Explain how you know that the square root of 30 is between 5 and 6

Answers

Answer 1
It’s between 5 and 6 mostly because 5 x 6 = 30.
Answer 2

Answer:

We know that 6 squared equals 36, and we know that 5 squared is equal to 25. SO we know that 30 must lie somewhere between those two numbers. It is greater than 5, but less than 6 because 25 is less than 30 and 36 is greater than 30.


Related Questions

Fern has 2 1/4 gallons of paint. Each gallon of paint will cover 375.5 ft2. How many square feet will fern be able to cover if she uses all the paint?

Answers

375.5x2, 375.5/4 = 93.875, so the answer is 844.875

Find the equation of a line which has a slope of 8 and crosses the y- axis at -3

Find the equation of a line which has a slope of 8 and crosses the y- axis at -3

Answers

Answer:

y = 8x - 3

Step-by-step explanation:

The point where the line crosses the y-axis is the y-intercept and the intercept we're looking for. We know the slope 8 and the intercept -3, so we can just provide the answer

\(\large\textsf{{Hi! In this problem we need to find the equation of a line}}\\\textsf{in slope-intercept form: \textbf{y=mx+b}, where \textbf{m} is the slope}\\\textsf{and \textbf{b} is the y-intercept}}.\\\\\\\\\textsf{The question provides us both the slope \& the y-intercept}\\\textsf{This means we can find the equation by}\\\textsf{plugging the numbers into the formula:}\\\\\textbf{y=mx+b}\\\\\textbf{y=8x+(-3)}\\\\\textbf{y=8x-3}\twoheadleftarrow\boldsymbol{Answer!}\ddot\smile\)

1.
A factory stacks boxes according to their weights. To provide stability to the stacks of boxes, heavier boxes are placed at the bottom of the stack, and lighter boxes are placed at the top. However, because of the boxes’ material, a box can only be placed on top of another if its weight is exactly half the weight of the lower box. Also, due to the height of the warehouse ceiling, boxes can only be stacked 4 levels high. The factory director has asked for your help in answering some questions about these boxes.

a. Explain how you would find the weight of each stacked box if you knew the weight of the bottom box. Find the weight of each box in a stack of 4 boxes if the bottom box weighs 10 pounds.
b. Eventually, these stacks of boxes will go onto pallets for shipping. We need to know how much each stack weighs in order to know how many stacks we can put on each pallet, but the bottom boxes do not necessarily weigh 10 pounds. In fact, we don’t know how much they weigh at all! Write and simplify an expression to find the weight of one stack of 4 boxes based on the unknown weight of the bottom box.
c. Each stack needs to weigh less than 100 pounds. Write and solve an inequality to find the maximum weight of the bottom box. What would be the possible range of weights for this box? It may help you to consider a graph of the solution to your inequality.
I rlly need help for c, I got the other 2.

Answers

If the weight of the bottom box is b then the weight of a stack of four boxes is b + b/2 + b/4 + b/8
= 8b/8 + 4b/8 + 2b/8 + 1b/8
= 15/8 b
A stack must weigh less than 100 pounds
15/8 b < 100
b < 100 x 8/15 = 53 1/3 pounds
If boxes have a minimum weight of 1 pound then
for stacks that contain 4 boxes the range of b is [8, 53 1/3)
and if stacks contain 1 to 4 boxes the range of b is [1, 53 1/3)

If the only restriction is a maximum of 100 then the range of b is [0, 53 1/3)

Juness is trying to determine the number of games of fetch her dog can play before her dog gets tired. Juness decides that one game of fetch counts as one 10-foot throw of the ball that her dog returns to her feet (or within arm's reach). Juness is offering a(n):

Answers

The term "quantification system" is often used in research or scientific experiments. It is used to determine the characteristics of the data, such as its nature, source, and extent, in order to obtain the most accurate measurements possible.

Juness is offering a quantification system by determining the number of games of fetch her dog can play before her dog gets tired. She decided that one game of fetch counts as one 10-foot throw of the ball that her dog returns to her feet (or within arm's reach). Juness is offering a(n) quantification system.

What is Quantification System?A quantification system is a process of determining the number, amount, or size of something. In other words, it is a process of putting a numerical value to the observation or data that helps in understanding the magnitude of the phenomenon or information.

The term "quantification system" is often used in research or scientific experiments. It is used to determine the characteristics of the data, such as its nature, source, and extent, in order to obtain the most accurate measurements possible.

Therefore, Juness is offering a quantification system by determining the number of games of fetch her dog can play before her dog gets tired by determining that one game of fetch counts as one 10-foot throw of the ball that her dog returns to her feet (or within arm's reach). The answer is 150 words.

To know more about qualification system,

https://brainly.com/question/4912954

#SPJ11

Juness is offering a definition of what a game of fetch is in terms of a specific type of action that her dog needs to perform, which is to retrieve a ball that Juness throws 10 feet away from her and bring it back to her feet (or within arm's reach).Explanation:Juness has come up with a specific definition of what constitutes a game of fetch for her dog. One game of fetch, according to Juness, is the equivalent of one 10-foot throw of the ball that her dog needs to retrieve and return to her feet or within arm's reach. This means that Juness is offering a definition of what a game of fetch is in terms of a specific type of action that her dog needs to perform, which is to retrieve a ball that Juness throws 10 feet away from her and bring it back to her feet (or within arm's reach).The number of games that her dog can play before getting tired is unknown and would need to be determined through observation and trial. However, Juness has provided a clear and specific definition of what she considers to be one game of fetch, which will be helpful in tracking the dog's activity and progress in the future. This response is a 150-word explanation of what Juness is offering.

− 2.5 = −3 help me please

Answers

Answer:

0.5

Step-by-step explanation:

-0.5-2.5=-3

OR

-2.5+3=0.5

T Raiderlink Bb Blackboard SPC Blackboard TTU -/1 Points] DETAILS HARMATHAP12 9.4.011. Find the derivative of the function. w = 2? - 326 + 14 w= 1-/1 Points) DETAILS HARMATHAP12 9.4.014.MI. Find the derivative of the function. +(x) = 16x12 + 6x6 - 2x + 19x - 7 h'(x) = [-/1 Points] DETAILS HARMATHAP12 9.5.002.MI. Find the derivative and simplify. y = (8x + 5)(x2 – 3x).

Answers

The derivative of the function is

A) dw/dz=z^5 (7z-18)

B) dh/dx=192x^11+36x^5-6x^2+19

C) dy/dx=24x^2-38x-15

In mathematics, the derivative of a function measures the sensitivity to change of the function value with respect to a change in its argument. It is the rate of change of a function with respect to a variable.

A) w = z^7 – 3z^6 + 14

dw/dz=7z^6-18z^5

dw/dz=z^5 (7z-18)

B) h(x) = 16x^12 + 6x^6 – 2x^3 + 19x – 7

dh/dx=192x^11+36x^5-6x^2+19

C) y = (8x + 5)(x^2 – 3x)

dy/dx=  d/dx  [8x+5]*〖(x〗^2-3x)+(8x+5)*d/dx[x^2-3x]

dy/dx=(8*  d/dx  [x}+d/dx[5])*〖(x〗^2-3x)+(8x+5)*(d/dx[x^2]-3 d/dx[x])

dy/dx=(8*1+0)(x^2-3x)+(8x+5)(2x-3*1)

dy/dx=8(x^2-3x)+(2x-3)(8x+5)

dy/dx=24x^2-38x-15

Note: The question is incomplete. The complete question probably is: Find the derivative of the following function: A) w = z^7 – 3z^6 + 14 B) h(x) = 16x^12 + 6x^6 – 2x^3 + 19x – 7 C) y = (8x + 5)(x^2 – 3x).

Learn more about Derivative:

https://brainly.com/question/23819325

#SPJ4

Can someone help I’m not good with word problems

Can someone help Im not good with word problems

Answers

Answer:

I agree that this question can be confusing:

Apparently point A and point B must be on the same straight line (measured from the light house or the question would be nonsensical)

tan 13 = H / DA      where H is height of lighthouse

tan 8 = H / DB       tangent measured from point B

tan 13 / tan 8 = DB / DA

DB = .2309 / .1405 * 1279 = 2101 ft

DB - DA = 2101 - 1279 = 822.0 ft

Unprogrammable Programs Prove whether the programs described below can exist or not. A program P(F,x,y) that returns true if the program F outputs y when given x as input (i.e. F(x) = y) and false otherwise.

Answers

The program P(F, x, y) can exist, where P returns true if the program F outputs y when given x as input (i.e., F(x) = y) and false otherwise.

Why is this statement false?

The program P(F, x, y) can exist, and it's known as a program that solves the Halting Problem. Here's a step-by-step explanation:

1. Define the program P(F, x, y) that takes input parameters F, x, and y.
2. The program P will execute the function F with the input x.
3. P will monitor the output of F when provided with x as input.
4. If F(x) equals y, P will return true, indicating that the program F outputs y when given x as input.
5. If F(x) does not equal y, P will return false, indicating that the program F does not output y when given x as input.

However, it's important to note that solving the Halting Problem is proven to be impossible for a Turing machine (a theoretical model of a computer).

This means that while we can define the program P(F, x, y) in principle, it's not possible to create a general solution that works for all possible combinations of programs F and inputs x and y.

Learn more about Halting Problem.

brainly.com/question/30186720

#SPJ11

Suppose that each of n sticks is broken into one long and one short part. The 2n parts are arranged into n pairs from which new sticks are formed. Find the probability (a) that the parts will be joined in the original order, (b) that long parts are paired with short parts.

Answers

Given Information:Each of n sticks is broken into one long and one short part. The 2n parts are arranged into n pairs from which new sticks are formed.Pairing each long part with a short part gives n possible pairs.Explanation:a. Probability that the parts will be joined in the original orderWe have n sticks that are broken into 2 parts

each.So, total parts = 2nOut of 2n parts, we can select n parts in n! ways. (Order is important as we have to join them in the original order)For each such n! arrangement, there is only 1 main answer that is the original order of n sticks.Now, total number of ways to arrange the parts is 2n!.So, probability that the parts will be joined in the original order = Number of favourable outcomes / Total number of possible outcomes= n! / 2n! = 1 / 2n-1b. Probability that long parts are paired with short partsWe have n pairs out of which one part is long and other is short.Each long part can be paired with a short part in n ways.Out of n pairs, one pair can be selected in nC1 ways. Similarly, the other pairs can be selected in n-1 C 1 ways, n-2 C 1 ways and so on

Total number of ways to select n pairs is n * (n-1) * (n-2) *... * 1 = n!So, probability that long parts are paired with short parts= Number of favourable outcomes / Total number of possible outcomes= n! / 2n! = 1 / 2n-1Therefore, the main answer to the problem is:(a) Probability that the parts will be joined in the original order= n! / 2n!(b) Probability that long parts are paired with short parts= n! / 2n!

To know more about Probability visit:

https://brainly.com/question/32117953

#SPJ11

How many five card hands can
be dealt from a standard deck of
52 cards?

Answers

Answer:

2

Step-by-step explanation:

-5 (4x - 6)..........

Answers

the answer is -20x+30 because its just math

Answer: -20x+30

Explanation:

multiply -5 with the numbers in the parenthesis

-5 · 4x and -5 · 6

-20x+30

if you are asked to simplify then, -2x+3. Although, I doubt they asked for it to be simplified. Hope this helps!

Todd made a table to show different plans he can use to save $500. Complete the table. Which plan can Todd use to save $500 in less than 16 weeks and have $20 extra? Explain how you found your answer

Answers

Todd use to save $500 in less than 16 weeks and have $20 extra in Plan C.

In plan A,

    Plans for saving = $500

  Amount of saving each week = $20

∴ Number of weeks needed to make goal = (500 ÷ 20) (by using division)

                                                                       = 25

In plan B,

    Plans for saving = $500

   Amount of saving each week = $30

Number of weeks needed to make goal = (500 ÷ 30) (by using division)

                                                                       = 17

In plan C,

    Plans for saving = $500

   Amount of saving each week = $40

∴ Number of weeks needed to make goal = (500 ÷ 40) (by using division)

                                                                       = 13

In plan D,

    Plans for saving = $500

   Amount of saving each week = $50

∴ Number of weeks needed to make goal = (500 ÷ 50) (by using division)

                                                                       = 10

So, Todd use to save $500 in less than 16 weeks and have $20 extra in Plan C.

Read more about divisions:

https://brainly.com/question/25289437

#SPJ4

Todd made a table to show different plans he can use to save $500. Complete the table. Which plan can

plz help me I only have 5 minutes left winner gets brainliest
Which ancient empire rose to power during the reign of Alexander the Great?



Kush


Carthage


Punt


Mali

Answers

Answer:B Carthage Well if its not then i dont know what to say

help pls!!!!!!!!!!!!!!!!!!!!!!!

help pls!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

x = -6

Step-by-step explanation:

50+x+46=90

x=90-50-46

x= -6

Consider the following function and graph. X f(x) = 8 x²-9 -10-8-6 4 6 8 10 X Determine whether f(x) approaches [infinity] or -[infinity] as x approaches 3 from the left and from the lim f(x) (a) X-3 (b) lim f(x) X-3+ -2 N b N 2.

Answers

f(x) approaches -1 as x approaches 3 from the left and from the right

lim f(x) as x → 3 exists and is equal to -1

lim f(x)/[2sin(x)/x] as x → 3+ does not exist.

Looking at the graph of the function f(x) = 8x² - 9, we can see that as x approaches 3 from the left (i.e., x → 3-), f(x) approaches a value close to -1, but does not go all the way to negative infinity. Therefore, we can say that lim f(x) as x → 3- = -1.

Similarly, as x approaches 3 from the right (i.e., x → 3+), f(x) also approaches a value close to -1, but does not go all the way to negative infinity. Therefore, we can say that lim f(x) as x → 3+ = -1.

Next, let's consider the limit of f(x) as x approaches 3. From the left and the right, the limit is -1, so we can say that lim f(x) as x → 3 exists and is equal to -1.

Finally, we need to find lim f(x) as x → 3+ - 2sin(x)/x. As x approaches 3, the term 2sin(x)/x approaches 2sin(3)/3, which is approximately 0.282. Since we have already determined that lim f(x) as x → 3+ = -1, we can use algebraic manipulation of limits to find lim [f(x)]/[2sin(x)/x] as x → 3+. This simplifies to:

lim [f(x)]/[2sin(x)/x] as x → 3+ = [lim f(x) as x → 3+] / [lim (2sin(x)/x) as x → 3+] = -1 / 0.282

This fraction is undefined, since dividing by zero is not allowed. Therefore, lim f(x)/[2sin(x)/x] as x → 3+ does not exist.

To summarize:

f(x) approaches -1 as x approaches 3 from the left and from the right

lim f(x) as x → 3 exists and is equal to -1

lim f(x)/[2sin(x)/x] as x → 3+ does not exist.

Learn more about function here:

https://brainly.com/question/30721594

#SPJ11

45,52,17,63,57,42,54,58 outlier

Answers

To identify an outlier in a set of numbers, we first need to determine the central tendency of the data, such as the mean or median. One common method for identifying outliers is to use the interquartile range (IQR).

To do this, we first need to find the median of the data set:

45, 52, 17, 63, 57, 42, 54, 58

Arranging them in ascending order:

17, 42, 45, 52, 54, 57, 58, 63

The median is the middle value, which is 54.

Next, we need to find the IQR. The IQR is the range between the first and third quartiles of the data. The first quartile (Q1) is the median of the lower half of the data, and the third quartile (Q3) is the median of the upper half of the data.

To find Q1 and Q3, we split the data into two halves:

Lower half: 17, 42, 45, 52

Upper half: 54, 57, 58, 63

Q1 is the median of the lower half, which is (42 + 45)/2 = 43.5.

Q3 is the median of the upper half, which is (57 + 58)/2 = 57.5.

Therefore, the IQR is 57.5 - 43.5 = 14.

Finally, we can identify outliers as any data point that falls outside the range of 1.5 times the IQR above Q3 or below Q1.

The upper limit is Q3 + 1.5(IQR) = 57.5 + 1.5(14) = 78.5.

The lower limit is Q1 - 1.5(IQR) = 43.5 - 1.5(14) = 22.5.

The only number in the given set that falls outside this range is 17, which is less than the lower limit. Therefore, 17 is the outlier in this data set.

Answer:

17

Step-by-step explanation:

In the set of numbers: 45, 52, 17, 63, 57, 42, 54, 58, the outlier is the number 17.

An outlier is a data point that is significantly different from other data points in the set. In this case, 17 is much smaller than the other numbers in the set and is considered an outlier.

Exponential growth followed by a steady decrease in population growth until the population size stabilizes due to limiting environmental factors is typical of ____.

Answers

The phenomenon described, characterized by exponential growth followed by a steady decrease in population growth until stabilization, is typical of logistic growth.

Logistic growth is a concept often observed in biological populations, where the population initially experiences rapid growth due to abundant resources and favorable conditions. During this initial phase, the population size increases exponentially. However, as the population grows larger, it begins to face limiting factors such as limited food supply, competition for resources, predation, disease, and limited habitat. These factors impose constraints on the population's growth rate.

As the population approaches its carrying capacity, which is the maximum population size that the environment can sustain, the growth rate starts to decline. The population growth rate becomes more gradual until it eventually reaches zero, resulting in a stable population size. This leveling off of population growth is due to the balance between birth rates and death rates, as well as the availability of resources. In logistic growth, the population reaches an equilibrium point where it remains relatively stable over time.

The logistic growth model provides a more realistic representation of population dynamics compared to simple exponential growth models. It accounts for the influence of limiting factors on population growth and helps explain the patterns observed in many natural populations.

Learn more about growth here:
brainly.com/question/28789953

#SPJ11

(I didnt put the full question on acident please ignore this :') )

Answers

Answer:

k but pls put the question so you that will get support:-)

Where is the questions?

the sun is shining and a spherical snowball of volume 260 ft3 is melting at a rate of 11 cubic feet per hour. as it melts, it remains spherical. at what rate is the radius changing after 6.5 hours?

Answers

If the spherical snowball is melting , then the rate at which the radius changing after 6.5 hours is 0.208 ft/h  .

A spherical snowball has volume = 260 ft³ that is melting at a rate of 11 cubic feet per hour, while remaining spherical.

We have to find the rate at which the radius is changing after 6.5 hours.

So , let "V" = volume of snowball, "r" = radius of snowball, and "t" = time.

Volume Of Sphere is  V = (4/3)πr³ and dV/dt = -11 ft³/h ;

So,  dr/dt when t = 6.5 hours. is dV/dt = (dV/dr)×(dr/dt)  ;

derivative of volume formula with respect to "r", we get:

⇒ dV/dr = 4πr²   ;

Substituting the given values in chain rule equation, we get:

⇒ -11 = (4/3)πr² × dr/dt  ;

⇒ dr/dt = -11/((4/3)πr²)

For  rate of change of the radius when t = 6.5 hours, we find the radius at that time.

The initial volume of the snowball = 260 ft³.

After 6.5 hours of melting at a rate of 11 ft³/h, the remaining volume will be:  V = 260 - (11 × 6.5) = 188.5 ft³   ;

So , V = (4/3)πr³

⇒ 188.5 = (4/3)πr³

⇒ r³ = (188.5 × 3 / (4π))   ;

≈ 3.55ft

Now we substitute r = 3.55 feet

⇒ dr/dt = -11/[(4/3)π(3.55)²]  ;

⇒ dr/dt ≈ -0.208 ft/h  ;

Therefore , the rate at which radius is changing after 6.5 hours is approximately 0.208 feet per hour and negative sign represents that radius is decreasing  .

Learn more about Rate Of Change here

https://brainly.com/question/28891125

#SPJ4

Can someone pls answer this !!!

Can someone pls answer this !!!

Answers

Answer:

Step-by-step explanation:

Supplementary angles- angles that equal 180

AOC is 44+56

AOC=100

EOB clearly is more than 100 degrees seeing as its wider than AOC so a is not true

Complementary angles- angles that equal 90

AOC is 100 degrees and BOC is 56

thats more than 90 so thats not true either.

Adjacent angles- angles with a common side and vertex and don't overlap. They do not need to have the same measure or add up to anything.

Both EOD and DOC share a vertex, O, and a side, OD, showing they are adjacent making the answer true.

The answer would be C. no, no, yes

fter following the directions in the background and procedures, you prepare a diluted version of your buffer. assume the ph of your diluted buffer is identical to the ph of your original buffer. then use this ph to calculate what the ph should be after adding 0.10 m naoh to 50 ml of the diluted buffer. (side note: theoretically, the diluted buffer should have the same ph as your original buffer (think about why). in reality, it may not be exactly the same, because the ionic strength of the solution changes (something you will learn more about in future courses).) the ph change after adding naoh should be different for the dilute buffer than for the original buffer because the two solutions have different buffering capacities. expected ph after adding 1 ml of 0.10 m naoh to diluted buffer 4.42 expected ph after adding 6 ml of 0.10 m naoh to diluted buffer

Answers

The expected pH after adding 1 ml of 0.10 M NaOH to the diluted buffer is 4.42, and the expected pH after adding 6 ml of 0.10 M NaOH to the diluted buffer is unknown.

When preparing the diluted buffer, it is assumed that the pH of the diluted buffer is identical to the pH of the original buffer. Therefore, after adding 0.10 M NaOH to the diluted buffer, we can calculate the expected pH change. However, the specific pH change after adding 6 ml of 0.10 M NaOH to the diluted buffer is not provided. The pH change after adding NaOH to a buffer depends on the buffering capacity of the solution. Buffers resist changes in pH by containing a weak acid and its conjugate base (or a weak base and its conjugate acid). The diluted buffer has a different buffering capacity than the original buffer due to changes in the ionic strength of the solution.

To calculate the expected pH change, we need to consider the concentration of the buffer components, the volume of the buffer, and the volume and concentration of the NaOH added. By using the Henderson-Hasselbalch equation or other relevant equations for pH calculations, we can determine the expected pH change after adding a specific volume of NaOH to the diluted buffer. However, without additional information or calculations, we cannot provide the expected pH after adding 6 ml of 0.10 M NaOH to the diluted buffer.

Learn more about Addition here: brainly.com/question/29464370

#SPJ11

if 54735 = 53000+735+p what is the value of p

Answers

Answer:

1000 :)

Step-by-step explanation:

We need to subtract to solve!!

54735 - 53000 = 1735

1735 - 735 = 1000

Have an amazing day!!

Please rate and mark brainliest!!!

The answer to 2+2 isnt 4 ill show you why

So you need to do f(x) 5x^2+3x-19+3

You would simplify the equation to get to y=4x+5f(x)+2

Naturally you would now graph the equation to a linear degree but still inducing a parabellum, y-(d-3)=0

Then solve using the square method (b/2)^2=(6)^2

Then put the 6 on both sides of the equation.

6^2+w0+8x+7t^2

After you get hydrogen oxide as your answer please note: Puenomia can only occur inside the respatory system.

There ya go: 18.

Answers

wow you are so smart

Help I will give you brainliest

Help I will give you brainliest

Answers

Answer:

b- 3/5

Step-by-step explanation:

divide 6 from both numbers

Answer:

B, 5/3

Step-by-step explanation:

hope this helps have a good day :)

A fair coin is flipped ten times. What is the
probability of the coin landing heads up
exactly six times?

Answers

Answer:

It’s 105/512, or about 20.51%

Step-by-step explanation:

I don't know, I asked peeps

PLEASE HELP!!! I WILL GIVE BRIANLIST !!!

PLEASE HELP!!! I WILL GIVE BRIANLIST !!!

Answers

Answer:

A or the first one

10. A soccer team is having a fundraiser by selling raffle tickets. Each ticket costs $2. For every 3 tickets
purchased, there is a $1. Discount. Which table displays the total price for the number of tickets
purchased?

10. A soccer team is having a fundraiser by selling raffle tickets. Each ticket costs $2. For every 3

Answers

Answer:

B

Step-by-step explanation:

2 over 3 tickets subtract the 1 dollar discount

The answer is B.

I hope this helped! And I might be wrong, just saying lol

I don't think I am though...

Michael invested a total of $14,000 in two certificates of deposit. One pays 5% interest,
and the other pays 6% interest. His total interest at the end of one year is $780. How
much is invested in the CD that pays 5% interest?

Answers

Answer:

6000=5%

8000=other CD

Step-by-step explanation:

3. Suppose g(t) = [0.5sinc²(0.5 t) cos(2 t)], where the sinc function is defined as (3.17) on p. 100 of the textbook. (a) Apply Parseval's Theorem to determine the 95% energy bandwidth (B) of this signal, where we define the 95% energy bandwidth as:
(b) Gf²df = 0.95Eg. What is the 95% energy bandwidth of g(2t) in terms of the value of B determined in Part a. Please provide full justification for your answer.

Answers

To determine the 95% energy bandwidth (B) of the signal g(t) = [0.5sinc²(0.5 t) cos(2 t)], we can apply Parseval's Theorem. Parseval's Theorem states that the total energy of a signal in the time domain is equal to the total energy of the signal in the frequency domain. Mathematically, it can be expressed as:

∫ |g(t)|² dt = ∫ |G(f)|² df

In this case, we want to find the frequency range within which 95% of the energy of the signal is concentrated. So we can rewrite the equation as: 0.95 * ∫ |g(t)|² dt = ∫ |G(f)|² df

Now, we need to evaluate the integral on both sides of the equation. Since the given signal is in the form of a product of two functions, we can separate the terms and evaluate them individually. By applying the Fourier transform properties and integrating, we can find the value of B.

For part (b), when we consider g(2t), the time domain signal is compressed by a factor of 2. This compression results in a corresponding expansion in the frequency domain. Therefore, the 95% energy bandwidth of g(2t) will be twice the value of B determined in part (a). This can be justified by considering the relationship between time and frequency domains in Fourier analysis, where time compression corresponds to frequency expansion and vice versa.

Learn more about Parseval's Theorem here: brainly.com/question/33212886

#SPJ11

2. Find the value of x and y.
(2x+7)
(12y+1)
Ox= 15, y = 12
Ox=14, y = 11
(3-7)
(1 point)

Answers

The value of x and y are x=14 and y=12

We can use 2x + 7 = 3x - 7 to solve for the corresponding measures.

Let's solve for x:

2x + 7 = 3x - 7

2x + 7 - 2x = 3x - 7 - 2x

7 = x - 7

7 + 7 = x - 7 + 7

14 = x

We can use (2x + 7) + (12y + 1) = 180 to solve for the straight angle.

Substitute for x

(2(14) + 7) + (12y + 1) = 180

(28 + 7) + (12y + 1) = 180

35 + 12y + 1 = 180

Now solve for y:

36 + 12y = 180

36 + 12y - 36 = 180 - 36

12y = 144

12y/12 = 144/12

y = 12

To learn more about straight angle visit https://brainly.com/question/9662298

#SPJ9

Other Questions
Can anyone help me with the Wet Lab Guide - Coulomb's Law report? I'm really having trouble with it. I have attached the worksheet Please answer this ASAP!!!!!!What type of weather are the upper part of Africa and the lower half of Asian most likely experience, it's on the image?rainfalldry heatcold breezesthunderstorms which particle determines the nuclear charge? The excerpt below was taken from an article on Fox Business last week. It should be used to answer the 3 questions that follow. Trump Starts to Sketch \$1 Trillion Infrastructure Plan - President Donald Trump called for a \$1 trillion infrastructure plan last month in his address to a joint session of Congress and added that the projects would be financed through public and private funds. He pushed his White House team to craft a plan that would pressure states to streamline local permitting, favor renovation of existing roads and highways over new construction and prioritize projects that can quickly begin construction. If implemented, the President's infrastructure plan would likely a. Shift the LM curve rightward b. Shift the LM curve leftward c. Shift the IS curve rightward d. Shift the is curve leftward e. Shift both curves in the same direction Following the prediction of our standard IS-LM model, most economists adjusted their forecasts for the US economy by a. Lowering both GDP and interest rates forecasts b. Raising both GDP and interest rates forecasts c. Raising GDP and lowering interest rates forecasts d. Lowering GDP and raising interest rates forecasts The impact of the infrastructure plan on GDP in the short run would be stronger if a. The Fed adjusted the money supply in order to keep interest rates from changing b. Money demand was not very sensitive to changes in income c. Money demand was very sensitive to changes in interest rates d. All the above e. None of the above Hey you... can you pls help me. Can you summarize: Shree Bose; Never Too Young To Change The World.PLSSSS Can Someone help me with this problem? Which statement is NOT supported by Newtons Laws of Motion?The magnitude of the acceleration of an object is inversely proportional to its mass.If the sum of the forces acting on an object is zero, the object will have zero acceleration.The direction of the acceleration of an object is the same as the direction of the biggest force acting on it.The magnitude of the acceleration of an object is directly proportional to the sum of all the forces acting on it. Gilberto needs to purchase baseballs and bats for his youth baseball league. He'll need at least 15 pieces of equipment, but he only has $435 to spend. Baseballs cost $20 each and bats cost $35 each. If Gilberto wants to purchase the most amount of equipment and still stay within his budget, which combination of baseballs and bats is optimal? (2 points) a (20, 1) b (13, 5) c (13, 2) d (10, 5) problem solving that is learned by observing the behavior of other individuals is called . A corporation acquired a cash machine for $120,000 after deducting a 25% trade discount from the advertised price. The machine was sent at a cost of $2,000 F.O.B. shipping point. The machine's installation and test runs cost $1,000. The machine's recorded acquisition cost is: A- $98,000 B- $128,000 C- $90,000 D- $93,000 some americans believe that americas human rights and humanitarian policies serve american interests by winning friends and demonstrating our concern for the oppressed and less fortunate. they believe that human rights and humanitarian policies are a form of what? Suppose a researcher wishes to edit a gene of interest containing the target DNA sequence 5'_GCGTAACTAGTCCTAACGAG-3' . Design the customized portion of an sgRNA for this target DNA sequence: 5' CUCGUUAGGACUAGUUAGCG [tex]p(x)=x^{3}+7x^{2} -4x-28[/tex] An event that has a dual effect on the accounting equation is referred to as a(n)_______ a. direct effect. b. transaction. c. investment. d. indirect effect. 24 and 25 I dont understand how to do it plz help! The radius of a circle is 58 centimeters. enter the circumference of the circle A linear function contains the following points.0-138What are the slope and y-intercept of this function?A. The slope isThe y-intercept is (0, -1).O B. The slope is -3.The y-intercept is (0, -1).O C. The slope is 3.The y intercept is (0, -1).O D. The slope is 3.The y-intercept is (-1,0). QuestionsQuestion 1 with 8 blanks SERVEUR Vous dsirez?LISE Nous (1) 1 of 8 (rflchir) encore. FANNY Je pense savoir ce que je veux (know what I want).SERVEUR Que (2) 2 of 8 (choisir)-vous, Mademoiselle? FANNY Je (3) 3 of 8 (choisir) un hamburger avec des frites. Et toi?LISE Euh... je (4) 4 of 8 (rflchir). La soupe ou la salade, je pense... Oui, je prends la salade. SERVEUR Trs bien, Mesdemoiselles. Je vous apporte a tout de suite (right away).FANNY Tu n'as pas trs faim? LISE Non, pas trop. Et je suis au rgime (on a diet). J'ai besoin de (5) 5 of 8 (maigrir) un peu. FANNY Tu (6) 6 of 8 (russir) dj. Ton jean est trop grand. Tu n'as pas envie de partager mon clair? LISE Mais non! Je vais (7) 7 of 8 (grossir)! FANNY Alors, je (8) 8 of 8 (finir) l'clair. (2/3) To the power of 4 How many moles are occupied by 2.2x10^23 particles of copper?