Enzymes catalyze chemical reactions by

Answers

Answer 1
By lowering the activation energy

Related Questions

what might happen if the lavender plant population began to decrease?

Answers

Answer:

WELL I KNOW THAT LAVENDOR HELPS WITH STRESS SO IF THERE WAS NO MORE LAVANDOR THEN THERE WOULD BE MORE STRESSED PEOPLE

ALSO LIKE WHATEVER EATS IT WOULD DIE OFF AND LIKE MESS UP THE FOOD CHAIN SORTA THING

Explanation:

Answer:

A decrease in the number of earth worms will also decrease the growth of plants.

Explanation:

Earths worms are the most essential dwelling invertebrates. They affect the biotic as well as abiotic properties of the earth. They are the decomposers in soil and provide free nitrogen to plants. So, if they are dramatically decreased in the soil they will affect the plant growth directly.

Choose the CORRECT statement about enzymes below.
Group of answer choices

Enzymes raise the activation energy needed in a chemical reaction

Enzymes slow down the rate of chemical reactions

Enzymes function best at specific pH and temperatures

Enzymes are carbohydrates and store short term energy

Answers

Answer:

Enzymes function best at specific pH and temperatures.

Explanation:

An enzyme can be defined as a biological catalyst that typically lowers the activation energy of a biological reaction. When the activation energy of a reaction is low, the rate of the reaction would be faster. Therefore, an enzyme speeds or catalyzes the rate of a reaction by lowering its activation energy.

Also, if the conditions are not optimal for an enzyme, it limits the ability of an enzyme to bind or be joined with its substrates.

Hence, the correct statement about enzymes is that enzymes function best at specific pH and temperatures. An increase in temperature increases or speeds up the rate of a reaction while low temperature limits or reduces the rate of a reaction. The optimal temperature for enzymes in the human body is around 37 degrees celsius.

german scientist schleidon and schwann ddeterminded that the basic unit of structure and function in living things are...

Answers

Schleiden and Schwann determined that the basic unit of structure and function in living things are cells. Schleiden and Schwann studied both plant and animal cells to find out the similarity and dissimilarity between them.

Cells was first discovered by Robert Hook in the corks of bottles. He found out that in corks there are small compartment like structures present, hence this is the first discovery of cell.

In the mid nineteenth century two German scientists studied cells of both plant and animal and came up with the famously known 'Cell Theory'.

They studied the cells and found out that animal cells differ from plants cell in various ways. The main difference is that plant cell contains cell wall and chloroplast whereas in animal cell, cell wall and chloroplast is absent.

The cell theory states that: -

All living organisms are composed of one or more cell.The cell is the basic unit of structure and organization of living organism. Cells arise from pre- existing cells.

For more details of cell theory refer to

  https://brainly.com/question/29091172

Although the scientific method is used by most of the sciences, it can also be applied to everyday situations. Which of the scenarios below would be an example of the scientific method at work?

Group of answer choices

An otherwise undamaged care does not reliably turn on when the key is placed in the ignition. A mechanic works to attempt to locate the problem

A medical patient is suffering from mysterious fainting spells. A medical team works to get the bottom of the problem - and identify the cause.

When you turn on your microwave and toaster at the same time the power goes out in the kitchen. The work of an electrician to diagnose and fix this problem.

Your cat keeps vomiting up a mysterious plant after visiting your back yard. What is the plant? Why does it make your cat vomit on your rug?!

Answers

Answer:

A medical patient is suffering from mysterious fainting spells. A medical team works to get the bottom of the problem - and identify the cause.

Explanation:

A medical patient is suffering from mysterious fainting spells. A medical team works to get to the bottom of the problem and identify the cause. So the correct option is B.

What is the scientific method?

The start of a scientific investigation is observation. This means anything that catches the attention of the scientist. For example, for a  cancer biologist, a certain kind of cancer might be an observation that can't be treated with chemotherapy and he would wonder why it is so.

For all the sciences, the core is a problem-solving approach which is called the scientific method. There are five basic steps in the scientific method. These are:

Observation of a phenomenonQuestioning the reason or cause for it.Hypothesizing or giving a testable explanationMaking a prediction based on the hypothesis.Testing the prediction.Using the results to develop new hypotheses or predictions.

Therefore, the correct option is B.

Read  more about scientific hypothesis, here

https://brainly.com/question/7508826

#SPJ2

Explain what happened to the spread of the infection as more individuals were vaccinated.

Answers

Answer: As a result of more people being vaccinated the spread of the infection slowed down.

1. The following gene sequence appears on one strand of a segment of DNA that is about to go
through DNA Replication. What code will DNA Polymerase build to make the complementary
strand?
TACGGCATATGCAAATGGCGAGCCTATATT

Answers

The DNA polymerase will build the complementary strand with the code: ATGCCGTATACGTTTACCGCTCGGATATA.

What is DNA replication?

DNA replication is a process by which a DNA molecule makes a copy of itself. During DNA replication, an enzyme called DNA polymerase reads the existing DNA strand and builds a new complementary strand by matching up the appropriate nucleotides.

To build the complementary strand of DNA, we need to use the base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G).

So, for each base in the original sequence, we will pair it with its complement:

Original strand: TACGGCATATGCAAATGGCGAGCCTATATTComplementary strand: ATGCCGTATACGTTTACCGCTCGGATATA

Learn more about DNA Replication here: https://brainly.com/question/21265857

#SPJ1

The complementary strand to the given sequence would be:

ATGCCGTATACGTTTACCGCTCGGATATAA

What is gene sequence?

A gene sequence is a specific sequence of nucleotides in DNA (or RNA) that encodes the genetic information for a particular trait, function or protein. Genes are the basic unit of heredity and are responsible for passing on traits from one generation to the next.

The complementary strand of DNA will have a sequence that pairs each nucleotide with its complementary base: adenine (A) with thymine (T), and cytosine (C) with guanine (G). Therefore, the complementary strand to the given sequence would be:

ATGCCGTATACGTTTACCGCTCGGATATAA

During DNA replication, DNA polymerase reads the existing strand from 3' to 5' and builds the complementary strand in the 5' to 3' direction. Therefore, the new strand would be synthesized by adding nucleotides in the following order:

ATA...CGT...TAA...CGC...TGG...ATA

Learn about complementary strand here https://brainly.com/question/1534778

#SPJ1

Biotic factors are the _____things in an environment? Multicellular, Eukaryotic, living or used to be living, Non living

Answers

Answer:

living

Explanation:

Biotic factors are the living parts of an ecosystem. Because of the way ecosystems work – as complex systems of competition and cooperation, where the action of every life form can effect all the others – any living thing within an ecosystem can be considered a biotic factor. Biotic factors such as soil bacteria, plant life, top predators, and polluters can all profoundly shape which organisms can live in an ecosystems and what survival strategies they use. Eukaryotic unicellular living beings Living beings that are made up of one single eukaryotic

chromatin consists of . chromatin consists of . membrane wrapped around rna membrane wrapped around dna dna and protein rna and protein

Answers

Chromatin consists of DNA and protein.

What is DNA?

DNA is a genetic component of a cell that contains the instructions needed for an organism to develop and perform its functions. With the usage of DNA molecules, this knowledge is passed down from one generation to the next.

What is protein ?

An amino acid-based compound. The body cannot function correctly without proteins. They serve as the building blocks for various chemicals like enzymes, cytokines, and antibodies as well as for body tissues like skin and hair.

Therefore, Chromatin consists of DNA and protein.

Learn more about DNA from the given link.

https://brainly.com/question/2131506

#SPJ1

similar between skin cell and fat cell​

Answers

Answer:

Initial Vision Step Location

Dipin Ghimire

1. Where does the initial step in vision occur? Optic nerve Ganglion cell Retina OVisual cortex

The initial step in vision occurs in the retina, which is a layer of tissue at the back of the eye that contains light-sensitive cells called photoreceptors. When light enters the eye, it is absorbed by the photoreceptors, which convert it into electrical signals. These signals are then transmitted to other cells in the retina, such as ganglion cells, which transmit the signals to the brain via the optic nerve. The visual cortex, which is located in the brain, processes these signals to create the visual images that we see.

Dipin Ghimire

similar between skin cell and fat cell

Both skin cells and fat cells are types of cells that are found in the human body. Some of the similarities between these two types of cells include:

Both skin cells and fat cells are made up of cell membranes, cytoplasm, and nuclei.

Both types of cells contain organelles such as mitochondria, ribosomes, and endoplasmic reticulum.

Both skin cells and fat cells are capable of dividing and reproducing to maintain the integrity and function of the tissues in which they are found.

Both skin cells and fat cells are essential for the proper functioning of the body and play important roles in maintaining health and well-being.

Look at the incomplete equation below. What does Ek represent?

Answers

In the given equation, Ek represents the kinetic energy of an object.

Kinetic energy (Ek) is a form of energy associated with the motion of an object. It is dependent on both the mass (m) and the velocity (v) of the object.

The equation Ek = (1/2)m\(v^2\) represents the formula to calculate the kinetic energy of an object.

The symbol "Ek" is commonly used to represent kinetic energy in scientific calculations and equations. By plugging in the values of mass and velocity into the equation, one can calculate the amount of kinetic energy possessed by the object.

The kinetic energy of an object increases with both its mass and velocity. As the mass increases, the object has more particles in motion, contributing to higher kinetic energy.

Similarly, as the velocity increases, the speed at which the object moves also increases, resulting in greater kinetic energy.

Therefore, understanding and calculating kinetic energy is important in various scientific and engineering applications, such as studying the movement of objects, analyzing collisions, or designing efficient systems.

For more such answers on kinetic energy

https://brainly.com/question/15438905

#SPJ8

Question

Look at the incomplete equation below. What does Ek represent?

Ek =----- x m x v2

why bone grow in bidirectional ​

Answers

Explanation:

Bones grow in different directions because they need to support the body in different ways. The different directions allow for flexibility and strength.

A farmer decides to test whether or not a fertilizer will make her crops grow bigger. In year 1, she plants corn in two different fields on her property and fertilizes one and not the other. She measures the height of 10 corn plants in meters from each field. She takes her measurements every week for three months. In year 2, she puts irrigation in one of the fields and conducts the same experiment.

Required:
a. What is the independent variable and the treatments (increments) used in the experiment?
b. What is the dependent variable and the units in which it was measured?
c. Name at least two controlled variables:
d. What is the hypothesis?
e. Identify two sources of error in the first year in the experiment:
f. Identify two sources of error in the second year in the experiment:

Answers

Answer:

a. independent variable: the fertilizer.

   treatments: the use of fertilizer in one of the fields.

b. dependent variable: the crop growth in height.

   units: meters

c. two controlled variables: soil pH / solar-radiation exposure, and water supply  

d. hypothesis: the fertilizer makes the crops grow bigger.

e. two sources of error in the first year:

the researcher might plant the two crops under different conditionstake wrong measures of the height of the corns

f. two sources of error in the second year:

she can fail in irrigating the crops climatic and environmental conditions might change and have different consequences on each of the fields (this source affects the results influencing the growth of the plants).  

Explanation:

Independent (manipulated) variable: Refers to all the variables in an experiment that provoke a response in another variable. An independent variable is the one that changes or is controlled and modified in the experiment to analyze how another variable responds to it. These changes allow analyzing its effects on the dependent variable. Usually, the independent variable is represented by the X letter. In the exposed example, the fertilizer is the independent variable.    Treatments: Refers to the experimental procedure applied in the experimental group. In this example, the use of fertilizer is the treatment. Here the experimental group (the one that receives the experimental procedure, with changes in the independent variable) is the fertilized field. Data from the experimental group is compared with the data from the control group, to analyze the effects of the fertilizer.Dependent variable: The values of these variables respond to any change in the independent variable. It represents the quantity of something. The change in the dependent variable might be proportional or inversely proportional to the change in the manipulated variable. It is usually identified by the letter Y. In the exposed example, the crop growth rate in height is the dependent variable, that depends on the fertilizer used in that field. The units in which the crop is measured are meters in height.        Controlled variable: Refers to those variables equally applied to every group or subject in an experiment and have no influence on the results. These variables do not affect the change in the dependent variable values. In the exposed example, soil pH and solar-radiation exposure can be two controlled variables, as they must be equal for both fields. Water supply by irrigation ducts during the second year in both fields is also a controlled variable.     Hypothesis: A hypothesis is a possible answer for a question, a speculation that is not verified yet and requires corroboration. A hypothesis must express what is expected to occur in a perfectly comprehensive manner. It must be objective and directly related to variables. In this example, the hypothesis might be that the fertilizer makes the crops grow bigger.          Errors: These are the differences between the observed data or taken values and what is really happening in nature, which can lead to a misinterpretation of what is actually going on. These errors might be systematic mistakes performed by the researcher when measuring, taking data, applying the treatment, etc. Or they might be due to random errors, which are due to failures in the instrumentals, changes in the environment,  a single mistake of the researcher while taking measures, among others. During the first year, the researcher might plant the two crops under different conditions (parcels with different slopes which affect solar-radiation) or might commit a mistake while applying the fertilizer (different concentrations for example), or might take wrong measures of the height of the corns. During the second year, she can fail in irrigating the crops correctly, providing more water to one of the fields.  She can commit the same measuring mistakes. Or even climatic and environmental conditions might change and have different consequences on each of the fields.        

Rinderpest (a virus) has high mortality in wildebeest (a kind of herbivore), especially in young animals. From the early 1960s, after the elimination of a virus called rinderpest, the wildebeest population has increased dramatically from 1958 to 1978. The elimination of rinderpest impacted the wildebeest population. What type of factor is rinderpest

Answers

Answer:

density-dependent, top-down factor

Explanation:

In biology, limiting factors are resources and other conditions in the environment whose presence/availability limit the population growth rate. Density-dependent factors refer to the conditions whose effects on the size/growth of the population vary depending on the population density. Some examples of density-dependent factors include diseases, competition, and predation, etc. These factors can exhibit a positive or negative correlation with the population size. Moreover, bottom-up population control (species limitation by resources) refers to limitations placed by resources allowing growth (e.g.,  food source or habitat), while top-down population control (limitation by enemies), refers to limitations placed by factors that control the death rate in the population (e.g., predation or diseases).

i don’t understand this assignment, please hell

i dont understand this assignment, please hell

Answers

The hormone calcitonin, which is produced by the thyroid gland, helps to regulate the concentration of calcium ions in the blood by decreasing it.

Calcitonin acts on the bones by decreasing the activity of osteoclasts, cells that break down bone tissue and release calcium into the bloodstream.

As a result, less calcium is released into the bloodstream from the bones, leading to a decrease in blood calcium concentration.

This is important for maintaining homeostasis and preventing hypercalcemia, which can lead to various health problems such as kidney stones, bone pain, and muscle weakness.

To know more about hypercalcemia, visit :

https://brainly.com/question/13061032

#SPJ1

The illustration represents particles moving through a cell membrane. What image represents active transport?

The illustration represents particles moving through a cell membrane. What image represents active transport?

Answers

Answer:

According to the illustration of transmembrane transport mechanisms, the one representing an active transport mechanism is labeled with the letter C.

Explanation:

The semipermeable nature of the cell membrane causes the passage of necessary substances from the cell to pass through various transmembrane transport mechanisms.

In the illustration, active transport is labeled with the letter C, which can be stated because:

The passage of particles is against the concentration gradient. It requires energy to take place.

The type of transport in the illustration corresponds to primary active transport.

Answer:

C.

Explanation:

transmembrane transport mechanisms.

How do plant cells differ from animal cells

Answers

Answer: Plant cells have chlorophyll, chloroplasts, cell walls, a more blocky shape, and larger vacuoles. Animal cells have a more rounder shape, no cell wall but only a cell membrane, smaller vacuoles, and other organelles such has centrosomes, which plant cells don’t have.

Explanation:

Answer:

Plant and animal cells are  different in that plant cells have chloroplasts and rigid cell walls, while animal cells do not.

which cell organelles composed of a series of channels throughout the cytoplasm that functions in thranport of molecules

Answers

The cell organelles composed of a series of channels throughout the cytoplasm that function in the transport of molecules are called the endoplasmic reticulum (ER).

The ER is an extensive network of membranous tubules and sacs that are interconnected, forming a complex structure within the cytoplasm of eukaryotic cells.There are two types of endoplasmic reticulum: the rough endoplasmic reticulum (RER) and the smooth endoplasmic reticulum (SER). The RER is characterized by the presence of ribosomes on its surface, giving it a rough appearance. These ribosomes are involved in protein synthesis, and as the newly synthesized proteins enter the lumen of the RER, they are transported through the ER channels.The SER, on the other hand, lacks ribosomes and appears smooth. It plays a role in various cellular processes, including lipid metabolism, detoxification of drugs and toxins, and the storage and release of calcium ions.Both the RER and SER are involved in the transport of molecules within the cell. They provide a large surface area for the synthesis, modification, and transport of proteins and lipids. The channels and membranes of the ER allow for the efficient movement of molecules, including proteins, lipids, and ions, throughout the cytoplasm and to other cellular compartments.

In summary, the endoplasmic reticulum is the cell organelle composed of a series of channels throughout the cytoplasm that facilitates the transport of molecules, enabling the efficient distribution of proteins, lipids, and other substances within the cell.

for more such questions on  organelles

https://brainly.com/question/16601148

#SPJ11

What is role of science in the field of medicine and agriculture?​

Answers

Agricultural sciences, sciences dealing with food and fibre production and processing. They include the technologies of soil cultivation, crop cultivation and harvesting, animal production, and the processing of plant and animal products for human consumption and use.

differentiate between transpiration, exaporation and evapotranspiration​

Answers

Transpiration refers to the process of water loss through the stomata of plants, evaporation is the process of a liquid turning into a gas, while evapotranspiration is the combination of both transpiration and evaporation and refers to the total water loss from a surface.

What is Transpiration?

Transpiration is the process by which water is lost from a plant through small pores called stomata. This water loss can occur through evaporation from the surface of the leaves or stems and serves to regulate the temperature of the plant and maintain water balance.

Transpiration also plays a crucial role in the movement of water and nutrients from the roots to the leaves. It is an important aspect of the water cycle and helps to redistribute water and minerals throughout the plant.

Learn more about transpiration, here:

https://brainly.com/question/28416606

#SPJ9

List three ways to keep the environment clean

Answers

Reduce, reuse, recycle

Reduce: Use plastic less
Reuse: Reuse plastic bags and paper bags when going to the store
Recycle: Recycle food, garbage, and paper into different containers

In the pillbug experiment, how many pill bugs did you need

Answers

10 pillbugs were needed in the Pillbug experiment to get good information. Thus, option (c) is the correct answer.

Pillbugs are categorized as terrestrial isopods and are in the crustacea family. Pill bugs are simple to acquire, to maintain, odourless and easy to handle. They make the perfect experimental subject.

The Pillbug experiment by McGraw Hill aims to understand how pillbugs behave in both damp and dry settings. The study is conducted by watching their behavior, taking into account how often they circle and spin.

The purpose of the Pillbug experiment is to determine if pillbugs, often known as roly-polys, prefer light or darkness. They are cold-blooded, slow-moving organisms whose surroundings regulate their body temperatures.

The complete question is:

In the Pillbug experiment, how many Pillbugs did you need to use to get good information for the experiment?

A. 100

B. 1

C. 10

D. 4

E. 5

Learn more about the Pillbug experiment here:

https://brainly.com/question/28072865

#SPJ9

Which of the following is an environmental cost of commercial agriculture? A. Overconsumption of water B. Efficient milk production C. Crop rotation D. Primary food crops​

Answers

Answer: A. overconsumption of water

Explanation:

Every other answer is a a positive

Which statements accurately describe animals? Check all that apply.
-All animals are prokaryotes.
-All animals are multicellular.
-All animal have cells that contain a nucleus and organelles.
-All animals are capable of asexual reproduction
-All animals must maintain stable internal conditions.
-All animals stay in one place throughout their lifetime.
-All animals make their own food.

Answers

All animals are multicellular.

All animal have cells that contain a nucleus and organelles. These two are the correct statements.

Animals have a huge variety of characteristics that set them apart from species in other kingdoms, despite the fact that they all belong to the animal kingdom. The vast majority of animals have specialized tissues, and all animals are eukaryotic, multicellular organisms. The majority of animals are mobile, at least at some points in their lives. Animals need nourishment in order to thrive and grow. Every animal is heterotrophic, meaning they consume both live and dead organic stuff. They differ from autotrophic creatures like most plants, which produce their own nutrition through photosynthesis, and from fungi, which externally digest their food, in that they receive energy in this manner. Animals can be parasitic, herbivorous, carnivorous, or omnivorous.Most animals reproduce sexually, and unlike plants, the young go through a sequence of developmental stages that shape their body plans.

Therefore, all animals are multicellular and have cell organelles.

Learn more about animal kingdom:

https://brainly.com/question/18437205

#SPJ9

Will give you brainliest ASAP
question 1
Question
How does diffusion help a cell maintain homeostasis?
Responses

A It lets the cell know when it needs to produce more energy.


B It helps the cell expel excess waste.

C .It helps the cell obtain and break down food for energy.

D It helps maintain an equilibrium of particles inside and outside a cell.

Answers

the answer is A. have a good day

Answer:

D It helps maintain an equilibrium of particles inside and outside a cell.

Explanation:

Have good day

Saprolegnia, a parasitic water mold, parasitizes dying or dead
-blank1 - and has a cell wall composed of -blank2 -, unlike the true fungi, which have cell walls composed of -blank3 -

Answers

Answer:

Saprolegnia parasitizes dying or dead fish, and has a cell wall composed of chitin, unlike the true fungi, which have cell walls composed of cellulose.

Maria decides to take shorter showers to help conserve water. What is she doing?
1. recycling
2. rethinking
3. reducing
4. reusing

Answers

reducing! She is reducing the amount of water she uses

Answer:  Maria is reducing the amount of water she uses by taking shorter showers. Therefore, the correct answer is 3. reducing.

Recycling is the process of converting waste materials into new materials and objects. Rethinking involves considering different approaches to a problem or situation. Reusing involves using an item multiple times instead of throwing it away after one use.

Explanation:

New forms of drug-resistant bacteria can evolve quickly because

Answers

Answer:

The correct answer is - when a drug kills most of the bacteria, the ones left to breed are those that have a natural resistance to the drug.

Explanation:

When a drug or antibacterial medication used on the colony of a bacteria, the drug kills most of the specific bacteria from the host or culture, however, some bacteria remain to breed the next generation of bacteria as they had resistance to the particular drug.

The left bacteria breed and produce more resistant bacteria and after a few generations, a new form of drug-resistant bacteria develops. This follows the natural selection process and adapting the beneficial characteristic.


Which event is responsible for the genetic variation seen from meiosis?
1
Homologous chromosomes exchange RNA with one another.
Sister chromatids exchange ribosomes with one another.
Homologous chromosomes exchange DNA with one another.
Sister chromatids exchange amino acids with one another.

Answers

Answer:

Homologous chromosomes exchange DNA with one another.

Explanation:

During crossing over, the two Homologous chromosomes line up next to eachother and the DNA "crosses over" changing the genes on the chromosome.

Patrick is a 16 year old boy whose body has stopped producing osteoclasts. What does this mean for his bones? What other parts of his body will be affected by this?

Answers

This means for his bones that his bones will become weak and brittle. Other parts of his body like the hip, wrist, and spine will be affected by this.

Osteoclasts weaken brittle bones, making them prone to breaking from even minor stresses like coughing or stooping. The most frequent locations for fractures caused by osteoclasts are the hip, wrist, or spine. Bone is a living tissue that constantly degrades and is replaced.

By increasing their resorptive activity and destroying bone to initiate normal bone repair, the cells known as osteoclasts mediate bone loss in pathologic circumstances. They develop from progenitors of the myeloid/monocyte lineage that circulate in the bloodstream after maturing in the bone marrow.

Osteoblasts create bone; osteocytes mature it, and osteoclasts degrade and reabsorb it.

To learn more about Osteoclasts visit: https://brainly.com/question/7448253

#SPJ9


Which face of the mountain is typically warmer?
East or West

Answers

This is often the eastern side of the mountain range because prevailing winds in the mid-latitudes blow from the west, but that is not necessarily always the case. In contrast to the moist windward side of a mountain, the leeward side typically has a dry, warm climate.

Answer:

west

Explanation:

In temperate regions mountain slopes facing the Equator—southward in the Northern Hemisphere and northward in the Southern Hemisphere—are significantly warmer than opposite slopes.

Other Questions
Early signs and symptoms of hypoperfusion can include As of a certain date, there had been a total of 13,974 performances of two shows on Broadway, with 2480 more performances of Show A than Show B. How many performances were there of each show? Do You Understand?1. For 0.25 +1.037, why do you line upthe decimal point instead of lining upthe 7 and the 5? Blank are things you can see and touch, they are products that you can purchase to meet needs and wants who were the presidential candidates of the democratic and republican parties in the presidential election of 2000? how did they differ on the issues of abortion and tax cuts? what right does the Florida constitution have that the US doesn't have which has been a big issue? Please Help Tiffany bought 2 hotdogs, 2 sodas and 2 hats at the baseball game. The hotdogs cost $1.10 each, the sodas cost $2.25 a piece and the hats were each $5.05. If she paid with a twenty dollar bill, how much change should she get back? Lucy had $72, which is nine times as much money as Xavier had. How much money did Xavier have? Select the correct solution method below, representing Xavier's money with x. O A. = 72. Multiply both sides by 9. Xavier had $648. B. x+ 9 = 72. Subtract 9 from both sides. Xavier had $63. O C. x-9 = 72. Add 9 to both sides. Xavier had $81. D. 9x = 72. Divide both sides by 9. Xavier had $8. "Dependency" for peripheral countries means that they are dependent on core countries for all of the following EXCEPT:A. demandB. laborC. investmentD. technologyE. imports Buying art supplies. Isabella is an artist who normally purchases her spray fixative in 6 2/3 ounce cans. If the economy size contains 1 2/5 as much spray, how many ounces will it contain? Simplify the expression 5x[(3.14+4.16)x9+2] Identify the percent of change from 2/5 to 1/3 as an increase or a decrease. Can someone help please 19c) find the area of the shaded polygons in rsm with 5 and 7 measurs given blue shape we real cool... which of the following identifies the central theme of the poem Problem 7Anita jogs at a constant speed of 4 miles per hour. Anita's brother leaves their house 12 minutes afterher, and he catches up to her 24 minutes later. If Anita's brother is also running at a constant rate, what ishis speed, in miles per hour? The vertical gaze center contains premotor neurons that project to lower motor neurons and interneurons in the abducens nucleus. True False Angad, Caroline and Sarah share some sweets in the ratio 7:4:3. Angad gets 52 more sweets than Sarah. How many sweets does Caroline get? Im The lottery What are the attitudes of the characters toward the ceremony What is a Shariah law in the Middle East today(2021)?Please help me!! I will give you Brainliest:]