Dinosaurs have been extinct for more than 65 million years, but scientists can still infer the diet of what many dinosaurs ate. dinosaurs can be classified as meat-eating carnivores, plant-eating herbivores, or omnivores that eat both plants and animals. how might finding the skull of a dinosaur allow scientists to infer the diet of the long-dead organism?

Answers

Answer 1

The skull of a dinosaur provides valuable information about its diet through the examination of teeth, jaw structure, and bite force. By analyzing these features, scientists can make informed inferences about whether the dinosaur was a meat-eating carnivore, plant-eating herbivore, or an omnivore that consumed both plants and animals.

Finding the skull of a dinosaur can provide valuable information to scientists about the diet of the long-dead organism. The skull of a dinosaur contains several key features that can help infer its dietary preferences.

Firstly, the shape and structure of the teeth can give important clues about the type of food the dinosaur consumed. For example, sharp, serrated teeth are typically found in meat-eating carnivores, indicating that the dinosaur had a diet primarily composed of other animals.

On the other hand, flat, broad teeth are often associated with plant-eating herbivores, suggesting that the dinosaur fed on vegetation. Teeth that have a combination of sharp and flat surfaces can suggest an omnivorous diet, indicating that the dinosaur consumed both plants and animals.

Furthermore, the position and arrangement of the teeth within the skull can also provide insights into the feeding habits of the dinosaur.

Some dinosaurs had specialized teeth that were adapted for specific tasks, such as tearing flesh or grinding plant material. By examining the skull and the position of these specialized teeth, scientists can make educated inferences about the diet of the dinosaur.

In addition to teeth, the jaw structure and bite force can also be indicative of dietary preferences. Strong, robust jaws and powerful bite forces are often associated with carnivorous dinosaurs that needed to capture and subdue their prey.

On the other hand, herbivorous dinosaurs typically had weaker jaws and less forceful bites, as their diet consisted of relatively softer plant material.

To learn more about dinosaur click here:

https://brainly.com/question/17321635#

#SPJ11


Related Questions

Summarize a process of lactic fermentation if you were to exercise for 4 hours today.

Use only 3 sentences.

Answers

Answer:

If aerobic respiration occurs, then ATP will be produced using the energy of the high-energy electrons carried by NADH or FADH2 to the electron transport chain. If aerobic respiration does not occur, NADH must be reoxidized to NAD+ for reuse as an electron carrier for glycolysis to continue. How is this done? Some living systems use an organic molecule as the final electron acceptor. Processes that use an organic molecule to regenerate NAD+ from NADH are collectively referred to as fermentation. In contrast, some living systems use an inorganic molecule as a final electron acceptor; both methods are a type of anaerobic cellular respiration. Anaerobic respiration enables organisms to convert energy for their use in the absence of oxygen.

Explanation:

what happens during each of the four phases of mitosis

Answers

1) Prophase: chromatin into chromosomes, the nuclear envelope break down, chromosomes attach to spindle fibres by their centromeres 2) Metaphase: chromosomes line up along the metaphase plate (centre of the cell) 3) Anaphase: sister chromatids are pulled to opposite poles of the cell 4) Telophase: nuclear envelope

I hope that helps

Answer:

Mitosis has four stages: prophase, metaphase, anaphase, and telophase.

You can remember the order of the phases with Please Pee on the MAT

In early prophase, the cell starts to break down some structures and build others up, setting the stage for division of the chromosomes.

In late prophase (sometimes also called prometaphase), the mitotic spindle begins to capture and organize the chromosomes.

In metaphase, the spindle has captured all the chromosomes and lined them up at the middle of the cell, ready to divide.

In anaphase, the sister chromatids separate from each other and are pulled towards opposite ends of the cell.

In telophase, the cell is nearly done dividing, and it starts to re-establish its normal structures as cytokinesis (division of the cell contents) takes place.

Cytokinesis, the division of the cytoplasm to form two new cells, overlaps with the final stages of mitosis. It may start in either anaphase or telophase, depending on the cell, and finishes shortly after telophase.

I was stuck on this too, you can watch this video to explain it much better

https://www.khanacademy.org/science/ap-biology/cell-communication-and-cell-cycle/cell-cycle/v/mitosis

P waves move can travel through liquid.

true or false

(TEST HELP!!!)

Answers

True! They can travel through solids, liquids, and gases but an S waves cannot

Answer:

The answer to your question is true

customer service jobs to India results in saving money for firms that pursue this strategy, because wages are much lower in India than in the United States. s

Answers

Answer:I think it’s outsourcing

Explanation:

Glycogen in the________________is broken down and released when blood glucose is low.

Answers

Answer:

a

Explanation:

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

Help or else I lose my mind

Help or else I lose my mind

Answers

Answer: Dependant would be how high it goes up. The control would be the height as Jonas wants to know if a different rubber band would make the rocket fly higher.

The last controlled values are the rubber band and how high the rocket goes.


Explanation: I can’t do the graph as I need a bigger photo of it.

Compare and contrast the differences among EPROM, EEPROM and
flash memory. (9 marks)
(c) Compare and contrast the differences among EPROM, EEPROM and flash memory. (9 marks)

Answers

EPROM (Erasable Programmable Read-Only Memory) is a non-volatile storage device that holds its data even after the power is turned off. EPROM chips must be erased in entirety before they can be reprogrammed, and the erasing process can only be done under ultraviolet (UV) light.

EEPROM (Electrically Erasable Programmable Read-Only Memory) is a non-volatile memory that can be electrically erased in small blocks. EEPROM can be rewritten more than 100,000 times and doesn't require UV light for erasing. Flash Memory is a non-volatile storage medium that can be electrically erased and reprogrammed in chunks or pages. Flash memory is quicker to erase and write than EEPROM. Flash memory is widely used in portable devices, such as digital cameras, cellphones, and USB flash drives, among other things.

There are several differences among these three types of memory, which are outlined below:EPROM is a non-volatile memory that can be programmed only once, whereas EEPROM can be electrically erased and rewritten.EEPROM is simpler to erase and rewrite than EPROM, and it doesn't require UV light.EEPROM is faster than EPROM because it doesn't need to be completely erased before new data can be programmed.Flash memory is a non-volatile storage medium that can be programmed in blocks.Flash memory is faster to write and erase than EEPROM.

To learn more about Flash memory

https://brainly.com/question/32217854

#SPJ11

In 100 to 150 words, compare and contrast the U.S Revolution and the South American Revolution.

Answers

Answer:

a

Explanation:

The difference between the hydrostatic pressure of the blood in the glomerulus and the opposing pressures of the osmotic blood pressure and fluid pressure in the capsular space is termed the

Answers

The difference between the hydrostatic pressure and the opposing pressures of the osmotic blood pressure and fluid pressure in the capsular space is termed the net filtration pressure. It is a fundamental pressure.

What is the net filtration pressure?

The net filtration pressure can be defined as the total pressure capable of promoting the process of filtration.

The net filtration pressure can be calculated by assessing hydrostatic pressures and pressures within the glomerular capillaries.

The net filtration pressure can be estimated by subtracting the pressures that oppose filtration from the glomerular blood hydrostatic pressure.

Learn more about the net filtration pressure here:

https://brainly.com/question/26646540

One group of reptiles, exemplified by the fossil Archaeopteryx, led to the evolution of ________.
A) dinosaurs
B) mammals
C)cephalopods
D) birds
E) horses

Answers

The group of reptiles exemplified by the fossil Archaeopteryx led to the evolution of birds. Therefore, the correct answer is: D) birds

The fossil Archaeopteryx is considered an important transitional fossil that provides evidence for the evolutionary link between dinosaurs and birds. It had both reptilian and avian features, displaying characteristics of both groups. Archaeopteryx had feathers, similar to birds, but also retained some reptilian features such as teeth and a long bony tail. Therefore, the evolution of birds is the outcome that can be associated with the fossil Archaeopteryx. The fossil Archaeopteryx is an extinct species of bird-like dinosaur that lived during the late Jurassic period, about 150-145 million years ago. It is considered a transitional fossil that provides important evidence for the evolution of birds from small, carnivorous dinosaurs.

Learn more about fossil Archaeopteryx led here:

https://brainly.com/question/23543018

#SPJ11

In 1815 a volcano erupted spewing billions of tons of ash into the sky. This ash "cloud" caused global annual temperatures to drop below normal, causing "a year without a summer" in 1816.Which sphere did this ash "cloud" affect to cause these changes? *

Answers

Answer:

The Atmosphere

Explanation:

1816 was a year without summer because the billions of tons of ash that was spewed blocked radiation preventing it from reaching the surface of the earth.

A volcano is a break in the crust of planetary bodies like Earth that allows gasses, volcanic ash, and hot lava to escape. Volcanos are one of the major factors that cause climate changes on Earth mostly because of their cooling effect.

The ash, gasses and lava usually escape to the atmospheric layer of the earth with their cooling effect. And they cool the earth by blocking incoming solar radiation. This can go on for months or years depending on the components and severity of the eruption and can lead to "a year without summer" as witnessed in 1816.

Are gender traits completely a result of societal expectations?
Are there any parts of the human body that get oxygen directly from the air and not from the blood?

PLZ HELP WILL GIVE BRAINLIEST

Answers

Answer:

I would say that gender traits are not completely a result of societal expectations but it definitely did play a role and the answer for the 2nd part is the cornea

I don’t think so ghhh just duck

Describe the first (pioneer species) seral stage of primary succession:

Answers

The first seral stage of primary succession is characterized by the presence of Pioneer species. These are typically hardy and adaptable organisms that are able to establish themselves in areas that have been completely cleared of vegetation, such as after a volcanic eruption or a glacier retreat.

Pioneer species are usually small and have short life cycles, and are able to thrive in harsh environmental conditions that would be too extreme for other plants. Examples of pioneer species include lichens and mosses, which can grow on bare rock and soil and help to break down the surface and create soil for other plants to grow in. As the pioneer species begin to colonize the area, they start to create conditions that are more favorable for the establishment of other plant species, and the process of succession continues with the development of new communities of plants and animals over time.

learn more about Pioneer species here:

https://brainly.com/question/7850016

#SPJ11

plsssss helpppp asap

plsssss helpppp asap

Answers

Answer:

cant see the pic

Explanation:

What are the chambers of the mammalian heart

Answers

Answer:

Two atria and two ventricles make a total of 4 chambers.

Explanation:

Two atria and two ventricles

(20!!!!! PLS HELP)Select the type of inheritance pattern that is best described below:

Independent genes at four different loci are responsible for determining an individual’s HLA tissue tip, important in organ transplants and certain diseases.

a. Pleiotropy
b. Codominance
c. Polygenic Inheritance
d. Multiple Alleles
e. Incomplete Dominance

Answers

Polygenic Inheritance in which independent genes at four different loci are responsible for determining an individual's HLA tissue type, important in organ transplants and certain diseases.

Polygenic inheritance refers to the inheritance of a trait governed by more than one genes. More then three genes govern the inheritance of polygenic traits. Multiple independent genes have an additive or similar effect on a single quantitative trait.

Human height and color of skin and eyes occurs due to several genes, so it is an example of polygenic inheritance. The HLA system is inherited in a Mendelian manner and extensively polymorphic half are inherited from your mother and half from your father.

To learn more about Polygenic Inheritance , here

brainly.com/question/12538425

#SPJ1

Gene mutations can be positive, negative or neutral. Suppose that the normal gene in Model 2 produced a polypeptide that was necessary for cellular respiration.Choose a mutation from those in Model 2 that would be neutral for a cell. Explain your rea- soning by relating the mutation to the cellular respiration process.A) mutation b
B)mutation A
C) mutation C

Answers

Genetic mutations are alterations in the normal gene sequence that result in the production of aberrant proteins.

The correct answer is all of them, gene mutation can be positive, negative, or neutral.

A) Various environmental influences and spontaneous occurrences can cause changes in genes, often known as mutations, which can affect the structure and function of the proteins that our cells utilize. Genes encoded in our DNA produce proteins that carry out particular activities within human cells. All new alleles in nature emerge spontaneously from mutations, which occur at a low frequency due to mistakes in DNA replication and the chemical instability of purine and pyrimidine bases.

Therefore, a gene mutation is a modification of the nucleotide sequence inside a single coding segment of DNA that takes place during cell replication (mitosis and meiosis). Variations in alleles result in variations in the organisms that make up a population. Cellular respiration, or the conversion of inspired oxygen to water that powers cellular activity, also produces highly reactive oxygen species that can damage DNA.

The purine bases G and A are particularly vulnerable to this attack. Positive mutations increase the likelihood that the organism will survive, which increases the likelihood that the mutation will be passed on to the offspring.

B) The human body replaces every cell during cellular respiration because of metabolism, and any errors in mRNA transcription or polypeptide translation can also happen. As temporary alterations to the cell, these modifications are nonetheless regarded as negative mutations since they might cause an organism to die before it has a chance to reproduce.

To learn more about Mutation,

brainly.com/question/17031191

#SPJ4

Can u judge who is the better person out of these 3?..

Mr A - He had friendship with bad politicians, consults astrologers, two wives, chain smoker, drinks eight to 10 times a day..

Mr B - He was kicked out of office twice, sleeps till noon, used opium in college & drinks whiskey every evening..

Mr C - He is a decorated war hero, a vegetarian, doesn't smoke, doesn't drink and never cheated on his wife..

You would say Mr.C

right?

Come here to ans Id-841 823 2122 PASS-ROKY ​

Answers

Answer:

 

WHat??????????????????

Answer:

Omo...

Is there a plot twist???  \(OoO )/

Explanation:

what role do independent and dependent varibles play in controlled experiment

Answers

Independent variables are those which are controlled by the scientist and change as a result of this, where as dependent variables are those that show the result of these changes and are measured

A drug company is testing the effectiveness of a new blood pressure medicine using rats as the test subjects

e) what are some posible factors that must remain constant during testing
f)what is ONE factor that will be different between the experimental group and the control group

PLEASE HELP

Answers

A constant factor could be the dose of the drugs  and the species of the rats used.

What is a constant factor?

In an experiment, a constant factor is one that is not allowed to change al through the experiment. This one must be held as the same and not allowed to vary. A constant factor could be the dose of the drugs  and the species of the rats used.

The factor that would be different for the experimental group and the control group  the administration of the new drug.

Learn more about experiment:https://brainly.com/question/11256472

#SPJ1

The u.s. integrated ocean observing system (ioos) is a government program to collect information in the gulf of mexico. please select the best answer from the choices provided
true
false

Answers

The statement "The U.S. Integrated Ocean Observing System (IOOS) is a government program to collect information in the Gulf of Mexico" is true.

The IOOS is a national ocean observing program that was established to provide a comprehensive and coordinated approach to collecting and disseminating information about the ocean and coastal waters in the United States.

The program collects data from a variety of sources, including satellites, buoys, ships, and coastal observing stations, and provides access to this information to a wide range of users, including government agencies, researchers, and the public.

One of the main focuses of the IOOS is the Gulf of Mexico, where the program works to collect data on a variety of topics, including water temperature, ocean currents, water quality, and marine biology. The information collected by the IOOS helps to improve our understanding of the Gulf of Mexico and the processes that occur in this important body of water.

Learn more about IOOS at :https://brainly.com/question/2981690

#SPJ4

which of the following is not a difference between rna and dna? a. in rna, cytosine binds with uracil, while in dna, cytosine binds with guanine. b. rna has ribose as its sugar, while dna has deoxyribose. c. rna is important in protein synthesis, while dna stores genetic information for protein synthesis. d. rna is single-stranded, while dna is double-stranded.

Answers

In RNA, cytosine binds to uracil, while in DNA, cytosine binds to guanine which is not the difference between RNA and DNA. Here option A is the correct answer.

RNA and DNA are both nucleic acids that are essential to life, but they have several differences. One major difference is their sugar component. RNA has ribose sugar, which contains an extra oxygen atom compared to the deoxyribose sugar in DNA. The presence of this extra oxygen makes RNA less stable than DNA.

Another difference is the function of the two molecules. DNA stores genetic information, which is passed from one generation to the next, while RNA is involved in protein synthesis. RNA carries genetic information from DNA to ribosomes, where it is used to build proteins.

RNA is also single-stranded, while DNA is double-stranded. RNA can form structures such as hairpins and loops due to its single-stranded nature, whereas DNA forms the well-known double helix structure.

To learn more about cytosine binds

https://brainly.com/question/12148299

#SPJ4

jan is about to eat a slice of pizza. in what order will the pizza pass through the organs of her gi tract? mouth, ileum, duodenum stomach, duodenum, and large intestine small intestine, stomach, and large intestine jejunum, colon, and cecum

Answers

The pizza passes through the mouth, stomach, duodenum, jejunum, ileum, large intestine (including the colon), and cecum.

The order in which the pizza will pass through the organs of Jan's GI tract is as follows: 1. Mouth: The pizza enters the mouth where it is chewed and mixed with saliva.2. Stomach: The pizza then moves into the stomach, where it is further broken down by stomach acid and digestive enzymes.3. Duodenum: From the stomach, the partially digested pizza enters the duodenum, which is the first part of the small intestine.4. Jejunum and Ileum: The pizza then continues to pass through the jejunum and ileum, which are the remaining parts of the small intestine. Here, nutrients are absorbed into the bloodstream.5. Large Intestine: Next, the pizza moves into the large intestine, specifically the colon. Here, water and electrolytes are absorbed, and any remaining undigested food is formed into stool.6. Cecum: Lastly, the pizza passes through the cecum, which is the beginning of the large intestine. From here, it eventually exits the body through the rectum and anus during the process of elimination.

For more questions on the large intestine

https://brainly.com/question/13782420

#SPJ8

Observing Animals (Image Attached)
Let’s study and compare three animals: a frog, an ancient and extinct mammal-like animal, and an owl. Observe the illustrations, and then answer the questions.

1. How are the bodies of the three animals similar to one another? How are they different?

2. What might these similarities suggest about the common ancestor of these organisms?

Observing Animals (Image Attached)Lets study and compare three animals: a frog, an ancient and extinct

Answers

Answer: They each have patches on their stomachs. Also, all 3 animals have claws or legs, even though they play different function in each organism, they 3 still share the same characteristics of having claws or legs.

Explanation:

I am also trying to understand the 2nd question, but this is the answer to the 1st one.

How do DNA, chromosomes, and genes work as the instructions for heredity?

Answers

Answer: Genes are segments of deoxyribonucleic acid (DNA) that contain the code for a specific protein that functions in one or more types of cells in the body. Chromosomes are structures within cells that contain a person's genes. Genes are contained in chromosomes, which are in the cell nucleus.

Explanation:

Need help ASAP.Will give you brainlist.

Need help ASAP.Will give you brainlist.

Answers

bruh bruh bruh bruh bruh bruh

In the early days of germ theory, contagious diseases were thought to be caused only by fungi or bacteria. In the 1890s, Dmitri Ivanovski filtered extracts from diseased tobacco plants and discovered that the disease could be transmitted to new plants through the filtrate. He hypothesized that something smaller than bacteria or fungi was responsible for the transmission of the disease. Which best explains how Ivanovski's work led to a change in the germ theory? He tried to promote his hypothesis as a law. He used a new experimental method to test his hypothesis. He used a more powerful bacterial strain than other scientists had. He obtained results that confirmed what other scientists were thinking.

Answers

Answer:

He used a new experimental method to test his hypothesis.

Explanation:

Dmitri Ivanovski, a Russian microbiologist who was born in the year 1864 and died in 1920. He was the scientist who initiated the discovery of viruses as a pathogenic microorganism. He worked to discover the cause of mosaic disease in tobacco plant and he hypothesized that that something smaller than bacteria or fungi, as early believed, was responsible for the transmission of the disease.

In order to test his hypothesis, he passed a solution containing the causative agent of the disease, which he prepared from the infected plant leaves, through a filter known as Chamberland filter. He was able to discover that the filtrate still contained microbial pathogens that can infect more tobacco plants, confirming his hypothesis that something smaller than fungi or bacteria is responsible for the tobacco mosaic infection.

Hence, to test out his hypothesis, Ivanovski in the 1890's used a new experimental method i.e. CHAMBERLAND FILTER method.

Last semester, Jordan got an A in biology. This semester his grade has dropped to a C, and he is really concerned.

Which questions should Jordan ask himself to help deal with this challenge? Check all that apply.

A) Am I able to keep up with my homework?
B) Am I smarter than most of the other students in class?
C) Am I taking a class that may be too difficult?
D) Am I anxious before I go to class each day?
E) Am I able to remember what I learned in class each day?

Answers

Answer:

acde

Explanation:

Answer:

Am I taking a class that may be too difficult?

Am I able to remember what I learned in class each day?

Am I able to keep up with my homework?

Explanation:

Of two stars of spectral class B5, one has broad hydrogen lines and the other has narrow hydrogen lines. How do these stars differ physically?

Answers

The physical difference between the two stars of spectral class B5 is that the star with broad hydrogen lines has a higher temperature and faster rotation compared to the star with narrow hydrogen lines.

The width of the hydrogen lines in a star's spectrum provides information about its physical properties. In this case, the star with broad hydrogen lines indicates a higher temperature and faster rotation compared to the star with narrow hydrogen lines.

The broadening of spectral lines is primarily caused by two factors: temperature and rotation. Higher temperatures lead to increased thermal motion of particles in the star, resulting in broader spectral lines. Therefore, the star with broad hydrogen lines has a higher temperature than the star with narrow hydrogen lines.

Additionally, the rotation of a star can also affect the broadening of spectral lines. A faster rotation produces a larger Doppler shift, which leads to broader lines in the spectrum. Therefore, the star with broad hydrogen lines is likely rotating at a higher speed than the star with narrow hydrogen lines.

Overall, the presence of broad and narrow hydrogen lines in the spectra of these B5 stars suggests differences in temperature and rotation, indicating variations in their physical characteristics.

Learn more about spectrum

https://brainly.com/question/4901067

#SPJ11

Other Questions
Angela wants to do what she can to "protect" her brain so that as she ages (even more!!!), she reduce the risk of major cognitive decline. In other words, Angela want take advantage of the plasticity A ________ involves complete political and economic integration, either voluntary or enforced. political union common market regional cooperation for development (RCD) customs union free trade area (FTA) 3. The function y = 2+1 is a solution of the differential equation (1 - 2x - )y+ 2(1+)y 2y = 0 The method of Reduction of order produces the second solution y2 = (correct) (a) (b) (c) (d) (e) m2 + +2 2.2 - 1+1 22 - +3 x+x+3 x+2 O - 32C . What is a useful marker point for the Global Anthropocene? When glacial sediments are replaced by organic sediments When Carbon Dioxide (CO2) and Methane (CH4) first get recorded in rocks and sediment When Carbon Dioxide (CO 2 ) and Methane (CH4) first appeared in the atmosphere Excess of radioactive isotopes such as 14C and 239Pu in rocks and sediments Estimate 510/11 to the nearest whole number InstructionsClick the links to open the resources below. These resources will help you complete the assignment. Once you have created your file(s) and are ready to upload your assignment, click the Add Files button below and select each file from your desktop or network folder. Upload each file separately.Your work will not be submitted to your teacher until you click Submit.DocumentsProject-Time Line of the Roman Empire-Student Guide (Word doc)Project-Time Line of the Roman Empire-Student Guide (PDF)Project-Time Line-Rubric (Word doc)Project-Time Line-Rubric (PDF)File Upload Determine whether the triangles can be proved similar. If they are similar, write a similarity statement. If they are not similar, explain why. you and your business partner are mailing advertising flyers to your customers. you address 6 flyers each minute and have already done 80. your partner addresses 4 flyers each minute and has already done 100. calculate when the two of you will have addressed equal numbers of flyers. A product currently sells for $12 per unit. The variable costs are $4 per unit, and 10,000 units are sold annually and a profit of $30,000 is realized per year. A new design will increase the variable costs by 20% and Fixed Costs by 10% but sales will increase to 12,000 units per year. (a) At what selling price do we break even, and (b) If the selling price is to be kept same ($12/unit) what will the annual profit be? Rewrite each statement or question putting the verb into the NEGATIVE .Il oublie les devoirs. given a string, find the length of the longest substring without repeating characters. what were two complaints that the Democratic-Republicans made against the Federalists in the election of 1800? 2(3x + 2) < 2x 12write the solution using interval notation The cost of producing 360360 DVDs is $3470. Producing 690 DVDs would cost $3572.30Find the average cost per DVD of the additional 330 DVDs over 360.What is the $ per DVD? explain how artificial insemination is carried out in calves Find the loose unit weight of the soil (kg/m3) if the shrinkagefactor is 0.72 and the compacted unit weight is 2170 kg/m3. Theswell of the soil is 25%. The graph of the function g(x) is a transformation of the parent function f(x)=x^2.Which equation describes the function g?g(x)=x^2+3g(x)=(x+3)^2g(x)=(x3)^2g(x)=x^23 Your father is about to retire, and wants to buy an annuity that will provide him with $50,000 of income per year for 25 years, beginning a year from today. The going rate on such annuities is 5.90% How much would it cost him to buy such an annuity today? You are faced with the probability distribution of the HPR on the stock market index fund given in Spreadsheet 5.1 of the text. Suppose the price of a put option on a share of the index fund with exercise price of $110 and time to expiration of 1 year is $12, and suppose the risk-free interest rate is 6% per year. You are contemplating investing $107.55 in a 1-year CD and simultaneously buying a call option on the stock market index fund with an exercise price of $110 and expiration of 1 year. What is the probability distribution of your dollar return at the end of the year HELP ASAP!!!!!!!!! Explain why the gel electrophoresis instrument must have a power supply.