Drag each label to the correct location on the image. Not all labels will be used. Classify the sides of the mountain range based on the direction of the prevailing winds. leeward side windward side lake-effect side​
NO LINKS
WILL MARK BRAINLIEST!

Drag Each Label To The Correct Location On The Image. Not All Labels Will Be Used. Classify The Sides

Answers

Answer 1

The direction of the prevailing winds from the mountain range is,

The left side of the mountain is the windward side,

The right side of the mountain is the leeward side,

The lake effect can be cold air moving over a body.

What is Orographic effect?

The process which explains the island's windward side and leeward side through the movement of winds through hills and mountains is known as Orographic effect.

Windward side:

The windward side of the mountain is the side which is facing the sea. This side acts as a natural barrier to produce the warm and moist air masses. So that they condensate receives a lot of precipitation. Because of that the windward side have much more vegetation.

Leeward side:

The leeward side is the side of the mountain that is on the opposite side of the sea. The leeward side is receiving very little precipitation, and usually it only gets downward and the wind was very dry. So that this side of the mountain looks much drier and having much less vegetation.

Lake effect side:

The lake effect occurs when you have cold air moving over a warm body of water. The lake effect will have a temperature difference between the air and body of water at around 850 milli-bars (about a mile above the surface) is more than 10 degrees Celsius.

So, The direction of the prevailing winds from the mountain range is,

The left side of the mountain is the windward side,The right side of the mountain is the leeward side,The lake effect can be cold air moving over a body.

Learn more about Orographic effect,

https://brainly.com/question/8912667

#SPJ2


Related Questions

If an object is placed at a distance of 12 cm from a convex lens of focal length 16 cm then calculate the image distance from the lens?

Answers

Answer:

-48cm

Explanation:

For a convex lens f is +ve and V is +ve

Using the formula 1/f=1/v+1/u

u=12cm and f=16cm

1/16-1/12=1/v

1/v=-1/48

v=-48cm

A wave traveling at 5.00x10^4 meters per second has a wavelength of 2.50x10^1 meters what is the frequency of the wave

Answers

Answer:

Frequency of the wave = 2 x 10³ hz

Explanation:

Given:

Velocity of wave = 5 x 10⁴

Wavelength = 2.5 x 10¹

Find:

Frequency of the wave

Computation:

Frequency of the wave = Velocity of wave / Wavelength

Frequency of the wave = [5 x 10⁴] / [2.5 x 10¹]

Frequency of the wave = 2 x 10³ hz

The frequency of a wave traveling at 5.00 x 10⁴ meters per second and a wavelength of 2.50x10¹ meters is 2 × 10³ Hz

HOW TO CALCULATE FREQUENCY:

The frequency of wave can be calculated by dividing the speed of the wave by its wavelength.

λ = v/f

Where,

V= velocity of the wavef = frequencyλ = wavelength

According to this question, a wave is traveling at 5.00 x 10⁴ m/s and has a wavelength of 2.50 x 10¹ meters. The frequency can be calculated as follows:

f = v ÷ λ

f = 5 × 10⁴ ÷ 2.5 × 10¹

f = 2 × 10³Hz

Therefore, the frequency of a wave traveling at 5.00 x 10⁴ meters per second and a wavelength of 2.50x10¹ meters is 2 × 10³Hz.

Learn more at: https://brainly.com/question/19601903?referrer=searchResults

Which would not describe a physical property of
a substance?
how it reacts with another substance
B how shiny it is
C what color it is
D its mass

Answers

Answer:

Explanation:

Out of the given options, A would not describe a physical property of a substance. How a substance reacts with another substance is a chemical property, whereas physical properties are intrinsic characteristics that can be observed or measured without changing the substance's identity. B, C, and D are examples of physical properties - shininess, color, and mass respectively.

A 12.0kg object is pushed with a horizontal force of 6.0N East across a table. If the force of
friction is 2.0N, what is the acceleration of the object?

Answers

Answer:

0.33m/\(s^{2}\) East.

Hope this helps you. Do mark me as brainliest.

Two sinusoidal waves have the same frequency and wavelength. The wavelength is 20 cm. The two waves travel from their respective sources and reach the same point in space at the same time, resulting in interference. One wave travels a larger distance than the other. For each of the possible values of that extra distance listed below, identify whether the extra distance results in maximum constructive interference, maximum destructive interference, or something in-between.
a. 10 cm - (A) in-between (2) maximum destructive (3) maximum constructive.
b. 15 cm - (A) in-between (2) maximum destructive (3) maximum constructive.
c. 20 cm - (A) in-between (2) maximum destructive (3) maximum constructive.
d. 30 cm - (A) in-between (2) maximum destructive (3) maximum constructive.
e. 35 cm - (A) in-between (2) maximum destructive (3) maximum constructive.
f. 40 cm - (A) in-between (2) maximum destructive (3) maximum constructive.

Answers

Answer:

Explanation:

When the path difference is equal to wave length or its integral multiple, constructive interference occurs . If it is odd multiple of half wave length , then destructive interference occurs.

For constructive interference , path diff = n λ

For destructive interference path diff = ( 2n+ 1 ) λ /2

where λ is wave length of wave , n is an integer.

a )

path diff = 10 cm which is half the wavelength , so maximum destructive interference will occur.

b )

path diff = 15 cm which is neither  half the wavelength nor full wavelength , so in between is the right option.

c )

path diff = 20 cm which is equal to  the wavelength , so maximum constructive  interference will occur.

d)

path diff = 30 cm which is 3 times half the wavelength , so maximum destructive interference will occur.

e)

path diff = 35 cm which is neither integral multiple of half the wavelength , nor integral multiple of wavelength so in between is th eright answer.

f )

path diff = 40 cm which is 2 times the wavelength , so maximum constructive  interference will occur

A motorcycle, travelling cast, starts from rest, moves in a straight line with a constant acceleration and covers a distance of 64 m in 4 s.Calculate a) Its acceleration b) Its final velocity c) At what time the motorcycle had covered half the total distance d) What distance the motorcycle had covered in half the total time.​

Answers

The motorcycle had covered a distance of 16 meters in half the total time.

a) To calculate the acceleration, we can use the formula:

a = (v - u) / t

where a is the acceleration, v is the final velocity, u is the initial velocity (which is 0 since the motorcycle starts from rest), and t is the time.

Given:

u = 0 m/s (initial velocity)

v = ? (final velocity)

t = 4 s (time)

s = 64 m (distance)

Using the equation of motion:

s = ut + 1/2at^2

We can rearrange the equation to solve for acceleration:

a = 2s / t^2

a = 2(64) / (4)^2

a = 128 / 16

a = 8 m/s^2

Therefore, the acceleration of the motorcycle is 8 m/s^2.

b) To find the final velocity, we can use the formula:

v = u + at

v = 0 + (8)(4)

v = 32 m/s

Therefore, the final velocity of the motorcycle is 32 m/s.

c) To determine the time at which the motorcycle had covered half the total distance, we divide the total distance by 2 and use the formula:

s = ut + 1/2at^2

32 = 0 + 1/2(8)t^2

16 = 4t^2

t^2 = 4

t = 2 s

Therefore, the motorcycle had covered half the total distance at 2 seconds.

d) To calculate the distance covered in half the total time, we use the formula:

s = ut + 1/2at^2

s = 0 + 1/2(8)(2)^2

s = 0 + 1/2(8)(4)

s = 0 + 16

s = 16 m

for such more questions  distance

https://brainly.com/question/26550516

#SPJ11

Refraction studes show that the Moho is depressed about 10 km beneath the center of the Hawaiian Islands. Assuming that this is the value of wo and that h=34 km, E= 70 GPa, v = 0.25. Pm Pw 2300 kg m-3, and g = 10 m s -2 determine the maximum bending stress in the lithosphere.

Answers

the maximum bending stress in the lithosphere is 202 MPa

hear

Given that Hite 34 km

12 2 70 9 Pa

N 2 0. 25

ρm- ρw= 2300 kgm 3

3 = 10 ms - 2

Moh depressed about 10km beneath the centre or Islands .

We know, flexural rigidity

Equation

D=E/12 (1 - V 2 )

be neath the center of Isla g

=70 x 109 pa x 103 x ( 10 m ) 312 (1 - 0.0625 )

=70 x 1021- Nm

=12X 019375Fox 10 212

=2 6: 222 x 102 Mm

Again , total maximum bending stress in the

lithosphere 6 = = 90 - ( 8 m - Pm ) 8 u

Where , Applied load of upper Surface of lithosph

We Replaced manthe rock thickness = 34 1

Bending stress = 6. 222 x 10' Alm- 2300 108 x 10->52 x 34 km

=n3 4

= 6. 2327 10 1/m- 230 0 kg x 10 m 2 x 34 x103 x]

=2 6 . 222 x 102/ nim - . 2300 X10 x 34x103 Pa

= 6222x1021 am 2 x 18 Alm

34x 34 x 34x( 103) ,m 3

6:222 X 102 Mm

2

3 4 x 3 4x34 x 109 m 3

2 6 .222 x 1012 na

34 x 34 x 39

6. 222

- x 10 2 pa

39, 304

2 0. 000 ( 5 8 307 10 - Pas

158, 83 X 108 pa .

-'. Bendig stress - 15.83 x108 pa . 782 x 10 Pa

2 15. 53 x108 pa - 7. 8 2x108 pc

Bendig stress=202 M Pa

to know more about lithosphr, visit to

https://brainly.com/question/21403674

#spJ4

Write a 16 line poem that describes centripal force utilizing all key concepts and terms.

Answers

A typical 16-line poem that described centripetal force can be found below.

Centripetal force

In circular motion, a force we call,

Centripetal, it keeps things in thrall.

Directed towards the center of the path,

Without it, objects would face a wrath.

Angular velocity is key,

The rate of change of the angle we see.

And the radius of the circle too,

Both play a role in what we must do.

The mass of the object cannot be ignored,

It factors in with gravity's cord.

As the force pulls towards the center,

Centripetal force is what we enter.

It is the sum of all the forces in play,

Equal to mass times velocity squared, we say.

And if the force is too weak or too strong,

Off the circular path, the object goes wrong.

Thus, centripetal force is what we need,

To keep objects moving at the speed,

In a circular path, they're meant to be,

A force that keeps them in harmony.

More on centripetal force can be found here: https://brainly.com/question/11324711

#SPJ1

A horizontal spring is attached to a wall at one end and a mass at the other. The mass rests on a frictionless surface. You pull the mass, stretching the spring beyond the equilibrium position a distance A, and release it from rest. The mass then begins to oscillate in simple harmonic motion with amplitude A. During one period, the mass spends part of the time in regions where the magnitude of its displacement from equilibrium is greater than (0.30)A— that is, when its position is between −A and (−0.30)A, and when its position is between (0.30)A and A. What total percentage of the period does the mass lie in these regions?

Answers

Answer:

 Δt'/ T% = 90.3%

Explanation:

Simple harmonic movement is described by the expression

         x = A cos (wt)

we find the time for the two points of motion

x = - 0.3 A

        -0.3 A = A cos (w t₁)

         w t₁ = cos -1 (-0.3)

         

remember that angles are in radians

        w t₁ = 1.875 rad

x = 0.3 A

        0.3 A = A cos w t₂

        w t₂ = cos -1 (0.3)

         w t₂ = 1,266 rad

         

Now let's calculate the time of a complete period

x= -A

        w t₃ = cos⁻¹ (-1)

        w t₃ = π rad

this angle for the forward movement and the same time for the return movement in the oscillation to the same point, which is the definition of period

         T = 2 t₃

         T = 2π / w     s

now we can calculate the fraction of time in the given time interval

        Δt / T = (t₁ -t₂) / T

        Δt / T = (1,875 - 1,266) / 2pi

        Δt / T = 0.0969

 

This is the fraction for when the mass is from 0 to 0.3, for regions of oscillation of greater amplitude the fraction is

         Δt'/ T = 1 - 0.0969

         Δt '/ T = 0.903

         Δt'/ T% = 90.3%

Two particles have positions at time t given by s1 = 4t-t^2 and s2 = 5t^2-t^3. Find the velocities at v1 and v2 at the instant the accelerations of the two particles are equal.

Answers

By differentiating the two equations, the velocities at v1 and v2 at the instant the accelerations of the two particles are equal are 0 m/s and 8 m/s

VELOCITY

There are various type of velocity

Instantaneous VelocityAverage velocityRelative velocity

Given that two particles have positions at time t given by s1 = 4t-t^2 and

s2 = 5t^2-t^3.

The velocities at v1 and v2 at the instant the accelerations of the two particles are equal can be calculated by first differentiating the two equations

s1 = 4t-t^2

\(\frac{ds}{dt}\) = 4 -2t

Acceleration will be second derivative

\(\frac{dv}{dt}\) = -2

for the second equation: s2 = 5t^2-t^3

\(\frac{ds}{dt}\) = 10t - 3\(t^{2}\)

\(\frac{dv}{dt}\) = 10 - 6t

Since the acceleration are equal, equate the two together

-2 = 10 - 6t

collect the likes term

-2 - 10 = -6t

-12 = -6t

t = 12/6

t = 2 s

Substitute t in the first ds/dt equation

\(V_{1}\) = 4 - 2t

\(V_{1}\) = 4 - 2(2)

\(V_{1}\) = 0

Substitute t in the second ds/dt equation

\(V_{2}\) = 10t - 3\(t^{2}\)

\(V_{2}\) = 10(2) - 3(2)^2

\(V_{2}\) = 20 - 12

\(V_{2}\) = 8 m/s

Therefore, the velocities at v1 and v2 at the instant the accelerations of the two particles are equal are 0 m/s and 8 m/s

Learn more about Velocity here: https://brainly.com/question/17228388

find the acceleration if the change in velocity is 5 m/s and the time is 15 seconds 5 m/s2 25 m/s2 0.33 m/s2 0.5 m/s2

Answers

Answer:

Below

Explanation:

Acceleration is defined as      change in velocity / change in time

Accel = 5 m/s  /  15 s =  .33 m/s^2

An organ pipe of length L has one end closed but the other end open. What is the wavelength of the fundamental node emitted?
a. Slightly smaller than 4 L
b. Slightly larger than 4 L c. Roughly equal to 3/2
d. Slightly larger than 2 L

Answers

Answer:analize a afirmacao a seguir e tudo que envolve o gerenciamento da marca e que ultrapassa as acoes com objetivos economicos e refere se a cultura principios e valores

Explanation:

a truck on the freeway, traveling at 30 m/s slams on the brakes. the truck comes to a rest in 4.7 seconds & travels 70 meters while stopping. what was the trucks acceleration while braking?

Answers

Answer: 76

Explanation:

How are magnetic fields like vectors?

Answers

Answer:Magnetic fields from two sources add up as vectors at each point, so the strength of the field is not necessarily the sum of the strengths1. Magnetic fields are vectors, which means they have direction as well as size. Therefore, the sum of two magnetic fields is not simply the sum of their magnitudes2.

Explanation:

A farmer hitches her tractor to a sled loaded with firewood and pulls it a distance
of 20 m along level ground (Figure 3). The total weight of sled and load is 14,700
2
N. The tractor exerts a constant 5000 N force at an of 36.9
◦ angle of above the
horizontal. A 3500 N friction force opposes the sled’s motion. Find the work
done by each force acting on the sled and the total work done by all the forces.

Answers

(a) The work done by the force applied by the tractor is 79,968.47 J.

(b) The work done by the frictional force on the tractor is 55,977.93 J.

(c) The total work done by  all the forces is 23,990.54 J.

Work done by the applied force

The work done by the force applied by the tractor is calculated as follows;

W = Fd cosθ

W = (5000 x 20) x cos(36.9)

W = 79,968.47 J

Work done by frictional force

W = Ffd cosθ

W = (3500 x 20) x cos(36.9)

W = 55,977.93 J

Net work done by all the forces on the tractor

W(net) = work done by applied force  -  work done by friction force

W(net) = 79,968.47 J -  55,977.93 J

W(net) = 23,990.54 J

Learn more about work done here: https://brainly.com/question/25573309

#SPJ1

Elephants can communicate over distances as far as 6 km by using very low-frequency sound waves. What is the wavelength of a 10 Hz sound wave emitted by an elephant? Assume air temperature is 20∘C.

Answers

The characteristics of the sound waves allow to find the result for the wavelength is:

         λ = 34.29 m

The sound wave is a longitudinal traveling wave, where the speed of the wave depends on the air temperature.

         v = \(v_o \sqrt{1 + \frac{T}{273} }\)  

where v₀ is the speed of sound for T = 0ºc v₀ = 331 m / s.

indicate that the temperature is T = 20ºC, let's find the speed of the traveling wave.

        v = 331 \(\sqrt{1 + \frac{20}{273} }\)  

        v = 342.9 m / s

The speed of sound is related to wavelength and frequency.

       v = λ f

        λ = \(\frac{v}{f}\)

Let's calculate

        \(\lambda = \frac{342.29}{10}\)  

        λ  = 34.29 m

In conclusion using the characteristics of sound waves we can find the result for the wavelength is:

          λ = 34.29 m

Learn more here:  brainly.com/question/21995826

What is the potential energy of a 20-kg safe sitting on a shelf 0.5 meters
above the ground?
O A. 98 J
B. 10 J
O C. 20 J
D. 196 J
Please help me I’ll give you BRAINLIEST

Answers

Explanation:

P.E=MGH

Where m is mass

Where G is Acceleration Due to Gravity

Where h is Height

So the parameters are M = 20kg

G = 9.8m/s

H = 0.5meters

P.E= 20x9.8x0.5

=98J.

So Ans. is A= 98J

During the earthquake, what we need to do to be safe,write steps.
(i) When you are in the classroom.
(ii) When you are out of danger

Answers

During an earthquake, it is important to take appropriate steps to ensure safety

Steps you can follow in two different scenarios

(i) When you are in the classroom

Drop, Cover, and Hold On: Quickly drop to the ground, take cover under a sturdy desk or table, and hold on to it to protect yourself from falling objects and potential structural collapse.

Protect Your Head: If possible, use your arms to cover your head and neck to provide additional protection.

Stay Indoors: Remain inside the classroom until the shaking stops and it is safe to exit. Be prepared for aftershocks, which are smaller tremors that may occur after the main earthquake.

(ii) When you are out of danger:

Evacuate to Open Space: If you are no longer in immediate danger, move quickly to an open space away from buildings, trees, streetlights, and utility wires that may pose a risk of falling or collapsing.

Watch for Falling Debris: Be aware of your surroundings and watch out for any hazards such as falling debris, broken glass, or damaged infrastructure.

Stay Clear of Buildings: Avoid entering damaged buildings or structures as they may be unstable. Keep a safe distance until authorities confirm it is safe to enter.

Learn more about earthquake at

https://brainly.com/question/248561

#SPJ1

a certain transformer doubles input voltage. if the primary coil draws 10 a of current, then the current in the secondary coil is

Answers

A certain transformer doubles input voltage. if the primary coil draws 10 a of current, then the current in the secondary coil is 5a

What is Voltage?The voltage represents the potential energy of an electrical charge at a certain location, if one were to place an electrical charge unit there. To put it another way, it is a measurement of the energy present in an electric field or an electric circuit at a certain location. It is equivalent to the amount of labour required to complete each unit of payment.The voltage can be mathematically stated as, where work is measured in joules and charge is measured in coulombs. The voltage is the difference in potential energy between two places in a circuit, according to our definition. The potential of one point is higher than that of the other points.

To learn more about Voltage refer to:

https://brainly.com/question/26523307

#SPJ4

The number of distinct ways of placing four indistinguishable balls into five distinguishable boxes is _____

Answers

The number of distinct ways of placing four indistinguishable balls into five distinguishable boxes is 20.

To solve this problem, we can use the stars and bars method, which is a combinatorial technique used to count the number of ways to distribute indistinguishable objects into distinguishable containers. In this case, we have four indistinguishable balls and five distinguishable boxes.

The stars and bars method works by representing each ball as a star and using bars to separate the balls into different boxes. For example, if we wanted to distribute two balls into three boxes, we could use the following diagram:

* | * * | *

In this diagram, the first and last bars represent the boundaries of the containers, while the stars represent the balls.

The second bar separates the first two balls from the last ball, indicating that the first two balls are in the first container and the last ball is in the third container.

To distribute four balls into five boxes, we need to use three bars to separate the balls into four groups. We have a total of six spaces to place the bars (including the boundaries), and we need to choose three of them to place the bars.

Therefore, the number of distinct ways to place four indistinguishable balls into five distinguishable boxes is the same as the number of ways to choose three spaces out of six, which is:

6 choose 3 = (6!)/(3!3!) = 20

Therefore, there are 20 distinct ways to place four indistinguishable balls into five distinguishable boxes using the stars and bars method.

For more such questions on boxes, click on:

https://brainly.com/question/28344846

#SPJ11

Your cousin has looked after you your whole life and you always looked up to him. Today he told you he sells drugs; " That's where I get all the money for clothes and stuff. " He asked, Do you want to go into business with me you will make great money?" What do you do/say to him? Use the decision-making process. *

Answers

Answer:

Honestly, you should have a firm resolve not to go into drug peddling.

Politely tell him you are not interested in the business, that you are most concerned about your future and the career path you have chosen for yourself already.

He will definitely feel bad, but you can go on to advise him.

You can also advise him to stop and highlight the dangers of doing drugs.

Explanation:

There are a whole lot of disadvantages involved in the drug business,

in fact, the disadvantages out weights the advantages in the long run.

say if one is caught and sent to a life long sentence, or if one is caught up with the effect of the use of hard drugs and the health implication, to the extent that one looses his/her sanity, you see it won't make any sense anymore doing drugs in the long run. so friend you can advise you cousin to stop and thinker of good businesses that cold fetch him cool money, without the law chasing him, with that he can be a contributor to economic growth by paying his taxes too

Figure 7-40 shows a cord attached to a cart that can slide along a frictionless horizontal rail aligned along an x axis. The left end of the cord is pulled over a pulley, of negligible mass and friction and at cord height h = 1.6 m, so the cart slides from x1 = 5.0 m to x2 = 1.0 m. During the move, the tension in the cord is a constant 28.0 N. What is the change in the kinetic energy of the cart during the move?

Answers

The cord's tension remains constant during the movement at 28.0 N. 94.08 J is the change in the cart's kinetic energy during motion.

the force exerted on the cart is the tension T in the chord itself. so,

F=T

Calculate the displacement of the cart.

d=\(\sqrt{x_{1}^{2}+h^{2} } -\sqrt{x_{2}^{2}+h^{2} }\)

subsitute 5.0m for x₁,1.0m for x₂,and 1.60m for h.

d=\(\sqrt{5.0^{2}+1.60^{2} } -\sqrt{1.0^{2}+1.60^{2} }\)

d=3.36m

calculate the change in kinetic energy of the cart.

ΔK=Fd

substitute 28.0N for F and 3.36m for d.

ΔK=28.0×3.36

ΔK=94.08 J

Tension is a force that runs the length of a medium, particularly one that is conveyed by a flexible medium like a rope or cable.

An action-reaction pair of forces acting at either end of the aforementioned elements is what is referred to as tension. Consider a rope; aside from the endpoints, every section of the rope experiences tension force in both directions. The ends feel strained on one side and the force of the attached weight. The tension fluctuates in several places along the string.

Learn more about tension here:

https://brainly.com/question/29677323

#SPJ4

please help i’ll mark u branliest

please help ill mark u branliest

Answers

Answer:

62

Explanation:

it doesn't need explanation

How do I find the mass in kg

How do I find the mass in kg

Answers

To find the mass in kilograms, you need to know the object's weight in newtons and the acceleration due to gravity. The formula for finding mass is mass = weight / acceleration due to gravity. So if you have an object with a weight of 100 N and the acceleration due to gravity is 9.8 m/s^2, the mass would be 10.204 kg.

The mass of the block is 0.025 kg or 25 g, when the spring has k = 28 N/m, and compresses 0.11 m before bringing the block to rest.

When a block is dropped onto a spring with k=28 N/m, the block has a speed of 3.2 m/s just before it strikes the spring. If the spring compresses an amount of 0.11 m before bringing the block to rest, what is the mass of the block?The formula for the spring potential energy is given as follows; PE = (1/2) kx² where k is the spring constant and x is the amount of deformation of the spring. Substituting the values given;PE = (1/2) 28 (0.11)²PE = 0.16972 J. According to the law of conservation of energy, the potential energy stored in the spring at maximum compression is equal to the kinetic energy the block had before it struck the spring;KE = (1/2) mv²where m is the mass of the block and v is its velocity.Substituting the values;0.16972 = (1/2) m (3.2)²m = 0.025 kg or 25 gTherefore, the mass of the block is 0.025 kg or 25 g.

For more questions on mass

https://brainly.com/question/86444

#SPJ8

Where is the near point of an eye for which a spectacle lens of power +2 D is prescribed for reading purpose?

Answers

The near point of a human eye is about a distance of 25 cm.

The closest distance that an object may be viewed clearly without straining is known as the near point of the eye.

This distance (the shortest at which a distinct image may be seen) is 25 cm for a typical human eye.

The closest point within the accommodation range of the eye at which an object may be positioned while still forming a focused picture on the retina is also referred to as the near point.

In order to focus on an item at the average near point distance, a person with hyperopia must have a near point that is further away than the typical near point for someone of their age.

To learn more about near point, click:

https://brainly.com/question/32579304

#SPJ1


What are 3 facts you learned about the periodic table:

Answers

Answer: the rarest element is Francium. J is not on the periodic table. also Dmitri Mendeleev proposed the periodic table.

Explanation: Kinda looked the last one up.

menstruation occurs in females when ?

Answers

Answer:

when they hit puberty

Explanation:

.

have a good day

Answer:

Their inner lining of uterus sheds

Explanation:

this occurs typically in females between 9-15

A person standing on the roof of a building drops a 0.125 Kg ball on the ground. A

child on eight floor saw the ball passing with a speed of 33.1 m/s. The first floor of the building

is 12.0 m high and each successive floor is 8.00 m high. Determine the total numbers of floors

in the building. How fast was the ball falling just before it hit the ground? What was its kinetic

energy just before it hit the ground?

Answers

Answer:

V = a t      velocity after time t

t = 33.1 / 9.80 = 3.38 sec   (time ball had been falling)

S = 1/2 a t^2 = 55.9 m

So the ball had been falling  for 7 * 8 = 56 m  

The child was 7 floors from the top

Since he was on the eight floor the floors below him were

7 * 8 + 12 = 68 m     total floors below child

68 + 56 = 124 m      total height of building

Total floors in building = 7 + 7 + 1 = 15 floors

PE at top = KE at bottom

KE = m g h = .125 * 9.80 * 124 = 152 Joules

What force produces an extension of 2.5 cm? ​

Answers

Answer:

F = 2.5 N

Explanation:

The force that produces an extension of 2.5 cm in a spring depends on the spring constant, which is a measure of the stiffness of the spring. The force required to extend or compress a spring by a certain amount is given by Hooke's law, which states that the force is proportional to the displacement:

F = k*x

where F is the force, x is the displacement or extension of the spring, and k is the spring constant.

If we know the spring constant, we can calculate the force required to produce an extension of 2.5 cm using the equation above.

For example, if the spring constant is 100 N/m, then the force required to produce an extension of 2.5 cm would be:

F = k*x

F = (100 N/m)*(0.025 m)

F = 2.5 N

Therefore, a force of 2.5 N would produce an extension of 2.5 cm in a spring with a spring constant of 100 N/m

14 The radius of gyration of a body about an axis &ta
distance 6 cm from its centre of mass is 10 cm.
Then, its radius of gyration about a parallel axis
through its centre of mass will be
(a) 80 cm (b) 8 cm (c) 0.8 cm (d) 0.08 cm

Answers

Correct option is B 8 cm.

Let radius of gyration for the axis not passing through center of mass be r and that for the axis passing through the center of mass be k and the distance between the two parallel axes be a.

Parallel axes theorem gives:

\( {mr}^{2} = m( {k}^{2} + {a}^{2} ) \\ ⇒ {r}^{2} = {k}^{2} + a {}^{2} \)\(⇒k = \sqrt{ {10}^{2} - {6}^{2} } = 8cm.\)

Thus, option B is the correct answer.

Other Questions
1. What are vertical angles?2. what us the relationship of vertical angles? 3. Name two pair of vertical angles. help hurry pleaseeeee what is unnecessary meeting? The velocity of a car increases from 10 km/h to 50 km/h in 5 seconds. What is its acceleration? Select THREE characteristics of a democracy.-always assumes a confederate form of government-acknowledgement of peoples basic rights-ruled by a small group of leaders-rights handed over by citizens to the government-participation by the peopleconsent by the people to accept the governments actions (consent of the governed) 5'-CATTTATTTAACTGGGTTCTTGCCCAGCCCATATTTTCACCCTTTAATGG TAATGAAGCTAAAATTTCTTTCCAGTCACTTTGCATATCATTTCCTTTCT CTTTAATTCTCTTTCGAAGTGAGATGATTGATAGATTCTTCTTCAGCAGT CACTTACTTTGGTAGATGATTTTCTTTTTCCTTTGAAGTCGATTTTGAAA GGAGCTCTGTGTGATGAGCTAATTAGCACAAACACACAGAGTATATAACC TTAATTAGGCATGATTATAGGCTCAACGTAATGGGATGTCCTGAAACTGC ACACTATGCAAATATTAGACTTTTCATTCTTCCCATTACATCGGAAACCA TCAAGCAAAGGATGTTTTGCAGTAGGTACCACAGTCAATGCCAGGTGCAA CTCTTTCAATAAAAGGTTGATT-3'1) you want to use PCR to amplify a specific portion. Use the underlined bases as the location of the two primers, what are the two primer sequences that need to be designed and synthesized for PCR? Be sure to indicate the 5 and 3 ends of the primers.2) What is the size of the expected amplified product? if I need 39 for 3 how many do I need for 4 Which detail does Hedrick provide to support his position in this excerpt? Many great American leaders have been slaveholders. Slavery was not written into the US Constitution. Several Founding Fathers from the South also opposed slavery. The Southern economy and society heavily relied on slavery. Suppose a distribution has mean 300 and standard deviation 25. If the z- 106 score of Q is -0.7 and the z-score of Q3 is 0.7, what values would be considered to be outliers? Who was the main author of the Constitution? Seana and Mikayla sold tickets to the school play. Seana sold 3 adulttickets and 2 student tickets for $84. Mikayla sold 2 adult tickets and5 student tickets for $100. How much did a student ticket cost? A. $12 B. $20 C. $36 D. $44 Todd made a table to show different plans he can use to save $500. Complete the table. Which plan can Todd use to save $500 in less than 16 weeks and have $20 extra? Explain how you found your answer Stop 1. The oldest rocks on this VFE are from the Conococheague Fm from the Cambrian period of geologic time. The Conococheague Fm includes both oolitic limestone and stromatolites. These are both indicators of what type of environment? Samuel Sewall viewed marriage, as other seventeenth-century colonists, like a property arrangement rather than an emotional bond based on romantic love.(A) Samuel Sewall viewed marriage, as other seventeenth-century colonists, like a property arrangement rather than(B) As did other seventeenth-century colonists, Samuel Sewall viewed marriage to be a property arrangement rather than viewing it as(C) Samuel Sewall viewed marriage to be a property arrangement, like other seventeenth-century colonists, rather than viewing it as(D) Marriage to Samuel Sewall, like other seventeenth-century colonists, was viewed as a property arrangement rather than(E) Samuel Sewall, like other seventeenth-century colonists, viewed marriage as a property arrangement rather than In order to be profitable anew indutrial product ale per cutomer' mot average more than or equal to 4. 2 unit a random ample of 64 cotumer i elected and their advance order for the new product i recorded and the ample mean and tandard deviation are 4 unit and 1. 8 unit repectively at 1% level check whether the product i profitable or not why do very small differences in annual growth rates amount to big differences in the degree of long-term economic growth? because the faster-growing countries gain a political advantage over poorer countries, and use that advantage for their economic gain. because the slower-growing countries don't export enough. because the slower-growing countries save too much. because the annual growth rate is compounded over time. the process in which the police and the public come together in the form of community meetings is known as 1. The remaining length (L) of 120-inch per rope after X inches have been cut off 120 - x = lProportional or not proportional 2. The total cost (T) after 8% sales tax is added to an items price (p): 1.08p=t Proportional or not proportional 3. The number of marbles each sister gets (x) when m marbles are shared equally among for sisters: x=m/4Proportional or not proportional 4. The volume (v) of a rectangular prism whose height is 12 cm and base is a square with side lengths cm: v = 12s2Proportional or not proportional solve for t. 3t - 2= 11 For the following, write your answer choice on the line. 1. Jess is running when we meet him in chapter one because______________________. A. someone is chasing him B. he wants to impress Momma C. hes in trouble D. He wants to be the fastest this