazepines.

Benzodiazepines are a class of drugs that are commonly prescribed for their sedative and anxiolytic (anti-anxiety) properties. Examples of benzodiazepines include Ativan (lorazepam) and Xanax (alprazolam). These medications work by enhancing the activity of a neurotransmitter called gamma-aminobutyric acid (GABA) in the brain, which leads to a decrease in central nervous system (CNS) activity.

While benzodiazepines can be effective in managing symptoms of anxiety, insomnia, and certain medical conditions, they also carry a risk of addiction and dependence when used for an extended period. Prolonged use of benzodiazepines can lead to tolerance, where higher doses are needed to achieve the same effects, and withdrawal symptoms upon discontinuation.

The addictive potential of benzodiazepines arises from their ability to produce a calming and euphoric effect, which some individuals may find desirable and seek to replicate. This can lead to misuse, abuse, and the development of a substance use disorder.

It is important to note that benzodiazepines should be used under the guidance of a healthcare professional, following prescribed dosage and duration recommendations. Regular monitoring and careful management are essential to mitigate the risk of addiction and ensure the safe use of these medications.

To know more about benzodiazepines click here: brainly.com/question/4109894

#SPJ11

The diagram is a schematic representation of the electron transport mechanism in mitochondria. Label the diagram to complete the model.
All rights reserved
0₂
ATP
ADP H₂O
mitochondrial
intermembrane space
electron
transport
chain
00
+
cytoplasm
++
+
+
mitochondrial matrix
+ +
++
+
x x x
x

The diagram is a schematic representation of the electron transport mechanism in mitochondria. Label

Answers

Answer:

02 is the box on top\ under o2 h2o is the box under on the left and on the right atp and all the way on the right is adp and the last one is the mitochondrial matrix is all the ways on the bottom.

Explanation:

Which explains the relationship between the respiratory system and the circulatory system in an organism?
A. The respiratory system takes in oxygen. The circulatory system delivers the oxygen to cells.
B. The respiratory system takes in oxygen. The circulatory system removes wastes from the body.
C. The respiratory system delivers oxygen to cells. The circulatory system controls the body's activities.
D. The respiratory system delivers oxygen to cells. The circulatory system provides support to cells.

Answers

A. The respiratory system takes in oxygen. The circulatory system delivers the oxygen to cells.

The respiratory system is defined as the set of tissues and organs involved in the uptake of oxygen from the atmosphere and the release of carbon dioxide produced during aerobic respiration.

This gas exchange is also called breathing or external respiration. Thus the correct option is A that is the respiratory system takes in oxygen. The circulatory system delivers the oxygen to cells.

In which system lungs and heart are present?

Lungs are present in respiratory system and heart is present in circulatory system.

The circulatory system is refers to as which delivers oxygen and nutrients to cells and takes away wastes. The heart pumps oxygenated and deoxygenated blood through blood vessels which include arteries, veins and capillaries.

For more details regarding the respiratory system and the circulatory system, visit:

https://brainly.com/question/14321657

#SPJ2

which of the following statements about signing statements is false

Answers

A signing statement is a written statement that the President issues at the time of signing a bill into law. The statement usually contains the President's interpretation of the law, their understanding of how the law will be executed and their expectations of the law's impact.

In essence, it provides an opportunity for the President to explain their views about the bill. However, some of the statements that have been issued in the past have caused controversy and have been considered unconstitutional.

The false statement about signing statements is that they are required by the Constitution. This is not true because the Constitution does not provide for the use of signing statements. In fact, they are considered a relatively modern practice that started in the 20th century. Additionally, there is no statutory or constitutional basis for signing statements.

Over time, signing statements have been used by presidents to express their reservations or objections to a particular piece of legislation. However, this is not the same as vetoing the bill. Presidents use signing statements to try to shape the meaning and implementation of the law in line with their policy goals. Critics of signing statements argue that they undermine the separation of powers, interfere with the role of the courts, and reduce accountability.

To know more about President visit:

https://brainly.com/question/11616771

#SPJ11

Glycolysis is the first of three steps in cellular respiration. Review glycolysis by matching each phrase on the right with a term on the left. Some terms are used twice.
____1. Compound formed between glucose and pyruvic acid
____2. Not involved in glycolysis
____3. Fuel molecule broken down in glycolysis
____4. Produced by substrate-level phosphorylation
____5. Invested to energize glucose molecule at start of process
____6. Reduced as glucose is oxidized
____7. Glucose converted to two molecules of this
____8. Assembled to make ATP
____9. "Splitting of sugar" 10. Carries hydrogen and electrons from oxidation of glucose
A NADH
B. Pyruvic acid
C ATP
D. NAD
E .Glucose
F. Glycolysis
G. ADP and P
H.Oxygen
I. Intermediate

Answers

Answer:Glycolysis is the first of three steps in cellular respiration. Review glycolysis by matching each phrase on the right with a term on the left. Some terms are used twice.

____1. Compound formed between glucose and pyruvic acid

____2. Not involved in glycolysis

____3. Fuel molecule broken down in glycolysis

____4. Produced by substrate-level phosphorylation

____5. Invested to energize glucose molecule at start of process

____6. Reduced as glucose is oxidized

____7. Glucose converted to two molecules of this

____8. Assembled to make ATP

____9. "Splitting of sugar" 10. Carries hydrogen and electrons from oxidation of glucose

A NADH

B. Pyruvic acid

C ATP

D. NAD

E .Glucose

F. Glycolysis

G. ADP and P

H.Oxygen

I. Intermediate

Explanation:

The answer to the statements are:

A. NADHB. Pyruvic acidC ATPD. NADE . GlucoseF. GlycolysisG. ADP and PH.OxygenI. Intermediate

What are cellular respiration and its purpose?

Cellular respiration is the system that occurs inside the mitochondria of organisms (animals and plants) to break down sugar inside the presence of oxygen to release strength in the form of ATP. This system releases carbon dioxide and water as waste products.

Learn more about Cellular respiration here: https://brainly.com/question/14158795

#SPJ2

Which of the following statements is TRUE?A. Transcription and translation are continuous processes in eukaryotes but not prokaryotesB. Transcription and translation are continuous processes in prokaryotes but not eukaryotesC. All of the processes occur in the same site in the cell for prokaryotes and eukaryotesD. mRNA is processed before translation in prokaryotes but not eukaryotesE. Transcription and translation are continuous processes in both eukaryotes and prokaryotes

Answers

Transcription and translation are processes that happens in both prokaryotes and eukaryotes, but in eukaryotic cells they take place in different sites than in prokaryotic cells. Therefore, C is incorrect.

In eukaryotic cells, the mRNA is extensively processed before it is ready to be translated, not in prokaryotic cells. Therefore, D is incorrect as well.

In eukaryotic cells, transcription and translation are separate processes, transcription takes place in the nucleus and translation takes place in the cytoplasm. In prokaryotic cells, transcription and translation both takes place in the cytoplasm, being a continuous process. Therefore, A is incorrect, E is wrong too and the correct answer is B. Transcription and translation are continuous processes in prokaryotes but not eukaryotes.


How do patterns associated with various types of transformations affect expression of culture
Delief and values in quilt making ?

Answers

Answer:

make the brainliest answer plss :)

How do patterns associated with various types of transformations affect expression of cultureDelief and

A firm operated at 80% of capacity for the past year, during which fixed costs were $210,000, variable costs were 70% of sales, and sales were $1,000,000. Operating profit was: Question 26 options: $90,000 $210,000 $590,000 $490,000

Answers

During the previous year, a company ran at 80% of capacity, incurring $210,000 in fixed expenses, 70% of sales in variable costs, and $900,000 in sales. The company's operating profit is (A) $90,000.

To calculate the operating profit of the firm, we need to consider the fixed costs, variable costs, and sales.

Fixed costs are expenses that remain constant regardless of the level of production or sales. In this case, the fixed costs are given as $210,000.

Variable costs are expenses that vary with the level of production or sales. Here, variable costs are stated as 70% of sales.

Sales for the year are given as $1,000,000.

To find the operating profit, we need to subtract the total costs from the sales revenue.

Variable costs can be calculated by multiplying the sales by the variable cost percentage:

Variable Costs = 70% * $1,000,000 = $700,000

Total Costs can be obtained by summing the fixed costs and variable costs:

Total Costs = $210,000 + $700,000 = $910,000

Operating Profit can be calculated by subtracting the total costs from the sales:

Operating Profit = $1,000,000 - $910,000 = $90,000

Therefore, the operating profit for the firm is $90,000.

To know more about the operating profit refer here :

https://brainly.com/question/28344071#

#SPJ11

What chemical bond most likely stores the mos energy?

Answers

The chemical bond that typically stores the most energy is the covalent bond, specifically the triple bond, as it involves the sharing of the highest number of electrons.

Covalent bonds involve the sharing of electrons between atoms, resulting in the formation of a stable molecule. Within covalent bonds, there are variations in bond strength, which correspond to the amount of energy required to break the bond.

Among covalent bonds, triple bonds are generally the strongest and store the most energy. Triple bonds involve the sharing of three pairs of electrons between two atoms. Examples include nitrogen gas (N2) and acetylene (C2H2), where the nitrogen and carbon atoms form triple bonds, respectively.

The strength of a covalent bond depends on several factors, including the number of shared electron pairs and the types of atoms involved. Bonds with higher bond orders (such as double or triple bonds) tend to be stronger and store more energy compared to single bonds.

It is important to note that other types of chemical bonds, such as ionic bonds and metallic bonds, also play significant roles in storing and releasing energy, but in general, covalent bonds, particularly triple bonds, are known for storing the most energy.

For more such answers on Covalent bond

https://brainly.com/question/2234173

#SPJ8

the hiv drug azidothymidine (azt) has what mechanism of action?choose one:a. it is an integrase inhibitor.b. it is a protease inhibitor.c. it is a reverse transcriptase inhibitor.d. it blocks the cd4 receptor.

Answers

The HIV drug azidothymidine (AZT) has it is a reverse transcriptase inhibitor mechanism of action.

Azidothymidine, generally known as zidovudine or AZT, is a medication used to prevent HIV-positive people from developing AIDS (acquired immunodeficiency syndrome). The class of medications known as nucleoside reverse transcriptase inhibitors (NRTIs) includes AZT. The U.S. Food and Drug Administration granted the first of these medications, AZT, approval in 1987 with the goal of extending the lives of AIDS patients.

Only when HIV is reproducing into proviral DNA—viral DNA that has not yet been integrated into host DNA—does AZT become effective against it. This is due to the fact that AZT's active ingredient, zidovudine 5-triphosphate, has a high affinity (attraction) for the reverse transcriptase enzyme that retroviruses like HIV employ to generate viral DNA.

Learn more about Azidothymidine(AZT):

https://brainly.com/question/13164482

#SPJ4

A crocodile-like morphology evolved independently in a group of Triassic reptiles called phytosaurs, and later, after phytosaurs were extinct, in true crocodiles. This is an example of: Sympatric speciation. Iterative evolution Evolutionary drift Genetic drift Lamarckian evolution

Answers

The correct answer is iterative evolution. A crocodile-like morphology evolved independently in a group of Triassic reptiles called phytosaurs, and later, after phytosaurs were extinct, in true crocodiles. This is an example of iterative evolution.

Iterative evolution is the development of similar structures or forms independently over time in separate lineages. This is frequently seen in unrelated lineages of organisms that evolve similar features through convergent evolution. The crocodile-like morphology that evolved independently in Triassic reptiles called phytosaurs and later in true crocodiles is an example of iterative evolution as they evolved independently in separate lineages. The ability of the phytosaurs to thrive in an aquatic environment likely contributed to the development of this morphology, which later allowed true crocodiles to similarly thrive.

Phytosaurs as flying birds:

https://brainly.com/question/32090966

#SPJ11

After lunch our digestive system will use the process of hydrolysis to break the food down into smaller subunits.
True
False

Answers

The given statement "After lunch our digestive system will use the process of hydrolysis to break the food down into smaller subunits" is TRUE.

The chemical reaction that occurs when a molecule is split into two or more fragments with the use of water is known as hydrolysis. It's a common process in both inorganic and organic chemistry. Hydrolysis plays an important role in the digestive system in breaking down large food molecules into smaller, more soluble molecules that can be absorbed into the bloodstream.Hence, After lunch our digestive system will use the process of hydrolysis to break the food down into smaller subunits is a true statement.

To learn more about digestive system

https://brainly.com/question/28978933

#SPJ11

How are leaves and roots similar? (Select all that apply.)
A. both contain xylem
B. both contain a pistil
C. both contain phloem
D. both contain stomata

Answers

Answer:

Similarity: Both stems and roots contain vascular tissue (xylem and phloem), the circulatory system of the plant.

Please spend some time reflecting on what you've learned about acids and bases and
think about some of the cleaning items in your house. Answer the questions below and
forward them to your teacher. Each question is worth 10 points.
1. Think about some of the items that we use and consume everyday, like shampoo,
toothpaste, soap, food, etc. Which of the items are acids, and which are bases? Keep
a journal of various items you use for one week. Include in your journal several
properties of each item, whether it is an acid or a base, and why you think so.

Answers

Answer:

1. Most shampoos are acidic, soap and toothpaste are mostly alkaline.

2. Toilet cleaner - Acidic, Lotion - Acidic, Bleach - Alkaline, Lemon Juice - Acidic

What is the important ingredient in the neutralization buffer and what does it do?

Answers

The important ingredient in a neutralization buffer is a base, usually sodium hydroxide (NaOH) or potassium hydroxide (KOH). The purpose of the neutralization buffer is to adjust the pH of a solution to a neutral level (around pH 7) by neutralizing any excess acid present.

When an acid and a base react, they undergo a chemical reaction called neutralization, resulting in the formation of water and a salt. The base in the neutralization buffer reacts with the acid, effectively neutralizing its acidic properties and increasing the pH of the solution. This is important in various biological and chemical processes where maintaining a specific pH is critical for optimal functioning. The neutralization buffer helps maintain a stable pH environment, allowing for accurate and consistent experimental results or suitable conditions for specific reactions to occur.

To know more about neutralization

brainly.com/question/14156911

#SPJ11

over left ischial tuberosity 3.5cm x 2.5cm tissue damage extends to muscle with undermining along right wound margin wound base not completely visualized

Answers

The wound over the left ischial tuberosity measures 3.5cm x 2.5cm and involves tissue damage extending into the muscle. Undermining is present along the right margin of the wound, and the base of the wound cannot be fully visualized.

This description indicates the characteristics and extent of a wound located on the left ischial tuberosity. The wound measures 3.5cm x 2.5cm, indicating its size. The tissue damage extends into the muscle, suggesting a deeper wound that affects underlying structures.

Undermining along the right margin of the wound refers to the presence of tissue separation or loss beneath the intact skin edges, which can complicate wound healing. The fact that the wound base is not completely visualized means that the full depth and extent of the wound cannot be clearly seen, which may require further examination or assessment to determine its full nature and appropriate treatment.

To learn more about tuberosity, click on:

brainly.com/question/31831162

#SPJ11

Other Questions
I need help in this ixl 6. A commuter backs her car out of her garage with an acceleration of 1.40 m/s^2 . (a) How long does it take her to reach a speed of 2.00 m/s in your understanding, do you think that the following statement is correct: "water is an effective solvent for living systems because of its inert behavior"? why or why not? explain your answer. In what way did television greatly impact culture in the 1960s and 1970s?A)B)()D)Its popularity made radios obsolete.It ended social and political strife by promoting unity.It led to a lack of interest in social issues and concerns because more andmore people stayed home to watch television rather than become involvedin causes relevant to the time period.It created greater social awareness-and many times divisions-as peoplewere able to witness things like civil rights protests, the Vietnam War, andthe Watergate scandal firsthand from their own living rooms. perdone, es _ la plaza de la fuente? Based on the map above, which of the following statements is accurate? A. Coffee is grown in tropical climates along the Equator. The United States and China are the world's leading coffee producers. C. Coffee can be grown in most climate zones. D. Most of the world's coffee is grown in the Asia/Pacific region. Please select the best answer from the choices provided. | OD Help me please. Find AC Im unsure where to plot the five points and shade in how do the details about the setting add to your understanding of events that took place before the story began there will come soft rains which of the following graphs represents the functional relationship between the volume of a gas at constant p and t and its corresponding number of gas moles present in container? How many molecules are in 120.0 g of oxygen gas? g the free energy associated with the proton gradient that develops across the inner mitochondrial membrane as a result of the electron transport chain is 23.3 kj per mole of protons. if fadh2 is the only electron donor to the electron transport chain, how many moles of fadh2 would be required to produce a proton gradient in which exactly one mole of protons have been pumped across the membrane, assuming we start with no gradient? the standard reduction potential of fadh2 is 0.10 v, and that of o2 is 0.81 v. select the closest value from the options below. a) 3 mol fadh2 d) 0.17 mol fadh2 b) 1 mol fadh2 e) 5.8 mol fadh2 c) 0.5 mol fadh2 Comparing the play and the diaryIf you dont know the story it call The Diary of Anne Frank... PLEASE HELP FAST!!!! For the story of The Diary of Anne Frank...What is the answer to the problem below? What is the mood in this passage from the play? A. Excited B. Panicked C. Happy D. Calm What do you learn here that you cannot learn from the diary? A. How Peter looksB. What the Van Daans personalities are like C. How people talk when Anne is not there D. How far the Franks traveled in order to hide What is different in the content between the play and the diary? A. Which family arrives firstB. Whether Anne or Peter is younger C. Whether Van Daan is nervous or not D. Whether Mr. Frank is confident or not Please answer all these questions!!! There are 15 books on a shelf. 9 of these books are new. The rest of them are used. what is the ratio of all books cu has an anomalous electron configuration. write the observed electron configuration of cu . express your answer in complete form in order of orbital filling. for example, 1s22s2 should be entered as 1s^22s^2. Sherrie buys a laptop computer for $600. Each year, the value of her laptop decreases by $40. How many years will it take before the laptop is not worth anything? Explain how you know your answer is correct. The __________ defines who may access the network, how they may access the network, and what they can access.A) service level agreement (SLA)B) network access policyC) statements of work (SOW)D) multi-source agreement (MSA) A local screen-printing company sells T-shirts at various prices, in dollars, depending upon how many T-shirts are bought at the time. The piecewise function below represents their pricing structure, where n is the number of T-shirts purchased. The school volleyball team purchased 20 shirts.How much did the volleyball team spend on shirts?$480$180$220$260 People with chronic asthma sometimes take medication that relieves bronchospasms. Which cicosanoid would the drug probably inhibit? Answers: A. Leukotriene B. Prostacyclin C. Prostaglandin D. Thromboxane i need this pls answer