Fitness is defined as the probability of an organism ............ and ............ in the environmen
in which it is found.
Which words correctly complete gaps 1 and 2?

A. photosynthesising and respiring
B. reproducing and respiring
C. surviving and reproducing
D. surviving and photosynthesising

Answers

Answer 1

Answer:

C

Explanation:


Related Questions

the first part of cellular respiration is called glycolysis, takes place in the _ and does not require any_

Answers

The first part of cellular respiration is glycolysis. It takes in the cytoplasm and does not require any oxygen.

What is glycolysis?

Glycolysis is the first stage of cellular respiration. In this reaction, glucose molecules are broken down to produce two pyruvate molecules - 3 carbon compounds.

The process of glycolysis takes place in the cytoplasm of cells and happens in a two steps reaction:

Glucose is first phosphorylated to form glucose-6-phosphateThe glucose-6-phosphate produced undergoes isomerization to form fructose-6-phosphateFructose-6-phosphate undergoes phosphorylation to become fructose-1, 6-biphosphatefructose-1, 6-biphosphate cleaves to produce two 3-carbon molecules known as pyruvates.

Thus, glycolysis requires two molecules of ATP for the two phosphorylation reactions. It is a process that does not require oxygen.

More on cellular respirations can be found here: https://brainly.com/question/13721588

#SPJ1

Given the DNA sequence and three restriction enzymes (Hindill, Pstl and BamHI), write out the sequence of the digestion products for both DNA strands when the DNA sequence is subjected to digestion by a mixture of three restriction enzymes? 5 CTGTTACTGCAGCTAACGTGGATCCGGTCAATCTTCA 3 Restriction recognition sequences (1 - the cleavage site): Hindiri 5-A|AGCTT-3 3-TTCGA|A-5 BamHI 5-G|GATCC-3 3-CCTAG|G-5 Pst! 5-CTGCA G-3' 3-G|ACGTC-5

Answers

To determine the digestion products when the DNA sequence is subjected to digestion by a mixture of three restriction enzymes (HindIII, PstI, and BamHI), we need to locate the recognition sites of each enzyme and identify the resulting fragments..

The recognition sequences and cleavage sites are as follows:

HindIII:

Recognition sequence: 5'-AAGCTT-3'

Cleavage site: A|AGCTT

BamHI:

Recognition sequence: 5'-GGATCC-3'

Cleavage site: G|GATCC

PstI:

Recognition sequence: 5'-CTGCAG-3'

Cleavage site: CTGCA|G

Given the DNA sequence: 5'-CTGTTACTGCAGCTAACGTGGATCCGGTCAATCTTCA-3'

HindIII cuts at A|AGCTT, resulting in two fragments:

Fragment 1: 5'-CTGTTACTGCAGCTAA-3'

Fragment 2: 5'-CGTGGATCCGGTCAATCTTCA-3'

BamHI cuts at G|GATCC, resulting in two fragments:

Fragment 3: 5'-CTGTTACTGC-3'

Fragment 4: 5'-AGCTAACGTGGATCCGGTCAATCTTCA-3'

PstI cuts at CTGCA|G, resulting in two fragments:

Fragment 5: 5'-CTGTTACT-3'

Fragment 6: 5'-AGCTAACGTGGATCCGGTCAATCTTCA-3'

So, when the DNA sequence is subjected to digestion by the mixture of HindIII, PstI, and BamHI, the digestion products for both DNA strands are as follows:

Top strand:

Fragment 1: 5'-CTGTTACTGCAGCTAA-3'

Fragment 2: 5'-CGTGGATCCGGTCAATCTTCA-3'

Fragment 3: 5'-CTGTTACTGC-3'

Fragment 4: 5'-AGCTAACGTGGATCCGGTCAATCTTCA-3'

Bottom strand:

Fragment 5: 5'-AGTAACTGCACTTAG-3'

Fragment 6: 5'-TCGACCTAGGCACCGAGTTAGAAGT-3'

Fragment 3: 5'-CTGTTACTGC-3'

Fragment 4: 5'-AGCTAACGTGGATCCGGTCAATCTTCA-3'

To know more about DNA sequence

brainly.com/question/31650148

#SPJ11

What is the resistance of a circuit with a voltage of 10 volts (V) and a current of 5 amps (A)? Use Ohm’s law to calculate the resistance.
The resistance of a circuit with a voltage of 10 V and current of 5 A is
ohms.

Answers

Answer: R = 2 ohm

Explanation: Based on the Ohm's law

                      U = R*I    --->   R = U / I

                                              R = 10 / 5

                                              R = 2 ohm

Answer:

Answer : The resistance of a circuit is 2 ohm.

 

Explanation:

Using Ohm's law :

Or,

where,

R = resistance of a circuit = ?

V = voltage of circuit = 10 volts = 10V

I = current flowing in a circuit = 5 A

Now put all the given values in the above formula, we get the resistance of circuit.

Therefore, the resistance of a circuit is 2 ohm.

Definition of photosynthesis (10 marks)

Answers

Photosynthesis is the biological process by which green plants, algae, and some bacteria convert light energy from the sun into chemical energy in the form of glucose and oxygen.

It is the primary process responsible for generating and maintaining oxygen levels in the Earth's atmosphere, as well as serving as the foundation of most food chains and ecosystems.

During photosynthesis, plants use pigments, primarily chlorophyll, located in specialized structures called chloroplasts, to capture light energy. This energy is then used to convert carbon dioxide (CO2) from the atmosphere and water (H2O) from the soil into glucose (C6H12O6) and oxygen (O2).

This process occurs in two main stages: the light-dependent reactions and the light-independent reactions (also known as the Calvin cycle).

Overall, photosynthesis is a crucial process that sustains life on Earth by producing oxygen and providing the energy-rich molecules necessary for organisms to carry out their metabolic activities.

It represents the fundamental mechanism by which autotrophic organisms convert solar energy into chemical energy, driving the functioning of ecosystems and ultimately supporting all life forms.

For more such answers on Photosynthesis

https://brainly.com/question/19160081

#SPJ8

Freedman Flowers stock has a 50% chance of producing a 25% return, a 30% chance of producing a 10% return, and a 20% chance of producing a -28% return. What in the film's expected rate of re Ca.9.415 Ob. 9.9006 Cc. 9.65 Od. 10.15%

Answers

The expected rate of return of Freedman Flowers is 9.9%.

Expected rate of return is the sum of the multiplication of each possible return with its corresponding probability of occurrence. Freedman Flowers' stock has a 50% chance of producing a 25% return, a 30% chance of producing a 10% return, and a 20% chance of producing a -28% return. The expected rate of return of Freedman Flowers can be calculated as follows:

Expected rate of return = (Probability of return 1 × Return 1) + (Probability of return 2 × Return 2) + (Probability of return 3 × Return 3)

Therefore, the expected rate of return of Freedman Flowers is:

Expected rate of return = (0.5 × 25%) + (0.3 × 10%) + (0.2 × -28%)

Expected rate of return = 12.5% + 3% - 5.6%

Expected rate of return = 9.9%

Therefore, the expected rate of return of Freedman Flowers is 9.9%.Option B, 9.9006 is the closest to the calculated expected rate of return.

Learn more about Freedman Flowers from the given link:

https://brainly.com/question/13923275

#SPJ11

what organisms will be affected if crickets, small insects and earthworms are killed by pesticides?

Answers

Answer: Earthworms are vital for soil health and recycling of plant material, yet pesticides appear to be jeopardising their reproduction and survival. As well as earthworms, other important organisms are being affected by the long-term, indiscriminate and excessive application of pesticides.

I HOPE THIS HELPS

Earthworms are important for soil health and plant material recycling, but pesticides appear to be threatening their reproduction and survival.

What are pesticides?

Pesticides are used to control a wide range of pests and disease carriers, including mosquitos, ticks, rats, and mice.

In agriculture, pesticides are used to control weeds, insect infestations, and diseases.

Many insecticides act on the nervous system of the insect, while others act as growth regulators or endotoxins.

Most act on neurons by causing a sodium/potassium imbalance, which prevents normal nerve impulse transmission.

The most well-known organochlorine pesticide is dichlorodiphenyltrichloroethane, also known as DDT, an insecticide whose uncontrolled use caused numerous environmental and human health problems.

Earthworms are beneficial to soil health and plant material recycling, but pesticides appear to be endangering their reproduction and survival.

Thus, the organisms including Robins are most likely affected due to this scenario, as they feed on organisms such as small insects, crickets, etc.

For more details regarding pesticides, visit:

https://brainly.com/question/24316938

#SPJ2

[Flagged - Stuck between B and C, and went with C as it made the most sense overall]
Question 53 - Passage 10
Based on the information in the passage, the mutation that causes the LP phenotype is most likely located in:
A. an intron within the lactase gene.
B. the coding sequence of the lactase gene.
C. an enhancer sequence of the lactase gene.
D. the stop codon at the end of the lactase gene.

Answers

According to the passage, the mutation that causes the LP phenotype is most likely located in an enhancer sequence of the lactase gene.

The passage states that the lactase gene has an enhancer sequence that controls its expression in the intestine. The mutation that causes lactase persistence likely affects this enhancer sequence, allowing lactase to continue to be produced into adulthood. This is supported by studies mentioned in the passage that have identified variations in this enhancer sequence among different populations with varying degrees of lactase persistence. Therefore, option C is the most appropriate answer to this question.


Based on the information provided, the mutation that causes the Lactase Persistence (LP) phenotype is most likely located in an enhancer sequence of the lactase gene (option C). This is because enhancer sequences play a role in regulating gene expression, and the LP phenotype is associated with increased lactase production in adults. A mutation in an enhancer sequence could alter the regulation of the lactase gene, leading to the observed phenotype. Options A, B, and D are less likely as they involve different parts of the gene and may not have the same impact on gene regulation and expression.

To know about mutation visit:

https://brainly.com/question/17130462

#SPJ11

Vocabulary Matching

Vocabulary Matching

Answers

Ecosystem, specialist species, niche, habitat, nonnative species, generalist species, extinction, Keystone species, indicator species, natural selection

An organism's home is known as its habitat, and its function in its environment is known as its niche. While niche focuses on how the creature effects the environment, habitat focuses on how the environment impacts the organism.

What about species?A group of things that share the same kind and name: kind. A group of related organisms with the capacity to bear viable offspring that falls below the genus level and is designated by a two-part scientific name. A group of plants or animals that may reproduce together and have similar characteristics is referred to as a species.A collection of people with similar traits who can interbreed to create fruitful offspring is how species are frequently defined. Alpaca - Vicugna pacos are two examples. A group of creatures that can naturally reproduce with one another and generate viable progeny is sometimes referred to as a species. However, classifying a species can be challenging and even contentious. The billions of people on the planet now are all members of the same species, Homo sapiens. Human beings differ among themselves, just like other species do, in terms of everything from size and shape to skin tone and eye color. The two-part name that Linnaeus invented is still used today and is currently presented in either Latin or Greek. It was originally used for plants and then later for animals. The first identifies the larger group, known as a genus, to which the plant belongs, while the second refers to the plant itself as a species.

Learn more about species here:

https://brainly.com/question/25939248

#SPJ13

Which of the following is NOT a true statement about the kidneys?

A) Blood leaves the kidneys through the ureter

B) The kidneys filter about 2,000 L of blood

C) The kidneys contain microscopic filters that clean the blood

D) A concentrated mixture of waste materials are collected in the kidneys of excretion

Answers

I think the answer to this is A

how are art and conservation science connected in this sculpture?

Answers

Answer: the artist was repurposing materials to create a variety of different masterpieces

What environmental input is necessary for the Calvin cycle reactions?

Answers

The environmental input that is necessary for the Calvin cycle reactions is carbon dioxide (CO₂). It is captured and utilized by the enzyme Rubisco to convert carbon dioxide into glucose during the process of photosynthesis.

The Calvin Cycle, also referred to as the dark reaction, C3 cycle, or carbon fixation, is a sequence of enzyme-assisted reactions that occur in the stroma of chloroplasts in photosynthetic organisms. The Calvin cycle is responsible for transforming carbon dioxide (CO₂) into a high-energy molecule, which is used to produce glucose. This procedure occurs in three stages: carbon fixation, reduction, and regeneration. Environmental input for Calvin CycleIn the Calvin cycle, carbon dioxide is required as an environmental input.

Learn more about Calvin Cycle: https://brainly.com/question/920840

#SPJ11

Write a description of the structure of DNA and a brief summary of Replication
(Own words please!)

Answers

Answer:

DNA is something that's in a person it's basically something that's in your body that you can use for mulitpule things.

The repeated unit of DNA, made up of a sugar, phosphate, and
nitrogenous base, is known as a - *
nucleotide.
double helix
adenine.
thymine.

Answers

Your answer is nucleotide. A nucleotide is made up of sugar, phosphate, and a nitrogenous base.

The anoxygenic purple and green photosynthetic bacteria can inhabit the deeper anoxic zones because their __________ and accessory pigments enable their use of light in the far-red spectrum that is not used by other photosynthetic organisms.

Answers

The anoxygenic purple and green photosynthetic bacteria can inhabit the deeper anoxic zones because their  bacteriochlorophyll pigments and accessory pigments enable their use of light in the far-red spectrum that is not used by other photosynthetic organisms.

The anoxygenic purple and green photosynthetic bacteria can inhabit the deeper anoxic zones because their bacteriochlorophyll pigments and accessory pigments enable their use of light in the far-red spectrum that is not used by other photosynthetic organisms.

Anoxygenic photosynthetic bacteria have specific pigments, such as bacteriochlorophylls and carotenoids, which allow them to capture light energy for photosynthesis. These pigments have absorption peaks in the far-red spectrum, typically ranging from 800 to 1000 nanometers. This is a range of light wavelengths that is not efficiently absorbed by other photosynthetic organisms, including oxygenic (oxygen-producing) photosynthetic bacteria and plants.

By utilizing the far-red spectrum of light, the anoxygenic bacteria are able to carry out photosynthesis in environments with lower light intensities and where other photosynthetic organisms cannot effectively compete for light energy. These bacteria are adapted to live in anaerobic (oxygen-limited) environments, such as deep layers of water bodies or sediments, where oxygen concentration is low or absent.

The ability of anoxygenic bacteria to utilize light in the far-red spectrum allows them to access a niche that is not occupied by other photosynthetic organisms. This gives them a competitive advantage in anaerobic environments and allows them to thrive in deeper zones where other photosynthetic organisms are unable to survive.

Overall, the unique pigments of anoxygenic purple and green bacteria enable them to harness light energy in the far-red spectrum, providing them with a distinct ecological niche in anoxic environments.

To know more about photosynthetic bacteria  follow the link:

https://brainly.com/question/30556564

#SPJ4

Which form of vesicular transport uses motor proteins to bring fluid and solutes into the cell?

Answers

Endocytosis is the form of vesicular transport that uses motor proteins to bring fluid and solutes into the cell.

Endocytosis is a cellular process that involves the engulfment of extracellular material into the cell by the formation of vesicles. It is accomplished through the interaction of motor proteins with the cell membrane. There are different types of endocytosis, including phagocytosis, pinocytosis, and receptor-mediated endocytosis. In all these processes, motor proteins play a crucial role in the internalization of materials. Motor proteins, such as myosins and kinesins, use energy from ATP to move along the cytoskeleton and facilitate the inward movement of vesicles containing fluid and solutes. This process allows cells to internalize nutrients, signaling molecules, and other substances from the extracellular environment. By utilizing motor proteins, endocytosis enables the controlled uptake of specific substances into the cell and contributes to various cellular functions, including nutrient acquisition, receptor regulation, and maintenance of cellular homeostasis.

To know more about  Endocytosis click here,

https://brainly.com/question/5302154

#SPJ11

Pascal is a unit of a trust state the statement is true or false​

Answers

Answer:

False

Explanation:

Pascal is the unit of pressure

On a microscopic scale, the energy change in a system is described by a ___________

a. A change in color or texture
b. Measuring the temperature
c. A chemical equation
d. An odor

Answers

Answer:

the answer is c a chemical equation

Sections of a chromosome that code for a trait are called what?

Answers

Answer:

genes ( tell me if I am wrong thx! )

Explanation:

Amy run hard during a race. The level of carbon dioxide in her bloodtream increae, becoming higher than normal. — Decribe one way Amy' body i likely to repond. — Explain how thi repone will help to lower level of carbon dioxide in her bloodtream

Answers

Amy runs hard during a race. Carbon dioxide levels in her bloodstream rise, becoming higher than normal. Any change in an organism's environment that causes the organism to react.

In physiology, a stimulus is a detectable change in the physical or chemical structure of an organism's internal or external environment. The ability of an organism or organ to detect external stimuli, so that an appropriate reaction can be made, is called excitability sensitivity.He is hungry, so he eats something. A rabbit is scared and runs away. You're cold so you put on a jacket. External stimuli include touch and pain, vision, smell, taste, sound, and balance balance. These sensory stimuli are activated by external changes. Pain is the stimulus that can provoke a greater response from the organism. Homeostasis is the body's ability to maintain a stable internal environment despite a changing external environment. Homeostasis is maintained primarily through negative feedback, when a response to a stimulus keeps a variable close to a set value.

To learn more about Homeostasish please click on below link.

https://brainly.com/question/3888340.

#SPJ4

The graphs below show the changes in crab color at one beach from 1950 to 1990.

The change in crab color is an example of which type of evolution?

O A. Stabilizing selection, because one crab color was preferred over other colors.

O B. Stabilizing selection, because two crab colors were preferred over other colors.

O C. Directional selection, because two extreme colors were preferred over the more moderate color.

O D. Disruptive selection, because two extreme colors were preferred over the more moderate color.

O E. Adaptive radiation, because crabs of a single color evolved to form crabs of several colors.

The graphs below show the changes in crab color at one beach from 1950 to 1990. The change in crab color

Answers

The change in crab color is an example of Disruptive selection because two extreme colors were preferred over the more moderate color. Thus, the correct option for this question is D.

What is Natural selection?

Natural selection may be defined as the selection of a few individuals from any given population according to their favorable variations.

In 1950, the crab color is in the form of stabilizing selection, while in 1990, it changes to disruptive selection that favors the two extreme colors over the intermediate one.

Disruptive selection occurs when environmental conditions changes in two different directions. Due to which variance increases in population.  

Therefore, the correct option is D.

To learn more about Natural selection, refer to the link:

https://brainly.com/question/14385908

#SPJ1

What are diseases such as a strep throat and Athlete's foot caused by?a. miasmab. decaying matterc. microorganismsd. temperature changes

Answers

Diseases such as strep throat and Athlete's foot are caused by microorganisms. The correct option is c.

Microorganisms, including bacteria and fungi, are responsible for causing a wide range of infections and diseases in humans. Strep throat is primarily caused by the bacterium Streptococcus pyogenes, while Athlete's foot is caused by various types of fungi, most commonly Trichophyton species.

These microorganisms can infect the body through direct contact, inhalation of airborne particles, or by coming into contact with contaminated surfaces. They invade and colonize the body, leading to the development of specific symptoms and manifestations associated with each disease.

While factors such as miasma (a concept that referred to bad air or foul smells as the cause of disease) and temperature changes may have been historically associated with disease, the primary causative agents in cases like strep throat and Athlete's foot are microorganisms.

Here you can learn more about strep throat

https://brainly.com/question/29762380#

#SPJ11  

think about the cells you observed. record your observations for each phase of the cell cycle. what distinguishable features do you see in each phase? be sure to use terms like chromosomes, chromatin, nucleus, nuclear membrane, spindle fibers, and describe the arrangement of the genetic material.

Answers

In cell cycle Interphase, M phase and Cytokinesis have different arrangements of chromosomes,nuclear membranes,chromatin etc.Cell cycle involves three phases.

The various periods of a cell cycle include:

Interphase - This stage incorporates the G1 stage, S stage and the G2 stage.

M stage - This is the mitotic stage and is separated into prophase, metaphase, anaphase and telophase.

Cytokinesis - In this stage the cytoplasm of the cell separates.

Interphase is the main phase of cell cycle. The cell stays in the interphase for most extreme periods by covering itself under various nuclear membranes. During this stage the cell sets itself up for division. The cell division goes through cell development and replication of chromatin  during this stage.

During the G1 stage the cell keeps on developing yet doesn't repeat.During the S stage the DNA of the cell duplicates.During the G2 stage the RNA, proteins and different macromolecules expected for mitotic division are created by the cell.

To know more about cell cycle, visit here:

https://brainly.com/question/15876101

#SPJ4

Carlo, in labor with her first child, is in a great deal of pain and has been experiencing strong contractions for nearly 12 hours with little progress toward birth. Although Carla was hoping for a natural birth, her doctor has urged her to use an epidural. Which of the following problems occues MOST often following an epidural? Newborus are at high risk for birth complications like cerebral palsy. An epidural increases the chance of having a cesarean section An epidural speeds up the labor process. The mother loses consciousness prior to delivery

Answers

An epidural increases the chance of having a cesarean section, the correct option is B.

An epidural is a regional anesthesia technique commonly used during labor to provide pain relief to the mother. While it effectively reduces the pain experienced during childbirth, it can also have certain effects and potential risks. One of the most common problems associated with epidurals is an increased likelihood of cesarean section.

When an epidural is administered, it can lead to a decrease in the mother's ability to feel and control her contractions. This can result in a longer labor process and potential complications, such as fetal distress or an inability to progress in labor. The correct option is B.

To learn more about epidural follow the link:

https://brainly.com/question/10438137

#SPJ4

The question is inappropriate; the correct question is:

Carlo, in labor with her first child, is in a great deal of pain and has been experiencing strong contractions for nearly 12 hours with little progress toward birth. Although Carla was hoping for a natural birth, her doctor has urged her to use an epidural. Which of the following problems occurs most often following an epidural?

A) Newborns are at high risk for birth complications like cerebral palsy.

B) An epidural increases the chance of having a cesarean section

C) An epidural speeds up the labor process.

D) The mother loses consciousness prior to delivery

true multicellularity is a major characteristic of

Answers

Answer: Eukaryotes only

A farmer eats many chickens a year. The number of soybeans it takes to feed grasshoppers, which are used to feed the chickens is represented by X. The same
number of soybeans (X) could feed approximately 397 people directly.

X number of Soybeans to grasshoppers to chickens to farmer
X number of Soybeans to 379 people
Which statement accurately compares the energy efficiency of the food chains?

A. The first chain is more efficient because the farmer can eat less food.
B. The first chain is more efficient because less energy is used to feed one person.
C. The second chain is more efficient because soybeans can feed more people
D. The second chain is more efficient because it will feed fewer animals

Answers

The second chain is more efficient because soybeans can feed more people

What is the food chain?

A food chain is a hierarchical sequence that shows how energy and nutrients are transferred from one organism to another in an ecosystem. In a typical food chain, energy flows from the sun to plants, then to herbivores, and then to carnivores, with decomposers playing an important role in recycling nutrients.

In summary, a food chain is a sequence that shows how energy and nutrients are transferred from one organism to another in an ecosystem.

Learn more about food chain:https://brainly.com/question/16065961

#SPJ1

Two brown-eyed parents have a child. The child has blue eyes.
Which term best describes the allele for the child's blue eyes?
O heterozygous
O homozygous
O dominant
O recessive

Answers

The term that best describes the allele for the child's blue eyes is recessive. Thus, the correct option for this question is D.

What is a Recessive allele?

A recessive allele may be defined as a kind of allele that when present on its own will not affect the individual. It will only be expressed in the phenotype if two copies of it are present.

According to the context of this question, the brown eye (B) is dominant over the blue eye (b). The parents have genotypes brown-eyed which means they are heterozygous for brown-eye (Bb) and when they interbreed with each other, they produce a blue eyes child which has a recessive allele of (bb).

Therefore, the term that best describes the allele for the child's blue eyes is recessive. Thus, the correct option for this question is D.

To learn more about Recessive alleles, refer to the link:

https://brainly.com/question/463037

#SPJ1

compare the birth rate death rate and population growth rate for different regions world for science

Answers

The birth rate, death rate, and population growth rate vary greatly between different regions of the world.

How do the birth and death rates compare?

In general, developed countries tend to have low birth rates and death rates, resulting in a slower rate of population growth

On the other hand, many developing countries have higher birth rates and death rates, leading to a higher rate of population growth

It's important to note that population growth rates can also be influenced by migration patterns and natural disasters, which can impact both birth and death rates.

Overall, the birth rate, death rate, and population growth rate are complex and interconnected factors that are influenced by a variety of social, economic, and environmental factors.

Read more about death rate here:

https://brainly.com/question/3000205

#SPJ1

The table below shows the amount of carbohydrates in same-size servings of different fruits.

Amount of Carbohydrates in Fruit
237 mL of Fruit
Carbohydrates (Grams)
Apples
17
Bananas
34
Cherries
19
Grapefruit
24
Oranges
21
Peaches
16
Watermelons
12

Among apples, cherries, oranges, and watermelons, a serving of which fruit would raise the level of sugar in blood by the least amount?
oranges
apples
cherries
watermelons

Answers

Among apples, cherries, oranges, and watermelons, a serving of watermelon would raise the level of sugar in blood by the least amount.

Therefore option D is correct.

What are the health benefits of watermelon?

watermelon the individual stay hydrated.

watermelon are packed with nutrients and beneficial plant compounds.

watermelon have  have anticancer effects.

watermelon improves heart health.

watermelon helps reduce inflammation and oxidative stress.

watermelon help prevent macular degeneration.

We notice in the scenario above, watermelon has the lowest amount of carbohydrates per serving, with only 12 grams of carbohydrates in a 237 mL serving.

Learn more about carbohydrates at:

https://brainly.com/question/336775

#SPJ1

How does evolution work to create the diversity of life on Earth?

Answers

Answer:

People adapt and mate with others

Explanation:

1. Describe the effect on the rate of photosynthesis if the temperature is increased from 10°c to 20°c​

Answers

Answer:

As temperature increases the number of collisions increases, therefore the rate of photosynthesis increases.

Explanation:

However, at high temperatures, enzymes are denatured and this will decrease the rate of photosynthesis

Other Questions
Which best explains why myths are created?to compare the ideas of different culturesto show the problems with having an imaginationto pass on a cultures values to future generationsto entertain the reader with humorous stories Water is the ______ in aqueous solutions because it can dissolve polar molecules. What questions do you answer when you manage a project brainly? The answer to anyones problems- describe an event directly influenced by a technology that either you or someone around you has experienced. what did you take away and how did it enhance your understanding of the technology's role? how many roots does y=x2-6x+9 have Choose the true statement about the graph of 3x 6. when writing for a multicultural audience, you should consider the following cultural variables True or false? At the pool, three out of every seven kids are not wearing goggles. Which of the following is the fraction of kids who are not wearing goggles?A : 4/7B : 3/7C : 3/4D : 4/3 WILL GIVE BRAINLY IF CORRECT PLEASE HELP Determine the slope of the line that passes through the points (-2, -1) and (3,5).When comparing the change in yvalues to the change in xvalues, (y2 y1) / (x2 x1), is the same for any two points (x1, y1) and (x2, y2)A.5/6B.4C.6/5D.1/4 If a person is unemployed because their industry has moved to another country, economists refer to the person as:________ bromine+calcium iodide calcium bromide + iodine What is the crystalline arrangement of atoms shown here? What is the prevailing mood of Morning Dawns? please helpim on my sisters acc btw lol a tragedy of the commons results when individuals choose to use more than their fair share of a collective resource. under what circumstances are these tragedies more likely to occur? HELP!!!! FAST!!!! 20 POINTS!!!! You are a traffic accident investigator. You have arrived at the scene of an accident. Two trucks of equalmass (3,000 kg each) were involved in a rear-end accident at a stop sign. Here is what you know: Truck 1 started from rest at the top of a 22-meter hill and coasted toward the intersection..Truck 2 was on a flat stretch of road at the bottom of the hill directly in front of Truck 1.At the bottom of the hill, Truck 1 was going 20 m/s; Truck 2 was going 35 m/s..There were no skid marks left by Truck 2. The collision occurred at the stop sign where Truck 2 hadstopped After the collision, both trucks moved together in the same direction at 10 m/s before slowly rollingto a stop.You must now push Truck 2, using 1,000 N of force, 8 meters off to the side of the road so no oneelse gets hurt.1. How much work was done to bring truck 2 to a stop? 2. If tuck 2 came to a stop In 15 seconds, how much power (in watts) did it take to stop truck 2 at the sign by applying force to the brakes? 3. What is the final combined momentum of the trucks right after the accident? 4. Assuming that there are no other no conservation forces involved, what impulse was given to each truck during the collision? A. Truck 1: B. Truck 2: Aiden is a physical therapist who specializes in leg injuries. His patients differ in age and type of injury Knee pain Ankle pain 2 4 a 0-12 years old 13-19 years old 1 4 What is the probability that a randomly selected patient suffers from ankle pain given that the patient is 13-19 years old? Simplify any fractions. please solve this question