Diabetes and hypertension two most common causes of chronic __________ in united states.

Answers

Answer 1
Kidney disease ~~~~~~

Related Questions

a/an ___ is the combined group of all organisms living in a specific environment a. pathogen b. microorganism c. enzyme d. microbiome

Answers

Answer:

d. microbiome

Explanation:

The microbiome refers to the combined group of microorganisms, including bacteria, fungi, viruses, and other microbes, that live in a specific environment, such as the human body or a particular ecosystem. The microbiome can have significant impacts on the health and functioning of the host organism or ecosystem and plays important roles in processes such as digestion, immune system function, and nutrient cycling.

2. Emerging adulthood is relatively new stage of the lifespan. Explain the four revolutions/movements
that were discussed in lecture and in the text that lead to changes in the ways of life for early 20-year-olds
in developed countries.

Answers

Four revolutions/movements that lead to changes in the ways of life for early 20-year-olds in developed countries are : Technological Revolution, Sexual Revolution, Women's Movement , Knowledge Economy

What are our revolutions that lead to changes in ways of life for early 20-year-olds in developed countries?

Emerging adulthood is a developmental stage that occurs between adolescence and adulthood, typically spanning the ages of 18-29 years.  Four key revolutions/movements that led to changes in the ways of life for early 20-year-olds in developed countries are:

Technological Revolution: The widespread availability and adoption of technology, particularly the internet and smartphones, have facilitated communication and access to information.

Sexual Revolution: The liberalization of sexual norms and values has contributed to greater sexual exploration and experimentation among emerging adults.

Women's Movement: The feminist movement has opened up new opportunities for women, allowing them to pursue education and careers on equal footing with men.

Knowledge Economy: The shift from an industrial to a knowledge-based economy has led to a greater emphasis on education and training.

To know more about emerging adulthood, refer

https://brainly.com/question/13134787

#SPJ1

List five ways to help yourself set and keep goals.​

Answers

Well first you need a goal like i do cuz my goal is to be a pro skater

What are some of the effects of using illegal drugs?​

Answers

Answer:

Drug abuse can have a number of damaging consequences on an addict’s social and emotional well-being, including:

Loss of employment

Relationship loss

Incarceration

Financial trouble

Homelessness

Risky sexual behavior

-can have negative effects on the brain, heart, and lungs

-leads to deposition of carcinogens

-infections may develop (specifically injecting heroin)

hope this helps :)

Think about lifestyle choices that you make on a daily basis. Choose at least four lifestyle choices which you could change to improve your overall health. Explain how making those changes would improve your health.
Explain what the core muscles do and why it's important to have a strong set of core muscles.

Answers

Answer:

1. I sit around all day long going nothing but watch TV

    - If you sit too much, your brain could look just like that of someone with dementia. Sitting also raises your risk of heart disease, diabetes, stroke, high blood pressure, and high cholesterol, which all play a role in the condition

2. I don't work out

    - You may lose muscle strength and endurance, because you are not using your muscles as much. Your bones may get weaker and lose some mineral content. Your metabolism may be affected, and your body may have more trouble breaking down fats and sugars. Your immune system may not work as well

3. I don't sleep that much anymore

    Lack of sleep can affect your overall health and make you prone to serious medical conditions, such as obesity, heart disease, high blood pressure, and diabetes.

4. I don't eat that much

    - In addition to sabotaging your weight-loss efforts, eating too few calories can also harm your health. When your body goes into starvation mode, you are at increased risk for the following: Abnormally low blood pressure and slow heart rate. Heart rhythm abnormalities.

Explanation:

Core muscles protect the spine and keep it stabilized. Also, they can help control movements such as walking and standing. The core helps transfer energy and helps us move in different directions. It's important to have a strong set of core muscles.

Thinking positively may help me have a healthier immune system and improve my mental health. Sleeping well at night, a full 6-8 hours can help me be more relaxed and that can reduce stress. Eating healthier, such as vegetables can help me have more energy and reduce the risk for cancer, etc. Exercising may help improve my physical health.

Technology has made many things convenient, so it makes it easier to choose active options.

Physically active jobs sometimes cause physical harm

People who choose to be less active instead of being more active tend to be unhealthier than the more active ones. They probably suffer from more health related issues.

We have absolute control of our behavior, to maintain good physical fitness you must make positive choices every day.

Diet, Available equipment or proper exercise information, Air or space to breath fresh air, Clean and fresh water( without it you will become dehydrated and therefore have no physical strength for fitness).

I HOPE THIS HELPS AND I GET BRAINLIEST

The legacy of_________ is that it influences or forms the foundation of most theories of personality today.

Answers

The legacy of psychodynamic and humanistic approaches is that it influences or forms the foundation of most theories of personality today.

Which theories have an impact on personality?

The four primary theories of personality are:

PsychoanalyticHumanisticTrait perspectiveBehaviorist theory.

The behaviorist theory of personality asserts that conditioning influences behavior and holds that a person's personality is a compilation of their environmental experiences.

Therefore, Psychodynamic and humanistic therapies do have certain similarities. Both of them think that each person's ideas and feelings are crucial to personality development and that dysfunctions are caused by competing emotions brought on by having one's desires denied.

Learn more about personality  theory from

https://brainly.com/question/28013709
#SPJ1

Match each chronic disease with one of its risk factors.
Breast cancer
Poor air quality
Diabetes
Poor diet
Asthma
Family history

Answers

Breast cancer- Family history
Diabetes- Poor diet
Asthma- Poor air quality

Every night, Pricilla increases her dose of pain medication, noting that the initial dose no
longer works. Pricilla seems to have developed:

a. drug tolerance.
b. classical conditioning.
c. withdrawal.
d. psychological dependence.

Answers

Answer:

A

Explanation:

The initial dose is not enough to reach above her baseline.

The baseline in this instance is how much medication she needs to not feel pain; the higher above the baseline the less pain she will feel.

I hope that made sence.

according to the acsm, adults should get at least how many minutes of moderately intense exercise per week?

Answers

Answer:

30 mins daily

Explanation:

A body is found in an apartment building that has the air conditioning at around 75 degrees. The body has leaked fluids, and most of the skin has sloughed off. About how long has the person been deceased?

Nine days
Two hours
Three days
Two months

Answers

The condition of the body, with leaked fluids and significant skin sloughing off may mean about two months ago. option D

When did the person die?

Given that decomposition processes can cause fluid leakage and skin sloughing over an extended period of time, "two months" appears to be the most reasonable estimate.

It is crucial to remember that pinpointing the precise moment of death frequently necessitates a thorough forensic investigation and analysis by experts, taking into account a number of variables including body temperature, rigor mortis, livor mortis, and insect activity, among others.

Learn more about death:https://brainly.com/question/31108171

#SPJ1

What is stress?
It's the positive and negative emotions you have
about yourself
It's positive thoughts you have towards your friends
and family
o
It's how your environment controls you
O
It's how you react to your environment

Answers

Answer:

how you react to the environment <3

Explanation:

Nutrient recoommendations established in the dietary guidelines for americans serve as the stand upon:_____.

Answers

Nutrient recommendations established in the Dietary Guidelines for Americans serve as the standard guidelines for promoting health and preventing chronic diseases through nutrition.

These guidelines provide evidence-based recommendations for the general population regarding nutrient intake and dietary patterns. They serve as a foundation for nutrition policies, education, and programs implemented by various organizations, including healthcare professionals, policymakers, educators, and food industry stakeholders.

The dietary guidelines aim to address public health concerns such as obesity, cardiovascular diseases, diabetes, and nutrient deficiencies.

They emphasize the importance of a balanced and varied diet that includes a wide range of nutrient-dense foods, moderation in consumption of certain nutrients, and physical activity. The guidelines are periodically updated based on scientific research to reflect the latest understanding of nutrition and health.

To know more about Dietary Guidelines for Americans refer here :    

https://brainly.com/question/32945670#

#SPJ11                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        

During embryonic development, if the cell divides three times, how many cells do you have?
A. 8
B. 1
C. 4
D. 2

Answers

During embryonic development, if the cell divides three times, there would be 8 cells.

WHAT IS CELL DIVISION:

Cell division is the process whereby living cells replicate themselves by dividing.

Somatic cells replicate through a type of cell division called mitosis. Mitosis produces two daughter cells that are genetically identical.

Embryo development occurs via mitotic division. This means that if the cell divides three times; 2³ = 8 cells would be produced.

Learn more about cell division at: https://brainly.com/question/725029

Which term describes the complete set of processes carried out by an organism in order to sustain life?
v refers to the set of chemical processes carried out by an organism in order to sustain life. in Digestion is a form of
• activity.

Answers

Answer:

Metabolism; catabolic.

Explanation:

Living system can be defined as the internal systems of organisms and how materials circulate within organisms.

Generally, these living systems are self-organized life forms and are known to be very much interactive with their surroundings or environment. Also, living systems are dependent on the flow of information, matter and energy at various levels.

Some examples of living systems in organisms are respiratory system, nervous system, digestive system, and circulatory system.

Additionally, living systems comprises of the following components; cells, organs, muscle, tissues, blood, etc., which are typically used for carrying out various bodily functions such as respiration, digestion, metabolism, etc.

Metabolism refers to the set of chemical processes carried out by an organism in order to sustain life. Digestion is a form of catabolic activity because it involves the breaking down of food into smaller sizes that can be absorbed as nutrients by the body while releasing energy through the process.

Do you think 21 is the appropriate legal age for alcohol use? Explain

Answers

Answer:

Yes

Explanation:

This law basically told states that they had to enact a minimum drinking age of 21 or lose up to 10 percent of their federal highway funding.

write a paragraph regarding your opinion on the coronavirus vaccine.
(1 paragraph only)​

Answers

Answer: I think that the coronavirus vaccine is something all of us should take. It lowers the chance of you getting the virus and if you do get it the effects are weakened. My whole family has gotten the vaccine and we have been safe from the virus so far. So I would advise to getting it.

Explanation:

1. Miasma is
a) the belief that illness is caused by evil behavior
b) a gust of polluted air
c) a method of killing microorganisms
d) a theory that living things can grow from nonliving things

Answers

I think it’s B! hope this helps ^v^

What dose your heart stop do you go to the hospital or is it Medical so if it is medical do people do to the emergency room to ok or is just fake thing happen white your heart

Answers

Some are for a second but people recommend you to go to the hospital to see if you have a heart condition

Describe one exercise you did that helps improve your striking and your reaction
time skills (at least one of your exercises must qualify).

Answers

Answer:

The correct answer is - skipping or jumping ropes.

Explanation:

There are many exercises and sports that can help an individual to improve his/her striking and reaction time. Reaction time depends on the reflexes that how fast your reflexes are. Main exercises and sports that can help in improving reaction time and reflexes are martial arts, soccer, hand paddle exercise, yoga, and other sports.

Skipping or jumping ropes require concentration and quick response in order to jump over ropes which helps in practicing the reflexes and react faster.

Thus, the correct answer is -  skipping or jumping ropes.

A diet often promises quick results but is usually nutritionally unbalanced. - passive
True
O False
ОО

A diet often promises quick results but is usually nutritionally unbalanced. - passiveTrueO False

Answers

Answer:

TRUTH

Explanation:

True
——/————-
————————

A scientist is conducting a study to determine how well a new medication treats ear infections. The scientist tells the participants to put 10 drops in their infected ear each day. After two weeks, all participants' ear infections had healed.

Which of the following changes to the design of this study would most improve the ability to test if the new medication effectively treats ear infections?
A. Have participants put ear drops in both their infected ear and healthy ear
B. Have participants use ear drops for only one week
C. Create a second group of participants with ear infections who use 15 drops a day
D. Create a second group of participants with ear infections who do not use any ear drops.

Many diseases have an incubation period. Which of the following best describes what an incubation period is?
A. The effect of a disease on babies
B. The period during which someone has an infection, but is not showing symptoms
C. The recovery period after being sick
D. The period during which someone builds up immunity to a disease

Answers

The Scientist should create a second group of participants with ear infections who do not use any ear drops; option D.

An incubation period is a period during which someone has an infection, but is not showing symptoms; option B.

What are controls in an experiment?

A control is a group in an experiment or research which do not receive the same treatment as the test group during the research.

In order for the scientist to improve the ability to test if the new medication effectively treats ear infections, he should set up a control group of participants with ear infections who do not use any ear drops.

In diseases, an incubation period is a period during which someone has an infection, but is not showing symptoms.

Incubation periods are usually when the disease causing organisms multiply.

Learn more about control group at: https://brainly.com/question/24708013

#SPJ1

the human body has more of this substance (by weight) than any other substance.

Answers

The substance that the human body has more of (by weight) than any other substance is water.

Water is a vital component of the human body, comprising a significant portion of its weight. On average, the human body is made up of approximately 60% water, although this can vary depending on factors such as age, sex, and body composition. Water is present in various tissues, organs, and fluids throughout the body, including blood, muscles, cells, and even bones.

Water plays crucial roles in numerous physiological processes, such as maintaining body temperature, transporting nutrients and oxygen, lubricating joints, facilitating digestion, and eliminating waste through urine and sweat. It also serves as a medium for chemical reactions within cells and helps to cushion and protect vital organs.

Given its abundance and essential functions, water is indeed the substance that the human body has more of (by weight) than any other substance. Its presence and balance are vital for the proper functioning and overall health of the human body.

To know more about the Human body, here

https://brainly.com/question/31111472

#SPJ4

Why does age not necessarily reflect physical, emotional, and social maturity?

Answers

Answer:

bc it can be a baby and that baby does not know anything

Explanation:

age doesn’t reflect on physical, emotional, and social maturity because at any age anyone can have emotional behavior also with physical and maturity. Trauma at any age can make someone very emotional also can make them mature more then someone who is older. Hope that helps :)

DAY ONE TOTAL EXPENDED
ACTIVITY CALORIES???

DAY ONE TOTAL EXPENDEDACTIVITY CALORIES???

Answers

I’m not sure which is day one but I did both so one of them is correct

153
Or
508
Calories

how long after a colposcopy can you have intercourse

Answers

For 1 to 2 weeks after a colposcopy you can have intercourse, the details are given in the below section.

Do now no longer have sex for 1 to two weeks after the biopsy. Your issuer might also additionally ask you to keep away from sex till you've got got had a threat to speak approximately the take a look at results. Ask your issuer what different steps you ought to take and whilst you ought to come again for a checkup. time, you ought to keep away from sexual touch or carrying tampons. It is really helpful to put on sanitary towels at some stage in this time. Have a bath instead of take a tub for 6 weeks following a remedy at colposcopy. You ought to be capable of hold together along with your every day sports after your appointment, which includes driving. For some days after your colposcopy, you can have a brownish vaginal discharge, or mild bleeding in case you had a biopsy. This is everyday and could typically forestall after three to five days.

To learn more about biopsy check the link below:

https://brainly.com/question/14583794

#SPJ4

What are the strong bands of connective tissue that join bones together are called

Answers

Answer: ligaments

explanation

Does anyone know about prevalence ratio interpretation? Need someone to please explain it.

Answers

Answer:

it is the two numbers they give u in the the order they tell u they want them in

Explanation:

hope this helps

which of these is a noncommunicable disease
A.Hepatitis
B.Flu
C.Tuberculosis
D.Diabetes

Answers

Diabetes this is because it is a chronic condition which occurs when the body doesn’t produce enough insulin or cannot effectively use the insulin it does produce

What are 3 ways you can develop the muscle in your arm

Answers

Answer:

workout your arms exercise i guess

Explanation:

A list of requirements for coronavirus protection and procedures?​

Answers

wash your hands often
wear a mask over ur nose and mouth
social distance
use hand sanitizer when on the go
Other Questions
Use the distributive property to rewrite the expression in factored form. 15g40 how to find the value of x and round it up You make her grave green with tear on tear.HyperbolePersonificationMetaphorSimile suppose you are given a cube, you break the cube in 3x3x3 pieces. however, before doing so, all 6 faces of the cube were colored green. all the other faces not colored green will be white after breaking it up. you randomly pick a small cube and see one face which is green. what is the probability that the cube is an edge cube? How did John D. Rockefeller horizontally integrate his monopoly in 1880? A.)He purchased iron mines around the country to add to his business. B.)He created a trust that controlled ninety percent of the nation's oil refineries. C.)He created a trust that controlled oil wells, refineries, and distribution networks. D.)He purchased coal plants around the country to add to his business. Help me with the following problem a circle is described by the equation x2+y2-6x+8y=0. what are the coordinates of the center of the circle and the length of its radius? Construct the confidence interval for the population mean .c=0.90, x=6.8, o = 0.7, and n = 43A 90% confidence interval for is (_,_) (Round to two decimal places as needed.) A country's real gross domestic product is the annual value of all final goods and services that are what? andi did a test. the test had 20 questions. for each correct answer he gains 5 points and if he errs he loses 2 points. andy answers the questions and at the end is evaluated with 51 points. what is the number of his correct answers? relatively speaking, the thickness of earth's atmosphere is incredibly small compared to earth's radius rearth the target stores' "bulls-eye" logo is an example of a _____. A. B. C. D. pretty please help me. Also you get 100 points 1. What was the purpose of President Clinton's interventions in Bosnia in 1994 and Serbia in 1999?a. to prevent human rights abusesb.to protect U.S. trade intereststo monitor democratic electionsd. to defend U.S. military bases2. Which of the following was an effect of the North American Free Trade Agreement (NAFTA)?a. the creation of high-wage service jobsb. stronger enforcement of environmental lawsc. the loss of U.S. manufacturing jobsd. weaker investment in transportation infrastructure3. How did President Bush's administration respond to the September 11 attacks?by passing the USA PATRIOT Act to search, monitor, and detain suspected terroristsb. by creating the Department of Homeland Security to coordinate different agencies in combatingterrorismc. by creating the Transportation Security Administration (TSA) and putting airport security underthe responsibility of the federal governmentd.All of the above. As Mr. Uttersons character develops, he becomes more angry. Bored. Sad. Worried. Mention some traditional science and technology influenced by modernization What is sales tax Short answer? Suppose a researcher wishes to edit a gene of interest containing the target DNA sequence 5'_GCGTAACTAGTCCTAACGAG-3' . Design the customized portion of an sgRNA for this target DNA sequence: 5' CUCGUUAGGACUAGUUAGCG The North American Free Trade Agreement (NAFTA) replaced theUnited StatesMexicoCanada Agreement (USMCA), becoming the primarytrade agreement for North America. True or False research that allows marketers to make causal inferences about relationships is called