during the late middle ages, how did the church believe music should be performed during religious services?

Answers

Answer 1

During the Late Middle Ages, the Catholic Church believed that music during religious services should be performed in a solemn and dignified manner, with the primary purpose being to elevate the worshipers' minds to God.

The preferred musical style was Gregorian chant, which was monophonic and sung in Latin by choirs of men and boys. This type of music was considered sacred and was used exclusively for religious purposes. The Church discouraged the use of instruments and secular elements in worship music, as they were seen as distractions from the pure, spiritual essence of the liturgy. Overall, the Church emphasized the role of music as a tool for devotion, rather than entertainment, and believed that it should be performed with reverence and piety.

Learn more about spiritual :

https://brainly.com/question/28385558

#SPJ4


Related Questions

An artist becomes so enamored with his work that he forgets how much time he spends painting. What is this an example of

Answers

Answer:

consumed in work

Explanation:

If you are consumedwith a feeling or idea, it affects you very strongly indeed.

hair, little shop of horrors, tommy, jesus christ superstar and godspell are considered what type of musical?

Answers

The musicals "Hair," "Little Shop of Horrors," "Tommy," "Jesus Christ Superstar," and "Godspell" are considered rock musicals.

Rock musicals emerged in the late 1960s and early 1970s, combining elements of traditional musical theater with rock music styles and themes. These musicals often feature a contemporary and rebellious tone, exploring social issues, counterculture movements, and religious themes through the lens of rock music.

They utilize electric guitars, drums, and other rock instruments to create a vibrant and energetic sound. The infusion of rock music into the theatrical format brought a new level of excitement and relatability, appealing to a younger audience and influencing the evolution of musical theater.

Learn more about  rock musicals.

https://brainly.com/question/30890252

#SPJ4

Smooth value gradations can be achieved by varying the amount of pressure applied to the medium or by employing the use of a blending tool. What method is used to create this approach?

Answers

The combination of pressure variation and blending tools enables artists to create smooth value gradations, adding depth, dimension, and realism to their artwork.

The method used to create smooth value gradations in traditional art mediums, such as pencils, charcoal, or pastels, typically involves a combination of techniques. One commonly used approach is to vary the amount of pressure applied to the medium. By exerting more pressure, artists can create darker and more intense tones, while lighter pressure results in softer and lighter shades. This technique allows for a gradual transition between different values, resulting in smooth gradations.

Another method employed to achieve smooth value gradations is the use of a blending tool. Blending tools, such as blending stumps, tortillons, or even fingers, are used to gently smudge and merge the colors or tones together. By carefully blending adjacent areas, artists can create seamless transitions between different values, thereby achieving smooth gradations.

Both the pressure variation and blending techniques require skill and practice to master. Artists often experiment with different levels of pressure, strokes, and blending tools to achieve the desired effects in their artwork. Additionally, the choice of medium itself, such as soft or hard pencils, can also impact the ease of creating smooth gradations.

Learn more about gradations here:

https://brainly.com/question/32137225

#SPJ11

hi, if anyones seen 3ebush, PLEASE let me know.

Answers

Answer:

got it

Explanation:

Handel lived in_________for three years, making important professional connections that eventually led to his appointment as musical director to the Electoral Court of Hanover, Germany.

Answers

In order to provide Italian opera to the English nobles, Handel founded three commercial opera companies. He experienced a mental breakdown in 1737, changed his creative course, targeted the middle class, and switched to English choral compositions.

He never again wrote an Italian opera following the popularity of Messiah (1742). His symphonic compositions Water Music and Music for the Royal Fireworks are enduring favorites. Since 1727, every British coronation has featured a performance of Zadok the Priest, one of his four coronation anthems. He passed away in 1759, was wealthy and well-respected, and received a state funeral at Westminster Abbey despite being nearly blind. He is best known for his operas, oratorios, anthems, concerti grossi, and organ concertos. Before moving in London in 1712, where he spent the most of his career and became a naturalized British national in 1727, Handel obtained his musical instruction in Halle and worked as a composer in Hamburg and Italy. Both the Italian Baroque composers and the middle-German polyphonic choral tradition had a significant impact on him. In turn, Handel's compositions represent one of the pinnacles of the "high baroque" movement, advancing the art forms of English oratorio and organ concerto as well as bringing Italian opera to its pinnacle of development.

learn more about  professional connections here :

https://brainly.com/question/12970668

#SPJ4

how do i make my pictures look 3D

Answers

Answer:

Add some shading, as well as darker pigments in certain areas. Doing these will make your drawings come to life and look 3D!

Answer:

Shading, lighting, pigments, and even exploring different shapes will make your art look more 3D and really come to life.

Explanation:

When thinking about lighting, shading, and darkening the pigments, try to think about here the light is coming from in a picture and the way the light is (i.e. Fire, fluorescent lights, sun, moon, etc.)

When coming from fire, the light may seem to dance.

As well as when coming from the moon and sun, Are there any tree limbs or other outside objects creating a shadow?

Thinking about these questions as you are planning or creating your art may be helpful for you.

Hope this helps :P

Could you possibly mark me brainliest? I need the points T-T

what two famous visual artists also worked for this ballet company as set designers? group of answer choices henri matisse

Answers

Two famous visual artists who also worked for the Ballets Russes as set designers were Pablo Picasso and Henri Matisse.

Both artists were part of the avant-garde art scene in Paris during the early 20th century, and their innovative and experimental styles made them natural choices for the innovative Ballets Russes productions.

Picasso worked on several productions for the Ballets Russes, including "Parade" and "Pulcinella," creating sets and costumes that were inspired by his own cubist style. Matisse worked on several productions as well, including "Le Chant du Rossignol" and "The Rite of Spring," creating colorful and vibrant sets and costumes that reflected his interest in fauvism and decorative art.

Their collaborations with the Ballets Russes were groundbreaking and helped to establish a new aesthetic for ballet productions, one that blended the worlds of dance and visual art in exciting and innovative ways.

Learn more about Henri Matisse.

https://brainly.com/question/27106030

#SPJ4

Full Question: what two famous visual artists also worked for this ballet company as set designers?

2. What influences what we know about ancient art? How is our knowledge of ancient art similar to or different from our knowledge of prehistoric art?

Answers

Answer:

Our knowledge about ancient art is deeply influenced by our readings about the theme, our researches, the authors we know who wrote something about it, but I think that the most preeminent influence is our own understanding of art. It's almost impossible to be free from preconceptions when we are separated about 4000 years of this art.

Explanation:

Perspective and history or what we think went down probably influences ancient art

what grit of nail file is used to remove excess artificial nail product?

Answers

It is typical to use a grit of 100 or higher to remove extra artificial nail product. This is regarded as having a coarse grit that works well to remove product buildup without harming the natural nail.

What is the purpose of a 240 grit nail file?

240 grit. This file, which has the least corrosive grit of any on the market, is typically used to prepare nails for UV gel lacquer. Remove any sharp edges from a new file by running it edge to edge with an older file before using it.

What is the purpose of a 180 grit nail file?

For shaping extensions with a medium thickness, such as the majority of tips and wraps, and for shaping the free edge of toenails, medium files (180 grit) work best. Good files (240-600 grit).

To know more about natural visit:-

https://brainly.com/question/24232947

#SPJ1

Final answer:

A rougher nail file of 80-120 grit is used to remove excess artificial nail product. The 80/80 grit file can be used for quick removal of a lot of product while more precision can be achieved with 100 or 150 grit files.

Explanation:

The grit number of a nail file indicates its coarseness or grain size. When it comes to removing excess artificial nail product a rougher file is typically used. Specifically, 80-120 grit is useful for this purpose. The 80/80 grit file, for instance, is quite coarse and ideal to quickly remove a lot of product. If you need more precision, you might use a 100 grit or 150 grit file. Remember, too coarse a file can damage the nail and too fine may not be effective.

Learn more about Nail file grit for artificial nails here:

https://brainly.com/question/31933888

the concept of separation of powers​

Answers

answer : basically means that you are stripped of your powers as a person
explanation:
Separation of powers refers to the division of responsibilities into different branches. It limits one branch from overpowering another. Its intent is to prevent overpowering and providing balance.

discuss the 3 main properties of color. how do you think an artist can change the feel of their art by using these 3 properties? << read less

Answers

The three main properties of color are hue, value, and saturation.

Hue refers to the specific color or wavelength of light, such as red, blue, or green. Artists can evoke different emotions and create different moods by selecting specific hues. Warm colors like red and orange can convey energy and excitement, while cool colors like blue and green can evoke calmness or serenity. By manipulating the hue, artists can influence the overall feel of their artwork.

Value refers to the lightness or darkness of a color. Artists can create contrast and depth by adjusting the value of colors. Lighter values can convey a sense of brightness or expansiveness, while darker values can create a mood of mystery or depth. By playing with value, artists can manipulate the perception of light and shadow, adding dimension to their artwork and altering its overall atmosphere.

To know more about artwork visit-

brainly.com/question/30662666

#SPJ11

hi ppl. Answer this correctly Landscape/seascape art can only be of an actual place, not a fictional one.
True
False

Answers

Answer:

True

Explanation:

Answer:

true?

Explanation:

Josef is interested in the sociological evolution of the continent of Africa from pre- to post-colonial eras. Why would an examination of African cinema be a good place to start?

Cinema always represents the evolution of society.

African cinema is rarely seen and has won few awards, so it will be new information.

The Pan African Federation of Filmmakers encourages an exploration of colonialism.

It wouldn’t be; Africa has little moviemaking history.

Answers

Josef is interested in the sociological evolution of the continent of Africa from the pre- to post-colonial eras. An examination of African cinema be a good place to start because "Cinema always represents the evolution of society." (Option A).

What is sociological evolution?

Sociocultural evolution, sociocultural evolutionism, and social evolution are sociobiological and cultural evolution theories that describe how societies and cultures develop through time.

Sociocultural evolution is the gradual transformation of cultures and communities over time. Sociobiology is the study of social behavior in terms of evolution.

Cultural evolution is a hypothesis of societal transformation that evolved over time. The evolution of eusociality, or extremely cooperative behaviors in animal species.

Learn more about sociological evolution:

https://brainly.com/question/15713086

#SPJ1

What is the difference between song of the year and record?

Answers

Answer:

Song of the Year honors the songwriters while Record of the Year honors the artists, producers, and sound engineers.

Explanation:

Song of the Year deals with the composition of the song.

Record of the Year deals with one specific recording of a song.

When using the compositional element "Foreground, Middle Ground and background" which area should be in focus? (PHOTOGRAPHY)

Answers

Answer:

I think its C

Explanation:

I think its important to capture all compositional elements so i think all of them should be in focus.

True or false: Handel's oratorios were musical works based on religious stories to be played in church

Answers

Answer: The answer is false.

Explanation:

Handel’s oratorios were not bored on religious stories.

⚠️⚠️Can someone tell me the order of the notes ? The first line ⚠️⚠️


ex:
A F# C D but of course this time it’s on the E strings

Can someone tell me the order of the notes ? The first line ex:A F# C D but of course this time its on

Answers

If it's treble clef, then its: EGFA GBAF (repeat)

Type the correct answer in the box. Spell all words correctly.

Which term refers to your core beliefs about good behavior and morality?

______are your core beliefs about good behavior and morality.

Answers

Answer:

Morals

Explanation:

"Values" are your core beliefs about good behavior and morality.

What are core beliefs?

Core beliefs refer to the fundamental and deeply held beliefs that individuals have about themselves, others, and the world around them. These beliefs often develop early in life and are shaped by a person's experiences, upbringing, culture, and personal values.

Core beliefs are often subconscious and can be difficult to identify, but they influence how a person perceives and interprets their experiences, as well as how they behave and interact with others.

Positive core beliefs can lead to healthy self-esteem, resilience, and adaptive coping strategies, while negative core beliefs can result in low self-worth, anxiety, and maladaptive behaviors.

Identifying and challenging negative core beliefs through therapy or other self-help techniques can be an important part of personal growth and can lead to more positive outcomes and greater well-being.

Learn more about core beliefs here:

https://brainly.com/question/31459558

#SPJ2

What lookup function should be used to search for values in a specific row of a table and return values from adjacent rows?
HLOOKUP
VLOOKUP
MAXLOOKUP
TABLOOKUP

Answers

Answer:

I Believe it HLOOKUP

Explanation:

Rows are horizontal, and the h in HLOOKUP means horizontal.

(Hope this is right)

The HLOOKUP function should be used to search for values in a specific row of a table and return values from adjacent rows. Thus option (A) is correct.

What are values?

The values are the fundamental beliefs that govern a person's lives. It is like a guidance of how a person behaves. They inspire a person how to act and speak. They guide the  decisions about everything from career to personal growth.

They embody the person we want to be, influencing how we treat others and how we interact with the world. To state it plainly, values are the core of who we are.  the values deeply affect our personal relationships and behavior.

There are two types of values: personal values (These are our own beliefs about right and wrong) and cultural values ( These are those that are accepted by the societies we grow up in).

Learn more about values here:

https://brainly.com/question/14965690

#SPJ2

What is the best type of music? Why?
Rock
Jazz
Hip-Hop
Rap
Pop
Country
R&B
Classical
Latin
K-Pop
EDM
I probably missed a bunch soooo OTHER is also a choice :)

Thanks!

Answers

Answer:

Rap and Country

Explanation:

Rap cuz i love the bass in your truck!!!!!!!!!!!!

Country cuz our song !!!!!

<3 (:

r&b because it has an calming affect which instils an array of varied feelings within us.

What's an anime I should watch that most people don't watch

What's an anime I should watch that most people don't watch

Answers

Answer:

indie anime’s, try to go to sites of other country’ pop stuff, i think you will found something..

Explanation:

Answer:

kakegurui

Explanation:

What are the major functions of a speech conclusion?

Answers

The speech conclusion serves several important functions. Here are some of the major functions of a speech conclusion: Summarizing main points, Providing closure, and Emphasizing the main message.

The speaker can summarise the key points and arguments made during the speech in the conclusion. It offers a succinct synthesis of the important ideas, helping the audience to remember the main argument. The speech's conclusion announces its finish and gives the audience a sense of finality.

The speaker has the chance to restate and emphasize the main points of the speech toward the conclusion. The ending reinforces the major subject and makes sure that it resonates with the audience by restating the main idea or important takeaways.

Learn more about speech:

brainly.com/question/30335830

#SPJ4

what time does foot locker announce raffle winners

Answers

Answer:

3pm to 6pm local time

Explanation:

From 3 pm to 6 pm, local time Foot Locker announces the raffle winners.

What is a Foot Locker?

Foot Locker Retail, Inc. is an American sportswear and footwear retailer, with its headquarters in Midtown Manhattan, New York City, and operating in 28 countries. It was established in 1974, and founded as a separate company in 1988, however Foot Locker's roots date to 1879, as it is a successor corporation to the F. W. Woolworth Company Woolworth, as many of its freestanding stores were Kinney Shoes and Woolworth's locations.

The company operates the eponymous Foot Locker chain of athletic footwear retail outlets along with Kids Foot Locker and Lady Foot Locker stores, and other athletic-based divisions including Champs Sports, Footaction USA, House of Hoops, and Eastbay/Footlocker.com, which owns the rights to Final-Score.

The company is also famous for its employees' uniforms at its flagship Foot Locker chain, resembling those of referees.

Learn more about locker, here:

https://brainly.com/question/16645025

#SPJ6

PLEASE PLEASEE HELP. Im giving out 25 points.
how can reviews help the restaurant owner use what was said in the reviews to inspire concrete changes in their restaurant?.
"The quality of the food was good."

"Service was excellent."

"The place was very very beautiful!!"

"Food price was kind of expensive, but after trying the food the only thought that rushed through my mind was that it was so worth it."

"The restaurant was spotless. I could even see the reflection of my face on the floor."

Answers

Reviews can help the restaurant owner use what was said in the reviews by bringing in more business. People read reviews and if they see positive reviews on a restaurant, that is most likely going to intrigue them to want to eat there. Hope this helped !!

(INTERIOR DESIGN CLASS) Use the internet to find a standard job application form. A search term such as “general job application form” should turn up many similar results. Then practice completing this form. What information did you already know? What information did you have to locate or think about? What could you do for the future to be better prepared to complete job applications?

Answers


When completing a job application form, it is important to read the instructions carefully and provide accurate and complete information. Some common information that job application forms require includes your personal information (name, address, phone number, email), education and work history, skills and qualifications, and references. You may also need to answer specific questions about your experience and why you are interested in the job.

While some of this information may already be familiar to you, such as your personal information and work history, you may need to locate or think about other information, such as specific dates of employment or contact information for references. It is a good idea to gather this information and have it on hand before starting to complete the job application form.

To be better prepared for future job applications, you can create a master resume or curriculum vitae (CV) that includes all of your relevant education, work experience, skills, and qualifications. This can serve as a reference when completing job application forms and can help ensure that you provide accurate and complete information. You can also prepare a list of references in advance and ask for their permission to use their contact information on job application forms.

Additionally, it is important to tailor your job application materials, including your resume and cover letter, to the specific job you are applying for. This means highlighting relevant skills and experience and customizing your application to match the requirements and qualifications listed in the job posting. By doing this, you can increase your chances of being selected for an interview and ultimately getting the job.

How to do the score sheet for volleyball?

Answers

Each squad makes use of a blanket, sheet, plastic sheet, or anything comparable. Teams start out by tossing and catching each other's balls in the blanket as they play with one ball apiece.

What do volleyball fouls mean?

Fouls. Failing to play as allowed by the regulations is referred to as a foul. When two opposing players break the rules at the same time, it is called a double foul. When a player makes numerous or successive illegal contacts, it is referred to as a double hit. When a player goes against the service counter or centerline limits, it is known as a foot fault.

How high is the volleyball court?

The play court, which really is 18 meters in length and 9 metres wide, is surrounded by a free environment that really is 3 metres wide. The area above the playing surface is referred to as the free performing space, and it is at least 7 metres high.

To know more about volleyball visit:

https://brainly.com/question/6943983

#SPJ4

Date, time, and venue of the game. Circle and complete the home team's name. HOME, circle the name of the visiting team. VISITOR.

Date, time, and venue of the game. Circle the names of the home team and the visiting squad, respectively. Have the officials in the penalty area tally the goalie's shots, SCORING - Referees are responsible for keeping track of all scoring and penalties. A game where two teams try to return a large, inflated ball before it hits the ground by bouncing it back and forth over a high net with their hands. A court is used for the game. You must send the ball over the net in order to plant it in your adversary's court. You must also prevent your adversary from trying the same thing. The squad has three hits (in total) for returning the ball.

Learn more about A game here:

https://brainly.com/question/30093972

#SPJ4

How will you tell your students the characteristics and elements of arts the best describe the arts of Romantic period?

Answers

Answer:

Term in use by the early 19th century to describe the movement in art and literature distinguished by a new interest in human psychology, expression of personal feeling and interest in the natural world.

Romantic art focused on:

- emotions

- feelings and moods ( spirituality, imagination, mystery, and fervor)

The subject matter varied widely including landscapes, religion, revolution, and peaceful beauty. The brushwork for romantic art became looser and less precise.

Explanation:

I hope it helps

Which of the following is a rich Italian-style vegetable soup?
A) chowder
B) minestrone
C) gumbo
D) bisque

Answers

B) Minestrone. Minestrone is a rich Italian-style vegetable soup.Minestrone is a classic Italian soup known for its hearty and flavorful combination of vegetables, beans, and sometimes pasta or rice.

It is a versatile soup that can vary in ingredients based on regional and seasonal preferences. Common ingredients found in minestrone include tomatoes, onions, carrots, celery, zucchini, beans (such as kidney beans or cannellini beans), and leafy greens like spinach or kale. The soup is typically simmered slowly to allow the flavors to meld together, resulting in a comforting and nourishing dish.

Minestrone is often served as a first course in Italian cuisine or as a main dish, accompanied by crusty bread. It is a popular choice during the colder months and is enjoyed for its heartiness and ability to showcase the flavors and textures of various vegetables. The beauty of minestrone lies in its adaptability, as cooks can incorporate seasonal produce or use ingredients on hand to create their own versions of this beloved Italian vegetable soup.

To learn more about Italian soup click here:

brainly.com/question/30375137

#SPJ11

2ways people use art and music in an art job

Answers

Answer:

Artists and musicians create works that not only unlock emotions, but also alter one's mood, trigger memories, and act as a source of comfort and inspiration. Visual art and music have numerous parallels because they share elements such as harmony, balance, rhythm, and repetition

Explanation:

I'll give brainliest if you help me!!
What is the first step that Marcus should take to calculate his overall percentage GPA for the year?
o add up all the points.
o divide the sum by the total number of points.
o round to the nearest tenth
o change the decimal into a percentage.
I need help asap!

I'll give brainliest if you help me!!What is the first step that Marcus should take to calculate his

Answers

Answer:

A:add up all the points

Explanation:

I took the test and sacrificed my grade for the answer

Answer:

Answer is A. :>

Explanation:

Other Questions
[-10-(6 - 14) + 16] Arlington Company is constructing a building. Construction began on January 1 and was completed on December 31. Expenditures were $6,400,000 on March 1, $5,280,000 on June 1, and $8,000,000 on December 31. Arlington Company borrowed $3,200,000 on January 1 on a 5-year, 12% note to help finance construction of the building. In addition, the company had outstanding all year a 10%, 3-year, $6,400,000 note payable and an 11%, 4-year, $12,000,000 note payable. What is the avoidable interest for Arlington Company? Which properties are necessary to claim that the two prisms are congruent? Check all that apply. Which of the following is a consequence of fertilizer runoff into the water supply?a.)The oxygen levels in the water supply increase.b.)Rainfall stops nitrogen from reaching a waterway.c.)There is a lack of nutrients in the soil.d.)An algal bloom contaminates the local water supply. This body region is protected by fatty acids, acidic pH, lactic acid, and a tough keratinized epithelial cell barrier with its own normal flora Group of answer choices urinary tract skin digestive tract respiratory tract Describe the importance of the narrator in understanding the thoughts of Father Wolf. Let n1=60, X1=10, n2=90, and X2=10. The estimated value of thestandard error for the difference between two populationproportions is0.06760.09230.01540.0656 To combat red-light-running crashes the phenomenon of a motorist entering an intersection after the traffic signal turns red and causing a crash many states are adopting photo-red enforcement programs. In these programs, red light cameras installed at dangerous intersections photograph the license plates of vehicles that run the red light. How effective are photo-red enforcement programs in reducing red-light-running crash incidents at intersections? The Virginia Department of Transportation (VDOT) conducted a comprehensive study of its newly adopted photo-red enforcement program and published the results in a report. In one portion of the study, the VDOT provided crash data both before and after installation of red light cameras at several intersections. The data (measured as the number of crashes caused by red light running per intersection per year) for 13 intersections in Fairfax County, Virginia, are given in the table. a. Analyze the data for the VDOT. What do you conclude? Use p-value for concluding over your results. (see Excel file VDOT.xlsx) b. Are the testing assumptions satisfied? Test is the differences (before vs after) are normally distributed. which was is not considered historical fiction? you are a teacher that is setting up a classroom library in your room with various genre including historical fiction. which was is not considered historical fiction? Concerning the slave trade and the abolition of slavery:1. How did the British North American colonies and the Spanish and Portuguese American colonies differ in the volume of the slave trade? 2. How did the British North American colonies and the Spanish and Portuguese American colonies differ in the timing of the slave trade and the abolition of slavery? 3-What were the consequences of the differences in the timing of the slave trade and the abolition of slavery for the survivability of African cultural patterns in the United States and in Brazil and the Caribbean? a refrigerator magnet has a magnetic field strength of 5 x 10^-3 T. what distance from a wire carrying Question 2 (1 point)During the third week of practice Ellison's cross country team ran 6 miles less than triple the number of miles they ran thefirst week. If they ran m miles in practice the first week, write an expression that represents the number of miles thatthe cross country team ran during the third week.a3-6m3m-6bC6-3mOd6m-3 Find m RSPlease please this is on my final ! When did the British East India Company established its first factory in Bengal Class 8? Suppose+an+exxon+corporation+bond+will+pay+$4,500+ten+years+from+now.+if+the+going+interest+rate+on+safe+10-year+bonds+is+5.60%,+how+much+is+the+bond+worth+today? Can someone plz help me? :( Which transportation form was the most important of the 1800s? a nurse is following safety principles to reduce the risk of needlestick injury. which actions will the nurse take? (select all that apply.) Question 2 which of the possible 2-mers has the highest value of totalDistance(v, DNA) from the DNA sequence ? actgatagaagctttctggctatca Answers:: a.CC b.ac c.tt d.gc solve for b12=b/3-8