Find the length of the missing side.
14.5 m
7.3 m
X

Find The Length Of The Missing Side.14.5 M7.3 MX

Answers

Answer 1

Answer:

x=  12.528

*rounded is 12.53 or 12.5

Step-by-step explanation:

7.3 ^2 + x^2 = 14.5^2

53.29 + x^2 = 210.25

-53.29            -53.29

x^2= 156.96

x= 12.528


Related Questions

Please help I will give brainiest pls

Please help I will give brainiest pls

Answers

46.5 is your answer

true-false questions: justify your answers. 1.13 the solution set to a system of three equations in three unknowns cannot be a plane. 1.14 a system of linear equations cannot have only two solutions. 1.15 the solution set to a consistent rank 2 linear system in four unknowns would be a line in four-dimensional space. 1.16 a system of four equations in four unknowns always has a solution. 1.17 a system of four equations in four unknowns can have at most one solution. 1.18 the rank of a system is always less than or equal to the number of equations in the system. 1.19 use geometric reasoning to answer the following questions concerning systems (i) and (ii) below: (a) if (i) has exactly one solution, then the same is true for (ii). (b) if the solution set of (i) is a line, then the same is true for (ii). (c) if (i) has no solutions, then the same is true for (ii). (i) a1x b1y c1z

Answers

The True- False of given statements of Solutions of Equations are justified.

1.13 False. The solution set to a system of three equations in three unknowns can be a point, a line, or a plane. It depends on the system of equations and how they intersect in three-dimensional space.

1.14 False. A system of linear equations can have infinitely many solutions, one solution, or no solutions. It depends on the coefficients of the equations and the rank of the coefficient matrix.

1.15 False. The solution set to a consistent rank 2 linear system in four unknowns would be a plane in four-dimensional space, not a line.

1.16 False. A system of four equations in four unknowns may not have a solution, or it may have infinitely many solutions or one solution. It depends on the coefficients of the equations and the rank of the coefficient matrix.

1.17 False. A system of four equations in four unknowns can have infinitely many solutions or one solution, but it cannot have at most one solution.

1.18 True. The rank of a system is always less than or equal to the number of equations in the system.

1.19 (a) False. If (i) has exactly one solution, it does not necessarily mean that (ii) will have exactly one solution. It depends on the coefficients of the equations in (ii).

(b) False. If the solution set of (i) is a line, it does not necessarily mean that the same is true for (ii). It depends on the coefficients of the equations in (ii).

(c) True. If (i) has no solutions, then the same is true for (ii), since (ii) is equivalent to (i).

To know more about Solutions of Equations:

https://brainly.com/question/29757556

#SPJ4

Martine wants to open an after-school tutoring service for students in 6th through 9th grade. How can a thorough knowledge of customers' expectations improve the probability of her success?

Answers

Answer:

it would help her know how to prepare her teaching to match the students learning and expectations

Step-by-step explanation:

This idea of opening this tutoring service for students in these grades would prove a success if if martine has adequate knowledge of her students/customers. That is the learners requirements, their expectations, their experiences, and their strengths and weaknesses in particular subject areas.

Knowledge of these expectations would help to set Martine on the path of tutoring success and this would attract more students. So for her to have a strong tutoring business she has to know the approaches to use to make students strong academically, and how to match learning ability with her teaching.

Write an equation of the line, in point-slope form, that passes through the two given points. points: (-3.18), (12.-12)​

Answers

Answer:

y=-2x+12

Step-by-step explanation:

Count how much the y raises for each x through division for the slop, and then plug that in to the x on either one of the pairs to get the number, and then add or subtract whatever the actual y is to get the y intercept.

A cinema screen is measured as 6 cm by 15m, to the nearest meter, calculate the upper and lower bounds for the area of the screen.

Answers

Answer:

Step-by-step explanation:

Area of rectangle is : length x width so 6x15 which is 150cm x 6cm which is 900cm^2.

b) Would you consider it unusual to find a college student who never wears a seat belt when riding in a car driven by someone​ else? A. ​Yes, because 0.01less than<​P(never)less than<0.10. B. ​Yes, because ​P(never)less than<0.05. C. ​No, because there were 139139 people in the survey who said they never wear their seat belt. D. ​No, because the probability of an unusual event is 0.

Answers

Answer:

Step-by-step explanation:

Hello!

Full text

In a national survey college students were​ asked, "How often do you  wear a seat belt when riding in a car driven by someone​ else?" The response frequencies appear in the table to the right.​ (a) Construct a probability model for​ seat-belt use by a passenger.​ (b) Would you consider it unusual to find a college student who never wears a seat belt when riding in a car driven by someone​ else?

Response , Frequency  

Never  102

Rarely  319

Sometimes  524

Most of the time  1067

Always  2727

n= 102+319+524+1067+2727= 4739

​(a) Complete the table below.

Response

Probability  To calculate the probability for each response you have to divide the frequency of each category by the total of people surveyed:

Never P(N)= 102/4739= 0.0215

​(Round to the nearest thousandth as​ needed.)

Rarely P(R)= 319/4739= 0.0673

​(Round to the nearest thousandth as​ needed.)

Sometimes P(S)= 524/4739= 0.1106

​(Round to the nearest thousandth as​ needed.)

Most of the time  P(M)= 1067/4739= 0.2252

​(Round to the nearest thousandth as​ needed.)

Always  P(A)= 2727/4739= 0.5754

​(Round to the nearest thousandth as​ needed.)

​(b) Would you consider it unusual to find a college student who never wears a seat belt when riding in a car driven by someone​ else?

A.

​No, because there were 102  people in the survey who said they never wear their seat belt. Incorrect, an event is considered unusual if its probability (relative frequency) is low, you cannot know if it is usual or unusual just by looking at the absolute frequency of it.

B.

​Yes, because ​P(never) < 0.05. Correct

C.

​No, because the probability of an unusual event is 0.    Incorrect, the probability of unusual events is low, impossible events are the ones with probability zero

D.

​Yes, because 0.01 < ​P(never) <  0.10. Incorrect, by the definition an event is considered unusual when its probability is equal or less than 5%.

I hope this helps!

HELP PLEASE! ILL MARK BRAINLIEST!

A rental car company charges $53.75 per day to rent a car and $0.07 for every mile driven. Alexander wants to rent a car, knowing that: He plans to drive 425 miles. He has at most $320 to spend. Write and solve an inequality which can be used to determine dthe number of days Alexander can afford to rent while staying within his budget .

Answers

Answer:

5 days

Step-by-step explanation:

425x0.07=29.75

320-29.75=290.25

290.25÷53.75=5.4

Answer:

Inequality: 53.75d + 29.75 ≤ 320

Answer: d ≤ 5.4

Step-by-step explanation:

Market researchers wanted to know whether the placement of a new product on a supermarket shelf significantly increases the percent of shoppers who will buy the product. At Supermarket X, a new product was placed on the top shelf, and at Supermarket Y, the product was placed one shelf below the top shelf. To observe buying habits, the researchers selected a random sample of 364 shoppers at X and another random sample of 327 shoppers at Y. Of the selected shoppers at X, 15 bought the product, and of the selected shoppers at Y, 19 bought the product. Which of the following is the most appropriate method for analyzing the results?

a. A two-sample z-test for a difference in sample proportions.
b. A two-sample z-test for a difference in population proportions
c. A one-sample z-test for a sample proportion
d. A one-sample z-test for a population proportion
e. A one-sample z-test for a difference in sample proportions

Answers

Answer:

a. A two-sample z-test for a difference in sample proportions

Step-by-step explanation:

We are told that there are two supermarkets in the research named X and Y.

That a random number of shoppers were selected in each supermarket.

Thus means we have two different sample proportion.. Since a different number of people were randomly selected from each supermarket and a different number of people purchased the product.

Thus, we will have 2 sample proportions one for supermarket X and the other for supermarket Y.

In addition, the position of the product was different in both supermarkets.

Thus, we can say that this is a 2 sample Z-test for difference in their sample proportion.

The option that is most appropriate method for analyzing the results is that a two sample z test for a difference in population proportions.

What is a two sample z-test?

A Two-Sample Z-test is known to be a kind of test that is often employed so as to make a comparison of the means of two samples to know and show if it is feasible that they are a product of the same population.

Conclusively, When a two sample z test is employed in the data given above, one can know and show the various difference that can be seen in population proportions.

Learn more about two sample z test  from

https://brainly.com/question/7191266

can anyone help me with question 7 please?

can anyone help me with question 7 please?

Answers

Answer:

c is the answer

Step-by-step explanation:

I hope it may helps you

Need help!!! Wil mary brainlyest!

Need help!!! Wil mary brainlyest!

Answers

Answer:

-17/5/11/10

=-17/5*10/11=-34/11=

3÷1÷11

Hope it helps

Answer:

Easy.  The answer is -3 1/11

Step-by-step explanation:

-17/5/11/10

-170/55

-3 1/11

The ratio of men to women working for a company is 8 to 5. If there are 273 employees total, how many women work for the company?

Answers

Answer:

105 women

Step-by-step explanation:

8 to 5, sooo \/

8x + 5x = 273

13x = 273

x=273/13

x=21

8*21 = 168 men

5*21 = 105 women

(to check we can add 168 and 105 together and make sure we get 273. We do!)

Which graph shows the system of equations:

2x+3y=5
4x−5y=−1

Which graph shows the system of equations:2x+3y=54x5y=1

Answers

Answer:

THE FRIST ONE

!Step-by-step explanation:

If a metallic cylinder having volume 1540 cm^3 is melted to form cylinder having height 10 cm what is radius of cylinder​

Answers

Answer:

radius is 7 cm

Step-by-step explanation:

formular for volume:

V=πr2h

r is radius

h is height

1540=3.14×r2×10r2=49.0r=7cm

Harrison and Sherrie are making decisions about their bank accounts. Harrison wants to deposit $200 as a principle amount, with an interest of 2% compounded quarterly. Sherrie wants to deposit $200 as the principle amount, with an interest of 4% compounded monthly. Explain which method results in more money after 2 years. Show all work. (10 points)

Answers

Answer:

Harrison earns: $208.14

Sherrie earns: $216.57

Step-by-step explanation:

Sherrie earns more money than Harrison in 2 years.

a) You have a piece of string that is 36m long. find the areas of all the shapes you can make which have a perimeter of 36m. b) A piece of land has an area of 100m². How many meters of wire fencing is needed to enclose it?​

Answers

a. The areas of the square is 81m² and for rectangle is 72m²

b. The perimeter of the square is 40m

What are the areas of all the shapes you can make which have a perimeter of 36m?

a. To determine the area of the shapes in which we have that have a perimeter of 36m, we can consider rectangle and square.

For a square;

Perimeter of square = 4L

36 = 4L

L = 9m

The area of the square will be L² = 9² = 81m²

For a rectangle;

The perimeter of rectangle is;

P = 2(L + W)

We can assume that two numbers which will represent the length and width are;

L = 12m, W = 6m or L = 6m, W = 12m

A = 12 * 6 = 72m²

b.

The area of the wire is 100m², the perimeter for this can be calculated when we consider square and rectangle;

Perimeter of square = 4L

Area of square = L² = 100m²

L = 10m

The perimeter of the wire is 4(10) = 40m

Learn more on perimeter and area of rectangle and square here;

https://brainly.com/question/25292087

#SPJ1

Define same side interior

Answers

Answer:

two angles that are on the same side of the transversal and on the interior of (between) the two lines.

Step-by-step explanation:

Please help me with this

Please help me with this

Answers

Step-by-step explanation:

Flip f(x) about the x-axis by multiplying it by -1

  - f(x)

  the squish it skinnier by multiplying it by 4

g(x) = - 4 f(x)   = -4 x^2

(a) Show that if λ is an eigenvalue of A, then λ is an eigenvalue of AT. Show with an example that the eigenvectors of A and AT are not the same.

(b) Show that if λ is an eigenvalue of A, and A is invertible, then λ^-1 is an eigenvalue of A^-1.

Answers

If λ is an eigenvalue of A, then λ is an eigenvalue of AT. Show with an example that the eigenvectors of A and AT are not the same.

What are eigenvalues and eigenvectors?

The equation Av = λv, where v is a non-zero vector, is satisfied by an eigenvector v and an eigenvalue given a square matrix A. In other words, the eigenvector v is multiplied by the matrix A to produce a scalar multiple of v. Due to their role in illuminating the behaviour of linear transformations and differential equation systems, eigenvectors play a crucial role in many branches of mathematics and science. When the eigenvector v is multiplied by A, the eigenvalue indicates how much it is scaled.

The eigenvalue and eigenvector states that, let v be a non-zero eigenvector of A corresponding to the eigenvalue λ.

Then, we have:

Av = λv

Taking transpose on both sides we have:

vTAT=λvT

The above equations thus relates transpose of vector and transpose of A to λ.

Now, consider a matrix:

[1234]

Now, the eigen values of this matrix are λ1 = -0.37 and λ2 = 5.37.

The eigenvectors are:

v1=[0.8246,0.5658]Tv2=[0.4159,0.9094]T

Now, for transpose of A:

AT=[1324]

The eigen vectors are:

u1=[0.7071,0.7071]Tu2=[0.8944,0.4472]T

Hence, we see that, if λ is an eigenvalue of A, then λ is an eigenvalue of AT. Show with an example that the eigenvectors of A and AT are not the same.

Learn more about eigenvalues here:

https://brainly.com/question/29749542

#SPJ1

write 12/root2 + root18 in the form broot2 where b is an interger

Answers

122+18=12+18×22=12+9×42=12+3×22=182=182(2)2=1822=92

The distance between two towns is 120 kilometers there are approximately 8 kilometers in 5 miles which measurement is closest to the number of mules between these two towns

Answers

Answer:

75 Kilometers

Step-by-step explanation:

We have been given that the distance between two towns is 120 km.

We are also told that there are approximately 8 km in 5 miles. Let us find number of miles per km by dividing 5 by 8.

\text{Number of miles in 1 km}=\frac{5\text{ miles}}{\text{8 Km}}

\text{Number of miles in 1 km}=0.625\frac{\text{ miles}}{\text{ Km}}

Therefore, there are 0.625 miles in 1 km.

To convert our given distance into miles we will multiply our given distance by number of miles in 1 km.

\text{Number of miles in 120 km}=120\text{ km}\times \frac{0.625\text{ miles}}{\text{ km}}

\text{Number of miles in 120 km}=120\times 0.625\text{ miles}

\text{Number of miles in 120 km}=75\text{ miles}

Therefore, the distance between two towns is 75 miles.

Answer:

The answer is 75, I had this question a few days ago and I got it right

Answer:75

The population of California was about 37,250,000 in 2013. Which number best approximates the population as a single digit times a power of 10?

Answers

Answer: 4 x 10^7 is the answer

6. What are the values of x and y?


6. What are the values of x and y?

Answers

x=35

try to get all degrees to 360.

the y shared with the 35 is 55
and the final y would be 90

so x= 35 , y= 90 , & y=55

add all of them together to get 360.

Please help me out on this

Please help me out on this

Answers

Answer


2^3/7

Step-by-step

How to calculate your bi-weekly paycheck based on 20 hour weeks at a rate of $9.00 per hour. Also, You will need to deduct Federal Income Tax (11.9%) , State Income Tax (3.6%), F.I.C.A (7.65%), and professional dues. Lastly you will need to look determine whether or not you will be able to pay your monthly car insurance bill of $200.00?

Answers

To calculate your bi-weekly paycheck, follow these steps:

Step 1: Calculate the gross earnings:

Multiply the number of hours worked per week by the hourly rate.

20 hours/week * $9.00/hour = $180.00/week

Step 2: Calculate the total earnings for two weeks:

Multiply the weekly earnings by the number of weeks in a bi-weekly pay period.

$180.00/week * 2 weeks = $360.00

Step 3: Calculate the deductions:

Calculate each deduction separately and subtract them from the gross earnings.

Federal Income Tax: $360.00 * 11.9% = $42.84

State Income Tax: $360.00 * 3.6% = $12.96

F.I.C.A: $360.00 * 7.65% = $27.54

Professional Dues: Amount varies depending on the specific dues.

Total Deductions: $42.84 + $12.96 + $27.54 + Professional Dues

Step 4: Calculate the net earnings:

Subtract the total deductions from the gross earnings.

Net Earnings = Gross Earnings - Total Deductions

Once you have the net earnings, you can determine if it is sufficient to cover your monthly car insurance bill of $200. If your bi-weekly net earnings are greater than or equal to $200, you will be able to pay your car insurance bill.

It is important to note that these calculations are based on the information provided, and actual tax rates and deductions may vary depending on your specific circumstances and location.

Additionally, professional dues may differ depending on your profession. It is recommended to consult with a tax professional or payroll department for precise calculations.

For  more such questions on gross earning.

https://brainly.com/question/29206567

#SPJ8

Preston writes 3 songs in 2 days, working 7 hours each day. He spends the same amount of time on each song. How long does he spend on each song?

Answers

Answer:

Step-by-step explanation:

In 2 days he spends 2*7 = 14 hours total

He divides the number of hours on each song evenly

14 /3 = 4 2/3 hours on each song.

What is 2/3 of an hour?

2/3 * 60 = 120 / 3 = 40 minutes

Total time spent on each song 4 hours and 40 minutes

Answer:

3 songs =2 days working only 7 hour =7×2=14 hour

1 song =14/3hour.=4.6 hour

he spends 4.6 hour on each song

QUESTION 4 PATTERNS, FUNCTIONS AND ALGEBRA 1. Given 6x³-8x³+2+9x7-4x a. How many terms are there in the polynomial? State the degree of the polynomial c. Determine the value of the polynomial if x=-1 b.​

Answers

Answers:

a)  There are 5 termsb)  Degree = 7c)  The value is -1

==========================================

Explanation:

a) Each term is separated by a plus or a minus.b) The degree is equal to the largest exponent. This applies to single variable polynomials only.c) Replace each x with -1. Then use the order of operations PEMDAS to simplify. You should get -1 as the answer. Use a calculator to confirm. It is a coincidence that we have the same input and output. This will not always happen with any general polynomial function.

R
8
7
6
2
-6-5-4-3-2-14
A
S
T
1 2 3 4 5 6 x
H
Question Details
*REQUIRED 15
1. To earn full credit, you must show ALL
of your steps and calculation leading to
your solution. You will be assessed on
your mathematical communication, use
of mathematics and accuracy of your
results.
Find the area of the parallelogram.
View Rubric

R8762-6-5-4-3-2-14AST1 2 3 4 5 6 xHQuestion Details*REQUIRED 151. To earn full credit, you must show

Answers

The required area of the parallelogram is 36√2 square units.

How to find the area of parallelogram?

To find the area of the parallelogram, we can use the formula:

Area = base x height

where the base is one of the sides of the parallelogram, and the height is the perpendicular distance between the base and the opposite side.

First, we need to find the length of one of the sides of the parallelogram. Let's take RS as the base.

RS = √[(2-(-4))² + (6-4)²] = √(6² + 2²) = √40 = 2√10

Next, we need to find the height of the parallelogram corresponding to the base RS. To do this, we need to find the distance between the line RS and the point T.

The equation of the line RS can be found using the slope-intercept form:

y - y1 = m(x - x1)

where (x1, y1) is one of the points on the line, and m is the slope of the line. Let's take R(-4, 4) as the point on the line. The slope of RS can be found as:

m = (6 - 4) / (2 - (-4)) = 1/3

Using point-slope form, the equation of RS is:

y - 4 = 1/3(x - (-4))

Simplifying, we get:

y = x/3 + 16/3

To find the distance between the line RS and point T(6,2), we need to find the perpendicular distance between T and the line RS. We can use the formula for the distance between a point and a line:

distance = |ax1 + by1 + c| / √(a² + b²)

where a, b, and c are the coefficients of the equation of the line in the standard form (Ax + By + C = 0), and (x1, y1) is the point.

Converting the equation of RS to the standard form, we get:

-2x + y - 8 = 0

Using this equation, we can find the distance between T and RS as:

distance = |(-2)(6) + (1)(2) - 8| / √((-2)² + 1²)

= 18/√5

the area of the parallelogram is:

Area = base x height = RS x distance between T and RS = 2√10 x 18/√5 = 36√2 = 36√2 square units.

So the area of the parallelogram is 36√2 square units.

To know more about parallelogram Visit:

brainly.com/question/29147156

#SPJ1

A high-speed elevator can rise 480 feet in 30 seconds. Which expression represents the rate, in FEET PER SECOND, of the elevator?
PER SECOND NOT PER MINUTE PER SECOND!!!

Answers

Answer:

16 feet per second

Step-by-step explanation:

Divide 480 feet by 30 seconds.

6) Lily was going to have a party so she
bought some sweets.She bought some
cookies and brownies. Cookies were $2 and
brownies were $3. She spent $144 for a total
of 60 sweets. How many cookies and
brownies did she buy?

Answers

Let's assume the number of cookies Lily bought is represented by "C," and the number of brownies is represented by "B."

According to the problem, the cost of one cookie is $2, and the cost of one brownie is $3. Lily spent a total of $144.

We can set up two equations based on the given information:

C + B = 60 (equation 1, representing the total number of sweets)

2C + 3B = 144 (equation 2, representing the total cost in dollars)

To solve this system of equations, we can use substitution or elimination method. Here, we'll use the substitution method.

From equation 1, we can rewrite it as C = 60 - B.

Now substitute this value of C in equation 2:

2(60 - B) + 3B = 144

Simplify the equation:

120 - 2B + 3B = 144

Combine like terms:

120 + B = 144

Subtract 120 from both sides:

B = 144 - 120

B = 24

Now substitute the value of B back into equation 1 to find C:

C + 24 = 60

C = 60 - 24

C = 36

Therefore, Lily bought 36 cookies and 24 brownies.

If two numbers are opposites and one number is 32 what is the other number

Answers

Answer:

-32

Step-by-step explanation:

the opposite of a positive number is a negative number

Other Questions
A fair coin is flipped 10 times. What is the probability that exactly 4 of the 10 flips come up heads What is x and the Theorem? Someone please help asap! What is the force of an object with a mass of 30 kg that is free falling? Which of the following criteria have to be met for a species to qualify as invasive? Endemic to the area, spreads rapidly, and displaces foreign species Introduced to a new area, spreads rapidly, and displaces other invasive species Introduced to a new area, spreads rapidly, and displaces native species Endemic to the area, spreads slowly, and displaces native species Civil engineering consulting firms that provide services to outlying communities are vulnerable to a number of factors that affect the financial condition of the communities, such as bond issues, real estate developments, etc. A small consulting firm entered into a fixed-price contract with a spec home builder, resulting in a stable income of $325,000 per year in years 1 through 5. At the end of that time, a mild recession slowed the development, so the parties signed another contract for $155,000 per year for 4 more years. Determine the present worth of the two contracts at an interest rate of 9% per year. before surgery a doctor makes a patient sign a contract with an exculpatory clause. will it be enforceable if the doctor is negligent? The charge of ISD from Biratnagar to Tokyo is Rs 125 for the first 3 minutes and Rs 15 for every additional 10 seconds. If a man made a call from Biratnagar to his friend in Tokyo and paid Rs 305, how long did he make a call What is the measure of angle x? Enter your answer in the box. x= Let sin A =4/5 with A in the second quadrant and sin B -12/13 with B in the third quadrant. Then cos (A+B) = In the painting Landscape with the Fall of Icarus by Pieter Bruegel the Elder, the artist intended to divert our attention so that we barely notice Icarus plunging to his doom; a fine example of ________. A sculptor is planning to make two triangular prisms out of steel. The sculptor will use for the bases of one prism and for the bases of the other prism. (a)Is triangle 1 similar to triangle 2?(b)Suppose the sculptor makes both prisms with the same height. Which prism will have a greater volume? How many times greater? Show your work. what types of bedrock fossils are found in sedimentary rocks? A scientist studies a model of a carbon dioxide moleculelike the one shown in the picture.Carbon dioxideCO2CWhat are two benefits of using this model?A. It explains why the parts of the molecule are bonded together.B. It represents an object too small to be observed directly.C. It shows how the molecule would react in certain conditions.D. It shows how parts of the molecule are arranged in relation to oneanother. Please see image attached. I was told by the instructor the answer is B but I dont understand why? each daugher cell inherits a daughter strand and original template strand from parent, so shouldnt the answer be A? Why do the strands split up to each daughter cell?Although DNA polymerases replicate DNA with extremely high fidelity, these enzymes do make mistakes at a rate of about 1 per every 100,000 nucleotides. Given that each human cell contains 23 pairs of DNA molecules with a collective 3 billion base pairs, it would amount to about 60,000 mistakes every time a cell replicates its DNA! Fortunately, there are extremely sophisticated mechanisms that fix most, but not all, of those mistakes. Suppose a cell (let's call it cell X ) in the regenerating liver of a patient is replicating its DNA molecules for mitosis, and suppose an " A " to " C " mismatch (see the sequences below) is present in one of the newly synthesized chromosome DNA because somehow this mismatch has escaped detection by repair mechanisms. Original template strand: 5'GGTTCAGTACGATTGCAAGGCCTTAAGGT3Newly synthesized strand: 3'-CCAAGTCATGCTAACGCTCCGGAATTCCAA- 5Which one of the following statements is most likely correct? A. After mitosis of the cell X, both daughter cells possess a permanent mutation. B. After mitosis of the cell X, one daughter cell possesses a permanent mutation. C. After mitosis of the cell X, one daughter cell will possess the AC mismatch, which will give rise to a permanent single base mutation after the DNA is replicated once. D. After mitosis of the cell X, both daughter cells possess the AC mismatch, which will give rise to a permanent single base mutation to be inherited by all of their daughter cells. HELPPPPOPPPOPPPP Which of the following is a sign of illness in a dog? If the radius circle is 2 inches the diameter is what explain how you determined is the diameter 4. Solid lead has a density of 11.34 g/cm. Molten (liquid) lead has a density of 10.66 g/cm. If youmelted a 510 g piece of lead, how much more volume will it take up? PromptUsing what you have learned, write one to two paragraphs comparing and contrasting the rise of the nation-state in Germanyand Japan. Be sure to include details that show similarities and differences between the two. Discuss the impact ofnationalism on the creation of the nation-state in each region. What is a theme of "Sea Rose"?isolationbeautyinstabilitymystery