Answer:
The correct answer is - there are huge diversity and different type of organism on earth.
Explanation:
On the earth, the world of biology which deals with the living organism is very much rich. There is various kind of organisms with different shapes and sizes. Some are microscopic single-cell and some are huge multicellular animals.
It is found that there are 15 million species present on earth and only two million are known to science. There is almost 80 percent of organisms still need to be discovered and understood. Different types of life on earth yet to be discovered.
Describe how C. parvum obtains the glucose it needs for glycolysis after it has infected another cell. Explain the role of lactate dehydrogenase in enabling C. parvum to continue producing ATP by glycolysis.
Answer:
Cryptosporidium parvum is an apicomplexan pathogen that obtains glucose either directly from its host or by the degradation of polysaccharides.
Explanation:
C. parvum only can produce ATP by glycolysis. Lactate dehydrogenase (LDH) is a universal enzyme required to synthesize pyruvate, which is the final product of the glycolysis process. This enzyme has been subject of research to understand the metabolism and evolution of apicomplexan parasites, including C. parvum.
Cryptosporidium parvum is a pathogenic agent that causes the disease cryptosporidiosis. The pathogen obtains glucose directly from the host. It can also obtain by the breakdown of polysaccharides.
C. parvum produces ATP through glycolysis. The enzyme lactate dehydrogenase is used by the C. parvum to generate metabolic ATP. It generates this ATP through the glycolytic pathway. The enzyme allows the conversion of NADH to NAD+. NAD+ is necessary for glycolysis to produce ATP. Metabolic energy plays a crucial role in the growth and proliferation of the pathogen in the host.
Some of the features of C. parvum are:
It consists of a unique lactate dehydrogenase enzyme to yield ATP. It causes the disease in the gastrointestinal tracts. The pathogen is used for research and understand its ability to obtain ATP directly from the host.Therefore, C. parvum consists of enzyme lactate dehydrogenase that helps in energy production through the glycolytic pathway.
To know more about C. parvum, refer to the following link:
https://brainly.com/question/16360264
This peripheral blood smear is from a 42-year-old man with a past medical history significant for hypertension who presents with progressive fatigue and weakness over the past month. He indicates generalized abdominal fullness. Laboratory data include: WBC = 129.7 x 10^3/uL , RBC = 4.43 x 10^6/uL , HGB = 13.0 g/dL, MCV = 91 fL, RDW = 15%, and PLT = 309 x 10^3/uL. Identify the following cells and answer the accompanying questions.
1.What cytochemical stain might be done on the peripheral blood smear to aid in diagnosis?
2.What would you expect the results of the special stain to be ?
3.Explain your answer Calculate the Mean corpuscular Hemoglobin Concentration
4.Calculate the Hct What is this disease?
5.Name the chromosomes associated with this disease. Explain the genetic translocation associated with this disease
1. A cytochemical stain that might be done on the peripheral blood smear to aid in diagnosis is a myeloperoxidase (MPO) stain. 2. If a myeloperoxidase (MPO) stain is performed, the results would be negative. 3. The mean corpuscular hemoglobin concentration (MCHC) cannot be determined with the given data since the hematocrit (Hct) value is not provided.
1. A cytochemical stain that might be done on the peripheral blood smear to aid in diagnosis is a myeloperoxidase (MPO) stain.
2. In this case, if a myeloperoxidase (MPO) stain is performed, the results would be negative.
3. The mean corpuscular hemoglobin concentration (MCHC) is calculated by dividing the hemoglobin concentration (HGB) by the hematocrit (Hct) and multiplying by 100. However, the information provided in the question does not include the Hct value, which is necessary for calculating the MCHC. Therefore, it is not possible to determine the MCHC with the given data.
4. The hematocrit (Hct) can be calculated by multiplying the red blood cell count (RBC) by the mean corpuscular volume (MCV) and dividing by 10. In this case, the RBC count is 4.43 x 10^6/uL and the MCV is 91 fL. Using the formula: Hct = (4.43 x 10^6) x (91) / 10, the calculated Hct is 40.273%.
To learn more about cytochemical stains
https://brainly.com/question/31365924
#SPJ11
You are an ecologist that just moved to Michigan and you are embarking on research in a new study system - prairies - native grasslands with high species diversity. Your first order of business is to explore this new system and make some detailed observations. You are particularly interested in an invasive species which has come to dominate many prairie ecosystems - autumn olive. Invasive species are species that become established in a region where they are not native. These species cause damage to the environment, human economy and/or human health. As you explore, you notice that autumn olive appears to be more abundant along the edge of the prairie you are studying (which borders a forest) relative to the central region of the prairie. You wonder why this may be the case.
For this assignment think about why you may be seeing this pattern and describe an experiment to test your ideas. Use the questions below as a guide:
What is your research question?
What is your biological hypothesis?
Briefly, how would you design an experiment to test this hypothesis?
Based on this experimental design, how would you statistically analyze your data?
Keep your response brief (one or two paragraphs). We know that you likely do not have the biological understanding of this system to design a study that would be realistic. We are interested in your thought process and how you go about choosing the appropriate analytical method.
This study highlights the importance of understanding the ecology of invasive species and their interactions with the surrounding environment.
The research question of why autumn olive is more abundant along the edge of the prairie compared to the central region is addressed through a well-designed experimental approach.
The biological hypothesis suggests that the presence of a forest edge adjacent to the prairie may provide favorable conditions for the growth and spread of autumn olive.
Factors such as increased light availability, higher nutrient levels, and potentially altered disturbance regimes in the edge habitat may facilitate the establishment and expansion of this invasive species.
Statistical analysis, including tests like t-tests or Mann-Whitney U tests, will be used to compare the abundance of autumn olive between the edge and central regions.
Regression analysis will further explore the relationships between the abundance of autumn olive and measured environmental variables, providing insights into the driving factors of the invasion pattern.
Overall, this study highlights the importance of understanding the ecology of invasive species and their interactions with the surrounding environment.
Learn more about invasive species: brainly.com/question/27931978
#SPJ11
What is likely to happen if a new organism that feeds off mice is introduced?
a.
The mice population will increase in response to the arrival of the new organism.
b.
The mice population, grasshopper population, and plant population will all increase.
c.
The new organism will compete with the snake population for resources.
d.
The populations of the existing organisms will remain unaffected.
Please select the best answer from the choices provided
A
B
C
D
Answer: A
Explanation:
this is correct because the mice population will decrease and would increase to prevent extinction
what are the similarities between cats and lion
Answer: eating D I C K
Explanation:
they lick it
35. Cause and Effect Even a very small difference in
a person's DNA can have a dramatic influence on
their health. Use the example of cystic fibrosis to
illustrate this point.
A person's DNA can determine their risk of developing certain diseases, which can have a major genetic impact on their health.
What is DNA?DNA (deoxyribonucleic acid) is a molecule that contains the biological instructions that make each species unique. DNA is composed of two strands of nucleotides twisted together in a double helix formation and contains the genetic instructions used in the development, functioning, and reproduction of all known living organisms and many viruses.The molecule of information is DNA. It holds the blueprints needed to create genetic proteins, which are other big molecules. Each of your cells contains these instructions, which are dispersed throughout 46 lengthy structures known as chromosomes. Numerous smaller DNA fragments known as genes make up each of these chromosomes.To learn more about DNA from the given link
https://brainly.com/question/2131506
#SPJ1
Please HELP I am TIMED!!!!
Which of the following nutrients in fertilizer causes abnormalities in muscle contractions?
zinc
potassium
nitrogen
copper
Answer:
potassium I think I am not sure
Which of these statements best explains why DNA is similar in most living organisms?
A. All organisms have the same number of chromosomes
B. All chromosomes have the same number of DNA nucleotide base pairs
C. All DNA contains the same bases that code the same amino acids
D. All SNA is passed from one generation to the next during reproduction
Answer:
D Hope this is right......
All DNA is passed from one generation to the next during reproduction. So the correct option is D.
What is the DNA?DNA or deoxyribonucleic acid is a polynucleotide molecule. Each nucleotide of DNA is composed of one nitrogen base, one deoxyribose sugar and one phosphate group.
The nucleotides are bonded with each other by the formation of phosphodiester bonds which liberate a water molecule.
The nitrogen base in the DNA is of four types. Adenine, Thymine, Cytosine and Guanine. The DNA is present in a double-stranded form and the nitrogen base is attached to each other in both the strands with the help of hydrogen bonds.
The nitrogen bases join with each other by the base pairing rule. Adenine joins to thymine and guanine joins to cytosine.
DNA a genetic material and a hereditary material. It is responsible for the functioning of an organism and the transmission of hereditary traits from one generation to the next.
Therefore the correct option is D.
Read more about DNA, here
https://brainly.com/question/14315652
#SPJ2
what is the effect of an electrical stimulus on the membrane potential of excitable cells?
Answer:
The resting membrane potential is a result of different concentrations inside and outside the cell. The difference in the number of positively charged potassium ions (K+) inside and outside the cell dominates the resting membrane potential
Explanation:
You can bench test a tubular bowl separation by first characterising the product in a test tube centrifugation .Without actually knowing the size and density of the particles in the suspension,derive an expression for angular velocity required to capture the top of the packed solids was 79 mm from the center of rotation after 17 min.
The angular velocity required to capture the top of the packed solids was 79 mm from the center of rotation after 17 min can be derived using the following expression:
ω = (2πn) / 60whereω = angular velocity n = rotational speedThe first step in solving the problem is to convert the time (17 min) to seconds.17 min = 17 × 60 = 1020 secondsWe can also convert the distance (79 mm) to meters:
79 mm = 0.079 m The gravitational constant, g, is equal to 9.81 m/s².Let's substitute the given values in the expression for angular velocity:
ω = (2π × n) / 60 = (2π × r × g) / (60 × h)Where:r = radius of the bowl = 79 mm = 0.079 mh = height of packed solids = 0.017 gn = number of revolutions in 17 min = (1 / 60) × 17 = 0.2833 rpm.Let's convert the rotational speed, n, to radians per second.1 revolution = 2π radiansn = 0.2833 rpm = 0.2833 × 2π / 60 = 0.0297 rad/sNow, we can substitute the values in the expression for ω:
ω = (2π × r × g) / (60 × h) = (2π × 0.079 × 9.81) / (60 × 0.017) = 14.3 rad/sTherefore, the angular velocity required to capture the top of the packed solids was 79 mm from the center of rotation after 17 min is 14.3 rad/s.About RotationRotation is the rotation of an object on a fixed axis, for example the rotation of a top and the rotation of the earth on its axis. For the earth, this rotation occurs on the north-south line/axis/axis. The rotation period or the time it takes for the earth to rotate on its axis for 1 rotation is 23 hours 56 minutes. This is used as a benchmark that the Earth's rotation time is 1 day in size. Earth's rotation around its axis takes 23 hours 56 minutes and 4.091 seconds.
Learn More About Rotation at https://brainly.com/question/27648576
#SPJ11
our sequence is 5' - cttataaagccgtacaaaatctttctagcgcaaaa - 3'. for simplicity sake, only consider the 5' to 3' direction. consider the underlined c. would a change to a g result in a change in gene expression?
No, a change to a G would not result in a change in gene expression as the underlined C is a non-coding nucleotide and does not have any effect on gene expression.
Non-coding DNA corresponds to the portion of an organism's genome that does not code for amino acids, the building blocks of proteins. Some noncoding DNA sequences are known to play functional roles such as regulation of gene expression, whereas other regions of noncoding DNA have no known function. Other regions of non-coding DNA are important for protein assembly. By altering one of these regions, a variant (also known as a mutation) in the noncoding DNA can turn on the gene, causing the protein to be produced in the wrong place or at the wrong time. There are two types of SNPs in the coding region.Synonymous and non-synonymous SNPs. Synonymous SNPs do not affect the protein sequence, whereas non-synonymous SNPs change the amino acid sequence of the protein.
To know more about Non-coding DNA visit:
https://brainly.com/question/28360970?referrer=searchResults
#SPJ4
What is the safest antibiotic
A restriction enzyme is used in a restriction digest reaction with linear dna. The enzyme recognizes and cuts the dna at 3 locations. How many bands of dna would be present if this were run on a gel using gel electrophoresis?.
They will display four bands of DNA if this were run on a gel using gel electrophoresis.
What is the fundamental principle of gel electrophoresis?
When an electric current is applied to a gel, charged molecules travel across it. An electric current is passed through the gel, creating a positive charge at one end and a negative charge at the other. Migration is the movement of charged molecules. Molecules migrate in the opposite direction of their charge.
What is the purpose of agarose in gel electrophoresis?
The separation of nucleic acids using agarose gel electrophoresis has shown to be an efficient and effective method. Because of the high gel strength of agarose, it is possible to handle low percentage gels for the separation of large DNA fragments.
Therefore restriction enzymes cut the DNA at restriction sites. When a restriction enzyme cuts a linear DNA at three points, four DNA fragments are generated.
To learn more about gel electrophoresis
https://brainly.com/question/6885687
#SPJ4
dna determines the structure of proteins produce by cells?
Answer:
A Proteins combine to produce cells, which produce DNA. B Proteins are made up of DNA, which determines the cells that are produced. C DNA is made up of proteins, which tell a cell how to function.
Explanation:
Ethics aside, is there a possibility that gene therapy can go
extremely wrong where it does fix the problem, but it causes a
completely different problem as well?
Gene therapy is a promising field of medicine that can bring hope to millions of people suffering from genetic diseases. However, it should be approached with caution and ethical considerations to minimize the risks and maximize the benefits.
Gene therapy is a medical treatment that aims to repair or replace the defective genes that cause genetic disorders. It's a complex and sensitive procedure that requires a deep understanding of human genetics and advanced technology. Although gene therapy has the potential to treat and cure many genetic diseases, it's not without risks and ethical considerations.
Therefore, it's essential to weigh the benefits against the risks before deciding to use gene therapy. So, the answer to the question is Yes, there is a possibility that gene therapy can go extremely wrong and cause unexpected side effects, even if it fixes the primary problem.
Gene therapy can be harmful in several ways, such as:
Off-target effects: Gene therapy can accidentally target the wrong cells or genes, leading to unpredictable and potentially harmful outcomes.
Immunological reactions: The immune system may see the modified cells as foreign and attack them, leading to inflammation and tissue damage.
Tumorigenesis: Gene therapy may activate oncogenes or inactivate tumor suppressor genes, leading to the formation of cancerous cells in the treated area.
Moreover, there's always the risk of transmitting the modified genes to future generations, raising ethical concerns about the safety and implications of gene therapy.
Therefore, scientists and regulators should conduct extensive preclinical and clinical studies to ensure the safety and efficacy of gene therapy before it's used in humans.
Learn more about: Gene therapy
https://brainly.com/question/11497315
#SPJ11
Name two types of intramolecular bonds.
Answer:
Intramolecular bonds are the bonds that hold atoms to atoms and make compounds. There are 3 types of intramolecular bonds: covalent, ionic, and metallic. Covalent Bond: a bond in which a pair or pairs of electrons is shared by two atoms.
Explanation: I asked my dad who is a doctor .... I hope this helps!!!
Answer:
Covalent bond
Iionic bond
Which of the following are NOT considered biohazards? Select one: A. Infectious or invasive organisms B. Non-toxic proteins purified from rabbit blood C. Biological toxins D. Human cells
The answer is B. Non-toxic proteins purified from rabbit blood are not considered biohazards.
Biohazards refer to biological substances that have the potential to harm living organisms, including humans.
They can be infectious agents, biological toxins, or invasive organisms.
In this case, non-toxic proteins purified from rabbit blood do not pose a threat to human health or the environment.
These proteins are derived from a non-infectious source (rabbit blood) and do not have inherent toxic properties.
Therefore, they are not considered biohazards.
It is important to properly handle and dispose of biohazardous materials to prevent the spread of infectious diseases and ensure safety in laboratory or healthcare settings.
Learn more about Biohazard:
https://brainly.com/question/12002153
#SPJ11
¿Cómo podría el oso ser diferente en varios hábitats?
Bears can vary in appearance and behavior depending on the habitat they live in. Here are some examples: Polar bears: These bears are adapted to living in the Arctic and have several physical and behavioral adaptations to help them survive in this harsh environment.
Brown bears: Brown bears can be found in a variety of habitats, including forests, tundra, and mountains. In coastal regions, they are known as "grizzly bears" and are often larger and more aggressive than their inland counterparts. In forested habitats, brown bears are excellent climbers and can use their sharp claws to climb trees.
Black bears: Black bears are found in forested habitats throughout North America. They are smaller and more agile than brown bears and are excellent climbers. They are also more omnivorous and will eat a wider variety of foods, including berries, nuts, and insects.
Sloth bears: Sloth bears are found in the forests of India, Sri Lanka, and Nepal. They are smaller than other bear species and have a distinct snout that they use to extract insects from trees. They are primarily herbivorous but will also eat small animals and insects.
Overall, bears are highly adaptable and have evolved to thrive in a wide range of habitats. However, their specific physical and behavioral adaptations can vary depending on the habitat they inhabit.
Learn more about Bear habitats
https://brainly.com/question/518912
#SPJ4
Translated Question;
How might the bear be different in various habitats?
Lipids are primarily composed of what elements?
Answer:
Lipids are composed of carbon, hydrogen and oxygen atoms, and in some cases contain phosphorus, nitrogen, sulfur and other elements.
Lipids are primarily composed of carbon, hydrogen, and oxygen. They are also known as fats, oils, and waxes. Lipids are essential for the structure and function of cells, and they provide energy for the body.
Lipids are important for the body in a number of ways. They help to:
Store energy: Lipids are a concentrated form of energy, and they can provide the body with energy when it is needed.
Form cell membranes: Lipids are the main component of cell membranes, which are the outer layer of cells. Cell membranes protect cells and help to control what enters and leaves the cells.
Produce hormones: Lipids are used to produce some hormones, such as testosterone and estrogen.
Absorb fat-soluble vitamins: Lipids help to absorb fat-soluble vitamins, such as vitamins A, D, E, and K.
Lipids are an essential part of the diet, and they should be included in a balanced diet. However, it is important to eat healthy fats, such as those found in avocados, nuts, and seeds. These fats are good for the heart and can help to reduce the risk of heart disease.
To know more about lipids:
https://brainly.com/question/1704581
#SPJ3
Ravi was asked by her boss Bob to deliver an order to a customer using the company van. Bob was hesitant to use Ravi as a delivery person because although Ravi has never had a car accident before she has a reputation amongst her friends and work colleagues for driving fast and getting speeding tickets in her own car. Ravi insisted she would be careful, and Bob knew that the customer really needed the order. Ravi drove carefully and dropped off the products to the customers warehouse. Eager to return the van, she sped as much as 25km over the speed limit on her way to deliver the van back the office. While rounding a curve, she lost control of the van, which tumbled off the road and down a hill, crashing into a tree. lan happened to witness the incident. He stopped his car at the top of the hill and ran down to help. Unfortunately, in his rush to help, he did not put the hand break on in his car and it also rolled down the hill and hit a shed. Ravi emerged from the van dazed but without a scratch. The van and lan's car, however, were severely damaged. lan's car was unable to be repaired and he had to buy a new vehicle. lan had been about to start a new his new home construction business and the delay in getting a suitable vehicle meant that it took an extra 3 months to get the business off the ground. Required 1) Using the law of Negligence explain who the Duty of Care is owed to by: () a) Ravi b) Bob c) lan
Negligence is a legal term used to describe careless behavior that causes damage to another person. The law of Negligence is used to establish whether a person is liable for injuries caused by their actions or omissions.
A duty of care is a legal responsibility that one person or organization has to another person or organization. The concept of a duty of care is central to the law of negligence. In this case, the duty of care is owed by Ravi, Bob, and Lan: RaviThe Duty of Care is owed by Ravi, who was driving the company van. Ravi owed a duty of care to her employer, Bob, and her colleagues, as well as to other road users. Ravi had a duty to drive safely and avoid causing injury or damage to others or their property.
Ravi was negligent when she drove the van at high speed and lost control of the vehicle, causing it to crash. Her negligence resulted in damage to the van, as well as damage to Lan's car. Bob Bob also had a duty of care, as he is Ravi's employer. Bob was responsible for ensuring that Ravi was fit to drive the company van and that she had the necessary skills and experience to operate the vehicle safely. Bob was also responsible for ensuring that the van was in good condition and roadworthy. Bob was negligent when he allowed Ravi to drive the van, knowing that she had a reputation for speeding and driving recklessly.
He could have assigned the delivery to another driver who had a good driving record. LanLan is not liable for any damage caused to Ravi's van as he was not responsible for driving it. However, he was owed a duty of care by Ravi when she caused damage to his car. Ravi's negligent driving resulted in the destruction of the man's car, which had to be replaced. As a result of the accident, Lan was delayed in starting his new home construction business, which caused him to incur a loss. Ravi was responsible for the losses suffered by Lan, and she could be sued for damages caused by her negligence.
To learn more about injuries caused here
https://brainly.com/question/29648597
#SPJ11
look at the following photographs. what two ways are microorganisms used in the making of cheese?
Please attach photograph
What are biomolecules and why they important
Protein List 4 differences
Answer:
The different levels of protein structure are known as primary, secondary, tertiary, and quaternary structure
Explanation:
Answer:
actin myosin hemoglobin titin
name several variables that may affect enzyme action
Explanation:
Enzyme activity can be affected by a variety of factors such as temperature, pH and concentration.
Temperature, pH, substrate concentration, enzyme concentration, presence of inhibitors and activators are variables that may affect enzyme action.
Enzyme activity can be influenced by a variety of factors. Temperature is one of the most significant factors that impact enzyme activity, as enzymes have an optimal temperature range where they work most efficiently. pH also plays a significant role in enzyme activity since each enzyme has an optimal pH at which it functions best.
The concentration of the substrate and enzyme may affect the reaction rate, as a higher concentration of either may lead to an increase in the rate of reaction. Inhibitors, which may be competitive or non-competitive, can inhibit enzyme activity, while activators can enhance it. Other factors that can influence enzyme activity include the presence of cofactors and coenzymes, as well as the overall cellular environment, such as the presence of other enzymes and metabolic pathways.
Learn more about activators here:
https://brainly.com/question/11563662
#SPJ11
What do you call something that is repeated throughout a work?
OA a mout
B. a symbol
Oc a figure of speech
D
consonance
Help Me Please!!!
Why is the air temperature shown on Sensor 4 (location 4) different from Sensor 5 (location 5), even though they are at the same latitude?
Answer:because they are not in the same place
Explanation:
How do you think Zebra Mussels might affect the Hudson River ecosystem?
Answer: Effects on the Hudson Ecosystem
The zebra mussel invasion has had profound effects on the Hudson River ecosystem. The food web changes that the mussel has caused compare in magnitude to disturbances in other aquatic ecosystems caused by toxins, nutrient pollution, or acid rain.
What is greatly affected by atmospheric pressure?
4 functions specific to sponges
Answer:
Although sponges do not have organized tissue, they depend on specialized cells, such as choanocytes, porocytes, amoebocytes, and pinacocytes, for specialized functions within their bodies. The mesohyl acts as a type of endoskeleton, helping to maintain the tubular shape of sponges.
Explanation:
this what I found when searching for the answer lol
According to the passage, what causes mutations during protein synthesis?
A. A wrong base becomes a permanent part of a new DNA sequence.
B. Most mutations happen spontaneously as DNA replicates itself.
C. A great many mutations occur due to chemicals in the environment.
D. Mutations do not occur during the process of protein synthesis.
Answer:
d.
Explanation: