Fast predators migrated to a rabbit inhabited area.

There is a mix of slow, medium, and fast rabbits.

Which of the following will be observed in the area years later?

Answers

Answer 1

Among the rabbits' predators are foxes, cats, dogs, birds of prey, and stoats. The typical top speed for rabbits is 30 mph. Due to their zigzag running pattern, certain hares may even reach high speeds of 45 mph.

What kind of defences do rabbits have against scavengers?

How do rabbits defend themselves against scavengers. The ability to run and hide is a rabbit's main line of protection. Rabbits may use their powerful hind legs, claws, and teeth to try to fend off predators or defend themselves when they are trapped.

The fastest type of rabbit is the jackrabbit, which has a top speed of 45 mph.

To know more about predators visit:

brainly.com/question/28060069

#SPJ1


Related Questions

How would you explain the key concepts for the CWA in less than two minutes?

Answers

Answer:

Explanation:

vPoint Source - a source of water discharged to surface water through a discrete point - generally through a pipe, ditch, or channel.

Nonpoint Source - Nonpoint sources, such as parking lots or athletic fields, discharge runoff water to groundwater or surface water; runoff does not come from  a pipe, ditch, or channel. These sources may contain pollutants such as pesticides, motor oil, and soaps.

Navigable Waters of the United States  For the purposes of the Clean Water Act, the term "navigable waters" includes:

all waters used in commerce, including groundwater;

all interstate waters including wetlands, mudflats, and sand-flats; and

all other waters such as lakes, rivers, streams, wetlands and sloughs.

EPA policy states, "The majority of facilities in the U.S. have the potential to discharge to navigable waters."  The Supreme Court decision in (2006) requires the Army Corps of Engineers and the EPA to determine whether there is a "significant nexus" between a navigable waterway and an area a spill might affect.  In June of 2007, EPA and the Army Corps of Engineers released provisional interpretive guidance regarding the "significant nexus” question. According to this guidance, the agencies will assert jurisdiction over traditional navigable waters, wetlands adjacent thereto, and relatively permanent tributaries thereof. The agencies will generally not assert jurisdiction over swales and ditches that lack routine water flow. Finally, the agencies will apply the "significant nexus" requirement and make a case-by-case, fact-specific analysis on impermanent tributaries and other wetlands.

Additional executive orders were issued 2015 in 2019.  Under the 2019 proposal, traditional navigable waters, tributaries to those waters, certain ditches, certain lakes and ponds, impoundments of jurisdictional waters, and wetlands adjacent to jurisdictional waters would be federally regulated. It also details what are not "waters of the United States," such as features that only contain water during or in response to rainfall (e.g., ephemeral features); groundwater; many ditches, including most roadside or farm ditches; prior converted cropland; stormwater control features; and waste treatment systems.

Could the requirement for one or more NPDES Discharge Permit apply to my campus?

If your campus discharges pollutants directly to navigable waters of the United States through a point source, you must obtain an NPDES permit or redirect the flow of the waste.

Stormwater releases from certain activities require an NPDES permit. The most common activities on college campuses requiring NPDES permits for stormwater are construction activities disturbing more than 1 acre, hazardous waste storage areas operating under the Resource Conservation and Recovery Act permit system, steam-generating power plants, and airports. See Stormwater section below.

Regulations issued by local water authorities, or Publicly Owned Treatment Works (POTWs), not NPDES permits, govern discharges into sanitary sewer systems. See Sewer Use (POTW) section below for more information about requirements for using POTWs for commercial or industrial waste disposal.

What do I have to do related to NPDES Discharge Permits?

Determine where wastewater flows from buildings and processes on your campus. Any industrial or commercial operation (e.g., ice rink melt pits, floor drains, and vehicle wash stations) that discharge into a water of the United States may require an NPDES permit. If required, you must obtain such a permit from the appropriate regulatory agency, probably your state environmental agency.

French drains, dry wells, and septic system leach fields are different from point source discharges because they do not immediately affect surface water. Some state and federal environmental agencies manage these systems under the Underground Injection Control program, part of the Safe Drinking Water Act. See Safe Drinking Water Act for more information.

Details of NPDES

How does the Ferris wheel move?

a. by bouncing

b. by spinning

c. by pushing

d. by rolling​

Answers

The Ferris wheel spins upwards with the help of gears and motors, while gravity pulls the wheel back down again

d. by rolling ( ✔ )

Compare the animal groups by placing the correct number(s) in the spaces provided 1.Sponges 2.Cnidarians

Answers

To compare the animal groups, Sponges and Cnidarians, let's consider some key characteristics of each group:

Sponges:

Sponges are multicellular organisms that belong to the phylum Porifera. They are simple animals that lack true tissues and organs.

Cnidarians:

Cnidarians belong to the phylum Cnidaria and include animals like jellyfish, corals, and sea anemones. They exhibit more complexity compared to sponges and have distinct tissue layers.

To compare the animal groups, Sponges and Cnidarians, let's consider some key characteristics of each group:

Sponges:

Sponges are multicellular organisms that belong to the phylum Porifera. They are simple animals that lack true tissues and organs. Some key characteristics of sponges include:

They have a porous body structure with numerous pores and channels.

They are filter feeders, extracting food particles from water that passes through their bodies.

Sponges exhibit a wide range of shapes, sizes, and colors.

They reproduce both sexually and asexually.

Cnidarians:

Cnidarians belong to the phylum Cnidaria and include animals like jellyfish, corals, and sea anemones. They exhibit more complexity compared to sponges and have distinct tissue layers. Some key characteristics of cnidarians include:

They have a sac-like body plan with a central digestive cavity called a gastrovascular cavity.

Cnidarians possess specialized cells called cnidocytes that contain stinging structures called nematocysts, which they use for defense and capturing prey.

They exhibit radial symmetry.

Cnidarians can reproduce both sexually and asexually.

In comparing the two groups, sponges and cnidarians, we can note the following:

Sponges are simpler in structure and lack true tissues, while cnidarians have distinct tissue layers.

Cnidarians have specialized stinging cells (cnidocytes) for capturing prey, while sponges do not possess such cells.

Cnidarians exhibit radial symmetry, whereas sponges do not have a specific symmetry pattern.

Both groups can reproduce sexually and asexually, but their reproductive strategies may differ.

Overall, sponges and cnidarians represent different levels of complexity and organization within the animal kingdom, with cnidarians exhibiting more specialized structures and behaviors compared to sponges.

For more such information on: animal groups

https://brainly.com/question/2194000

#SPJ11

A student placed a prepared slide on the stage of a light microscope. Describe how to adjust the microscope to view the slide at a magnification of x400.​

Answers

Here are the steps for viewing a slide at 400X magnification: In a compound and light microscope, prepare a slide and keep it near the objective lens at all times. Put a 10X magnification ocular lens in the area of the microscope.

How does 400x magnification work?

You can see a very detailed image of the specimen on your slide thanks to the 400x total magnification that a high-power optical system and a 10x eyepiece provide.

Which focus knob at 40x 400x is simpler to use?

The coarse focus knob or fine focus knob, respectively, will be the ones that are simpler to use at 40X and 400X. At low magnifications, like 40X, the coarser focus knob is simpler to operate because it makes it easy to focus the specimen more quickly.

To know more about microscope visit:

https://brainly.com/question/18661784

#SPJ1

Multiple Choice
Constructive error is the judgment that disconfirming results of an investigation should be published to further the scientific literature
on that topic.
O True
O False

Answers

Answer:

true

Explanation:

it a must to published topic so dat people can help you

A German company specializes in building laboratory rooms for handling dangerous viruses and bacteria. Each room is designed to have a completely separate life support system that allows the users to examine and identify the viruses and bacteria without contaminating any other area. What type of a layout would be used to construct such a room? Group of answer choices

Answers

Answer:

The type of layout that would be used to construct such rooms is:

fixed-position layout.

Explanation:

With this type of layout, the life support systems for each room will not be moved from one room to the next.  Each room will have its own specialized equipment and systems so that only the workers and some test materials will be moving into and out of the separate rooms.  There are other types of layout, including hybrid, process, and product layouts.  Fixed-position layouts are more appropriate for systems and equipment that are too large or too heavy to move or require separate use to reduce contamination.

Which of the following claims is supported by the data observed in the graph?

I. Meat production is more efficient than agricultural crops per square meter.
II. More protein is produced per square meter by lamb and mutton than pig and poultry.
III. Agricultural crops are more efficient than meat production per square meter.

A) I only
B) II only
C) I and III only
D) II and III only

Which of the following claims is supported by the data observed in the graph?I. Meat production is more

Answers

The claim that is supported by the data observed in the graph is Agricultural crops are more efficient than meat production per square meter.

Why are agricultural crops more efficient than meat production per square meter?

Agricultural crops are generally more efficient than meat production per square meter for several reasons.

These reasons include:

Energy efficiency: Crops require less energy to produce compared to meat. This is because growing crops requires less energy input, such as feed, water, and other resources, compared to raising animals for meat production.Land use efficiency: Growing crops is more land-efficient than raising animals for meat. Crops can be grown more densely and can yield more food per unit of land than livestock can. This is because animals require more space to move around, graze, and obtain their food.Water use efficiency: Crops require less water to produce than meat. Water is required for both crops and livestock, but it takes significantly more water to produce a unit of meat than a unit of crops. This is because animals require water for their own needs as well as to produce the feed that they eat.Environmental impact: Meat production has a higher environmental impact compared to crop production. Livestock produce methane, a potent greenhouse gas, as well as other pollutants. Raising animals also requires more land, water, and other resources, which can lead to deforestation, water depletion, and other environmental issues.

Overall, agricultural crops are more efficient than meat production per square meter due to lower energy input, higher land use efficiency, lower water use, and a lower environmental impact.

Learn more about land use efficiency at: https://brainly.com/question/4514861

#SPj1

where does natural selection happen ?

Answers

Answer:Natural selection occurs in nature obviously. There are quite a few reasons natural selection happens. One of the reasons natural selection occurs is because sometimes more offspring are born but not all of them survive.

Explanation:

The person above is correct

A father with type O blood marries a woman with type B blood who has a type O mother. What is the probability that the offspring of this husband and wife will be O? B? A? AB?

Answers

Answer:

Probably OB or ob or Ob or oB

Explanation:

Answer:

It’s highly unlikely that the offspring wi8kl be A or AB because there’s nothing to factor that in as a probabilit. The kid is more likely to be OB or B, with a slightly lower but still probable chance of having O.

Explanation:

Which organisms occupy two different places within the same food chain? (Select all that apply.) Venus flytrap remora pitcher plant thermophiles

Answers

Answer

I think its remora I'm not sure I hope it's right

Explanation:

Identify the cranial nerves associated with gastrointestinal tract motor output

Answers

The vagus nerve is the cranial nerves associated with gastrointestinal tract motor output.

Stimulation of the vagus excites postganglionic parasympathetic neurons withinside the stomach, which then launch acetylcholine onto parietal cells to stimulate acid secretion. Cephalic efferents withinside the vagus nerve launch gastrin-liberating peptide (GRP) onto G-cells withinside the pyloric glands and those launch gastrin.

The vagus nerve, additionally called the vagal nerves, are the primary nerves of your parasympathetic fearful device. This device controls particular frame features along with your digestion, coronary heart price and immune device. These features are involuntary, that means you can not consciously manage themThe vagus nerve enervates the gut (gastrointestinal tract), coronary heart and larynx.

Read more about gastrointestinal:

https://brainly.com/question/1386870

#SPJ4


true or False on the line before each statement.
1. Commercial advertisers, the media, government, and public officials
all use propaganda.

Answers

what's up? this is true. best of luck with your studies

Translate the DNA, mRNA, amino acid shown in picture (DNA sample)

DNA:
mRNA:
amino acid:

TACGCCTTTACT TACTCGTCAATT TACCCGACGACCACT TACTACTAGATC TACCACCACACT TACTCATCGATC TACTGGTAAGTAACT TACTTTCAGGGTACT

Translate the DNA, mRNA, amino acid shown in picture (DNA sample)DNA: mRNA: amino acid:TACGCCTTTACT TACTCGTCAATT

Answers

DNA: DNA stands for Deoxyribonucleic Acid, which is a molecule that contains the genetic instructions for the development, functioning, and reproduction of all living organisms.

It is a long, double-stranded molecule made up of four types of nucleotides: adenine (A), thymine (T), guanine (G), and cytosine (C).

TACGCCTTTACTTACTCGTCAATTTACCCGACGACCACTTACTACTAGATCTACCACCACACTTACTCATCGATCTACTGGTAAGTAACTTACTTTCAGGGTACT

mRNA:

mRNA stands for Messenger Ribonucleic Acid, which is a type of RNA molecule that carries the genetic information from DNA to the ribosomes, where it serves as a template for protein synthesis.

mRNA is synthesized through a process called transcription.

AUGCGGAAAUGAAUGAGCAGUAAAUUGGGCUGUGCUGGUGAAUGAUGGUGGUGUGAUGAGUAGUAGGUGGUAGAUGAUGACCAUUCACCCAUUGAGUCA

Amino acid:

Amino acids are the building blocks of proteins. They are organic compounds made up of an amino group (-NH2), a carboxyl group (-COOH), and a side chain that is specific to each amino acid. There are 20 different amino acids that are commonly found in proteins, each with a different side chain that gives it unique properties.

Met-Arg-Lys-Asp-Arg-Gln-Stop-Leu-Gly-Leu-Cys-Trp-Val-Asn-Asp-Val-Val-Val-Asp-Ser-Val-Gly-Asp-Met-Leu-Pro-Leu-Glu-Ser

To know more about amino acid, visit :

https://brainly.com/question/14583479

#SPJ1

Water is essential for all living processes, and most land animals need a supply of fresh water to survive. Group of answer choicesTrueFalse

Answers

Water is essential for all living processes, and most land animals need a supply of fresh water to survive. Without water, existence of life will be impossible. All organisms use water for their existence. It is used as drinking water. It is also an aid in respiration process.

Answer -True

This is a gastropod fossil from Triassic period. This type of fossil can be on the east boundary of the state of Missouri. It looks a lot like ______ we find on Earth today.

A) ferns
B) fish
C) snails
D) starfish​

This is a gastropod fossil from Triassic period. This type of fossil can be on the east boundary of the

Answers

Answer:

C . snails

Explanation:

This shell looks like a snail shell

Fat located just below the surface of the skin (subcutaneous fat) insulates the body and keeps it warm. This is because fat's ______ water content does not conduct heat well.Multiple choice question.highlow

Answers

Fat located just below the surface of the skin (subcutaneous fat) insulates the body and keeps it warm. This is because fat's low water content does not conduct heat well.

The body's most abundant fat is found immediately below the skin. According to Fried, this sort of fat behaves differently depending on its location. More fatty acids are produced by subcutaneous belly fat, which may lead to greater insulin sensitivity and an increased risk of metabolic illness. The lower body's subcutaneous fat, on the other hand, is effective at absorbing and storing fat. It is regarded as disease-preventive.

Normal subcutaneous fat is risk-free and may perhaps offer some disease protection. The fat that envelops the internal organs is called visceral fat. Although it cannot be seen from the outside, it is linked to many illnesses. Both visceral fat and subcutaneous fat can be lost.

To know more about subcutaneous fat click here:

https://brainly.com/question/30341350

#SPJ4

NAMING BRAINLIEST!! Choose all the answers that apply.

Energy in an ecosystem:


is part of an open system
is recycled and reused
flows only one way
is transferred through the food chain
is eventually lost as heat

Answers

Answer:

Energy in an ecosystem: is part of an open system, is recycled and reused, is transferred through the food chain and is lost as heat.

A lichen is an organism that structurally appears to be a single organism. But a lichen is actually two different organisms—a fungus and green algae—living together as one organism. The fungal partner derives its nutrition from the photosynthesizing algae. How does a lichen differ in its photosynthetic activity from Elysia chlorotica, the sea slug that’s considered to be a photosynthesizing animal?

Answers

The way that  lichen differ in its photosynthetic activity from Elysia chlorotica, the sea slug that’s considered to be a photosynthesizing animal is option C. Lichens can photosynthesize only because of the living algal partner, while Elysia chlorotica incorporates chloroplasts from algae into its cells.

What is the lichen about?

In a lichen, the algal partner is responsible for photosynthesis, and the fungal partner provides protection and structure for the algal cells. The relationship between the two organisms is permanent and essential for the survival of the lichen.

On the other hand, Elysia chlorotica, a sea slug is considered to be a photosynthesizing animal. It incorporates chloroplasts from the algae it feeds on and retain them, which allows it to carry out photosynthesis on its own. This mechanism is not a permanent association and the slug can photosynthesize only when it has the chloroplasts.

Learn more about lichen from

https://brainly.com/question/21042163

#SPJ1

See full question below

A lichen is an organism that structurally appears to be a single organism. But a lichen is actually two different organisms—a fungus and green algae—living together as one organism. The fungal partner derives its nutrition from the photosynthesizing algae. How does a lichen differ in its photosynthetic activity from Elysia chlorotica, the sea slug that’s considered to be a photosynthesizing animal?

A.

In lichens, the fungi photosynthesize on their own, while Elysia chlorotica forms a relationship with a photosynthesizing plant.

B.

In lichens, the relationship with the algae lasts throughout the life cycle, but in Elysia chlorotica, the relationship occurs only during the immature juvenile stage of the slug’s life cycle.

C.

Lichens can photosynthesize only because of the living algal partner, while Elysia chlorotica incorporates chloroplasts from algae into its cells.

D.

In lichens, the association between the fungi and algae is permanent, while Elysia chlorotica associates with a photosynthesizing organism only when it requires food.

2. Mammary glands are shared characteristic among mammals and the oldest common ancestor of mammals. This is an example of a
O A. cladogram.
O B. synapomorphy.
O c. taxonomy.
O D. phylogeny.

Answers

Answer: B

Explanation:

Your answer is B and synapomorphy

11. A person who has rickets might need
more foods from which two groups?

Answers

A person who has rickets might need more foods from the milk and green leafy vegetables groups. Rickets is a disease that is caused by a lack of vitamin D. Vitamin D is essential for the absorption of calcium and phosphorus, which are needed for the formation of strong bones. Milk and green leafy vegetables are good sources of vitamin D. Other foods that are good sources of vitamin D include fatty fish, egg yolks, and fortified foods.

In addition to getting enough vitamin D, people with rickets may also need to take calcium and phosphorus supplements. These supplements can help to improve bone health and prevent further bone loss.

Here are some specific foods that people with rickets may want to include in their diet:

Milk
Yogurt
Cheese
Salmon
Tuna
Sardines
Eggs
Fortified orange juice
Fortified cereal
Tofu
Green leafy vegetables
Fortified bread
Fortified pasta
It is important to talk to a doctor or registered dietitian about the best way to manage rickets. They can help to create a personalized diet and supplement plan that will meet the individual's needs.

Which of the following identifies the field of study that involves all the elements of plant structure and
metabolism that allow plants to sustain life and reproduce?
O plant systems
O photosynthesis
O agronomy
O plant evolution

Answers

The field of study that involves all the elements of plant structure and metabolism that allow plants to sustain life and reproduce is "plant systems".

What are plant systems

Plant systems is the scientific field that studies the internal and external structures of plants, their physiological processes, and their interactions with the environment. It involves the study of plant anatomy, plant physiology, plant ecology, and plant development.

Plant anatomy deals with the structure and organization of plant tissues, organs, and cells, while plant physiology studies the functions and processes that occur within the plant, such as photosynthesis, respiration, and nutrient uptake.

Plant ecology examines the relationships between plants and their environment, including interactions with other organisms, while plant development focuses on the growth and differentiation of plant cells, tissues, and organs throughout their life cycle.

Learn more about metabolism at

https://brainly.com/question/1490181

#SPJ1

A. Plant systems

What is the field of study plant systems ?

The field of study that involves all the elements of plant structure and metabolism that allow plants to sustain life and reproduce is commonly known as plant systems.

Plant systems include :

The study of plant anatomy PhysiologyBiochemistry Genetics EcologyEvolution

Therefore, The study of plant systems aims to understand how plants function at the molecular, cellular and organismal levels and how they interact with their environment. This knowledge is important for improving crop yields developing new plant-based products, and addressing global challenges such as food security and climate change.

Learn more about plant systems here : brainly.com/question/30228388

#SPJ1

Which two Kingdoms are nearly the same, except for where they can survive?
A. Plantae and Fungi
B. Protista and Plantae
C. Eubacteria and Archaebacteria
D. Protista and Archaebacteria

Answers

Eubacteria and Archaebacteria are the two Kingdoms are nearly the same. The correct option is C.

What are eubacteria?

Eubacteria are prokaryotic microbes that consist of a single cell that lacks a nucleus and contains DNA in the form of a single circular chromosome.

Eubacteria are gram-negative or gram-positive bacteria with economic, agricultural, and medical significance. E. coli, Lactobacilli, and Azospirillum are among them.

Archaebacteria are referred to as ancient bacteria, whilst the eubacteria are referred to as true bacteria.

Archaebacteria, unlike eubacteria, can survive in harsh environments.

The resemblances are that archaea and eubacteria are both prokaryotes, which are single-celled organisms without a nucleus or organelles.

Thus, the correct option is C.

For more details regarding archaebacteria, visit:

https://brainly.com/question/2598723

#SPJ1

what is thymine and its purpose

Answers

Answer:

Thymine, which is often abbreviated to T or Thy, can also be referred to as 5-methyluracil. It is one of the pyrimidine bases found in the nucleic acid of DNA, along with adenine, guanine and cytosine (A, G and C). These bases are the building blocks of DNA and life form on earth.

Explanation:

can someone help me on my most recent question, its math and its multiple choice

Answer:

Explanation:

It is one of the pyrimidine bases found in the nucleic acid of DNA, along with adenine, guanine and cytosine (A, G and C). These bases are the building blocks of DNA and life form on earth.

To see if baldness in men is caused by a high protein diet, a scientific researcher provides one group of 50 men a diet which includes the normal AMDR range for protein (10-35%). The researchers provide a second group of 50 men with a high protein diet, containing above 50% protein. What is the variable for which this experiment’s results will be based upon?

a.
Whether or not the men develop baldness

b.
The amount of protein in the men’s diets

c.
The age of the men and amount of water they are given to drink

d.
The number of men in each group

Answers

The variable for which this experiment's results will be based upon is:

a. Whether or not the men develop baldness

The researcher is investigating if a high protein diet is a potential cause of baldness in men. Therefore, the variable of interest is whether or not the men develop baldness, and the study is comparing two groups of men with different levels of protein in their diets to see if there is a significant difference in baldness rates.

While other factors such as age, water intake, and the number of men in each group may also be controlled or monitored during the study, they are not the main variable of interest for this particular experiment.

Filaments connected to the dense plaque underlying the membrane in a hemidesmosome course outward into the cytoplasm. These filaments are composed of the protein and are best known as A) actin, microfilaments B) keratin, microfilaments C) actin, intermediate filaments D) keratin, intermediate filaments​

Answers

The answer is c) keratin, intermediate filaments.

What are keratin intermediate filaments?In epithelia, keratin intermediate filaments are widely distributed and organize into cytoskeletal networks that support cell type-specific processes like adhesion, migration, and metabolism. These functionalities are maintained via a continuous cycle of keratin filament turnover.The cytoskeleton's main structural element, the intermediate filaments, are made up of a few smaller subgroups as well as the five major subgroups vimentin, keratins, desmin, neurofilaments, and glial fibrillary acidic protein (GFAP) (e.g., nestin, peripherin).A protein called keratin aids in the formation of your skin's outer layer, hair, and nails (epidermis). Your skin is supported, wounds are treated, and your hair and nails are kept in good condition.In contrast to actin filaments and microtubules, intermediate filaments are extremely stable structures that make up the real skeleton of the cell. They provide the cell its elastic qualities and its capacity to tolerate tension. They also anchor and place the nucleus within the cell.

Hemidesmosomes are found in the basal membrane of the epithelial cells, which helps to attach to the basal lamina. hemidesmosomes contain integrin proteins it is attached to laminin protein in the basal lamina and in the cytoplasmic side it is attached to intermediate filaments made of keratin.

These filaments are composed of the protein and are best known as actin, intermediate filaments.

Therefore, the answer is c) keratin, intermediate filaments.

To learn more about intermediate filaments, refer to:

https://brainly.com/question/11732936

#SPJ9

Researchers have been studying different types of grasses and have learned that certain species will benefit from being grazed by other organisms. What type of relationship would this behavior represent?

Answers

The behavior you described, where certain species of grass benefit from being grazed by other organisms, represents a mutualistic relationship. Mutualism is a type of symbiotic relationship in which both participating organisms derive benefits from their interaction.

In this case, the grasses benefit from being grazed because the act of grazing stimulates their growth and helps them maintain optimal health. Grazing removes the top portions of the grass, which promotes new shoots and stimulates lateral growth.

Additionally, grazing can prevent excessive shading and allow sunlight to reach lower parts of the grass, aiding in photosynthesis.

On the other hand, the organisms that graze on the grass, such as herbivores or grazers like cattle or certain insects, benefit from the food source provided by the grass. Grazing animals obtain nutrition from consuming the grass, which is a source of energy and nutrients.

Thus, the mutualistic relationship between the grasses and the organisms that graze on them is characterized by reciprocal benefits. The grasses benefit from the stimulation of growth and maintenance, while the grazers benefit from the food resource.

For more such questions on organisms

https://brainly.com/question/17259533

#SPJ8

Breeders can use a Punnett square to predict the outcome of a genetic cross. If the genotype of both parents was Aa, what would be expected of the genotypes among their possible offspring?

Answers

Answer:

AA, Aa, Aa, and aa

Explanation:

If you do the punnet square to solve this, you will see these results!

Answer:B on edge 2020

Explanation:half would have the genotype Aa

If you ended up with 30 blue, 25, black, 25 brown, 6 yellow, and 4 orange invertebrates, what does this tell you about the type of predator?

Answers

The distribution of invertebrates among different colors suggests that the type of predator targeting them might have color preference or selectivity.

The fact that there are significantly more blue invertebrates (30) compared to black (25), brown (25), yellow (6), and orange (4) indicates that the predator might have a preference for blue-colored prey. This preference is evidenced by the higher number of blue invertebrates captured compared to other colors.

Additionally, the predator seems to show a relatively equal preference for black and brown invertebrates since their numbers are the same. However, it is important to note that the sample size of the invertebrates may affect the observed distribution, and further investigation would be required to draw definitive conclusions.

Understanding the predator's color preference can provide insights into its visual perception and hunting strategies. It could indicate that the predator has developed adaptations to target specific color morphs or that certain colors are more conspicuous or attractive to the predator's visual system.
For more questions on invertebrates
https://brainly.com/question/3481345
#SPJ11

Why do sex-linked traits follow different patterns of inheratance than other traits

Answers

Answer:

Males and females have different sex chromosomes.

Explanation:

Sex Linked trait is controlled by the chromosomes while other traits are controlled by autosomes. The autosomal cells and traits have a constant characteristics in a human being. The chromosomal cells however vary. The male chromosome XY is different from the female chromosome XX.

This is the reason why sex-linked traits follow different patterns of inheratance than other traits as a result of the Males and females having different sex chromosomes is valid.

Prepare for this short essay.

Find a tape that measures in cm. If yours only measures in inches, convert inches to cm's. Measure your height and type it below; now measure the length of your arms stretched out from fingertip to fingertip and type it below, now divide the two numbers and type the answer below. The closer the answer is to 1, the more "square" you are. If it is not 1, you are a rectangle. Professional basketball players are often rectangles because their arms are so long!

Answers

Answer:

1.01 cm

Explanation:

Height - 170 cm

Arm length - 172 cm

Other Questions
What where the two problems Microsoft faced? How was it solved? Someone can help me with the question 3, please Which of the following is the correct definition for memoir?series of 4 radio buttons (A) A poem that tells a story(B) A narrative composed from personal experiences(C) A book that an author writes about the life of another real person(D) An incident in a fictional narrative that happened before the story began Complete the sentences with words from the box. Look at A and B opposite to help you. commission bonus currency earn mortgage taxovertime pension rent salary social security 1. After I lost my job, I was living on ___ for three months. This was difficult, because the amount was much lower than the ___ I had before.2. I used to work as a salesperson, but I wasn't very successful, so I didn't ___ much ___ 3. If the company makes 10% more than last year, we'll all get a ___ at the end of the year. 4 It'll take me at least 25 years to repay the ___ on my house. 5. Many European countries now have the same ___, the euro6. My wages aren't very good, so I do a lot of ___ 7. Nearly 40% of everything I earn goes to the government as ___8. The owner has just increased the ___ on our flat by 15%.9. When I retire, my ___ will be 60% of my final salary. 1.2 Are the following statements true or false? Find reasons for your answers in A and B opposite. 1 Bank deposits are not classified as money. 2 People earning wages get paid more often than people earning a salary. 3 People working on commission always get paid the same amount. 4 When you stop working at the end of your career, you receive a pension. 5 Most people pay a rent and a mortgage. What is the direction of the total force exerted by these two charges on a negative point charge q3q3q_3 = -6.03 ncnc that is placed at the origin? For mental health professionals it is critical to discuss the symptoms of verity mental health disorder the primary symptoms of bipolar disorder are Please help thank you Why were the British and French fighting? Outcome? What are 3 benefits of stocks? Two students, Student A and Student B, claim to know the correct representation of theexpression - (3t).9 Student A represents the expression as the product of 9 and y timesthe product of 3 and t. Student B represents the expression as the quotient of 9 and y timesthe sum of 3 and t.Both students' claims are incorrect. What makes each representation incorrect?Explain your answer. 3 x 1, 250 expanded form If a storm is 7. 5 kilometers away, how much time is expected between observations of lightning and thunder? Round your answer to one decimal place. Seconds. Which passage below bestreveals the cultural setting of"A Piece of String"?A. "Yes, you yourself."B. The old man remembered, understoodand flushed with anger.C. giving forth that unpleasant odor, humanand animal, peculiar to the people of thefield In the triangle MSA, MS = 17 and MA = 8. What is the value of angle S, to the nearest degree? Select the correct answer from each drop-down menu.Read the sentence from paragraph 2.At the heart of the mitigation project are two goals: to create more habitat connectivity for diverse species of wildlife and to keep animals from becoming roadkill.How does the author use the phrase "at the heart of" to clarify ideas in the passage?The phrase "at the heart of" means The author uses this phrase to clarify Please help me ASAP greatly appreciated! PLSSS HELP! can someone answer these two questions from my math homework!1. 7(18-6)+12(4-1)2. 26+8(1266)-8 the portuguese viewed the atlantic ocean islands as the perfect location for the cultivation of____ In 2011 members of a movement calling themselves "occupy wall street" relied heavily on social media websites to coordinate their protests. they protested what they saw as corporations having too much control of government, contributing to economic problems. is this type of political and civic participation important in us society? explain your response and give at least two additional examples of how a person can participate in a democratic society the two types of biofuel introduced in class. the one that is most important in the united states. the two countries that produce the most biofuel globally.