determine the volume in ml of 0.183 m koh(aq) needed to reach the equivalence (stoichiometric) point in the titration of 21.74 ml of 0.292 m c6h5oh(aq). the ka of phenol is 1.0 x 10-10.

Answers

Answer 1

You'll need 34.7 mL of 0.183 M KOH to reach the stoichiometric point in the titration of 21.74 mL of 0.292 M C₆H₅OH. Titration is a laboratory technique used to determine the concentration of a solution by reacting it with a known concentration solution.

In this case, we are titrating a solution of 0.292 m C₆H₅OH with a solution of 0.183 m KOH. The stoichiometric point in this reaction is the point at which the number of moles of the added titrant (KOH) is equal to the number of moles of the analyte (C₆H₅OH).

At this point, the reaction is complete, and the resulting solution is neutral. We can calculate the number of moles of C₆H₅OH using its concentration and volume:
moles of C₆H₅OH = concentration x volume = 0.292 x 0.02174 = 0.006342 moles

To reach the stoichiometric point, we need an equal number of moles of KOH.
moles of KOH = moles of C₆H₅OH = 0.006342 moles

We can then use the concentration of KOH to calculate the volume needed to reach the stoichiometric point:
moles of KOH = concentration x volume
0.006342 moles = 0.183 mol/L x volume
Volume = 0.006342 moles / 0.183 mol/L = 0.0347 L or 34.7 mL

Therefore, we need 34.7 mL of 0.183 M KOH to reach the stoichiometric point in the titration of 21.74 mL of 0.292 M C₆H₅OH. It is important to note the given Ka value of phenol is not used in this calculation since it is not directly related to the stoichiometry of the reaction.

To know more about titration refer here:

https://brainly.com/question/29312456#

#SPJ11


Related Questions

The site of transcription initiation is the

promoter.

sigma factor.

start codon.

origin of replication.

Answers


Promoter


The site of transcription initiation is the
promoter. The site on the DNA from which
the first RNA nucleotide is transcribed is
called the +1 site, or the initiation site.

How many microseconds are in 0.329 seconds

Answers

Their are 329000 microseconds in 0.329 seconds.

cheggin the experiment to determine which mechanism was used by restriction endonucleases, what evidence ruled out the formation of a covalent intermediate?

Answers

The covalent phosphodiester bonds of DNA are hydrolyzed by restriction enzymes, leaving either "sticky/cohesive" ends or "blunt" ends.

By incubating the target DNA molecule with restriction enzymes, which detect and bind certain DNA sequences and cleave at specified nucleotides either inside or outside of the recognition sequence, restriction digestion is carried out.

An isolated bacterial protein known as a restriction enzyme cleaves DNA at sequence-specific locations to create DNA fragments with a known sequence at either end. Restrictions enzymes are crucial for numerous laboratory processes, including recombinant DNA technology and genetic engineering.

At the particular restriction site, DNA bonds between the 3′ OH of one nucleotide and the 5′ phosphate of the following one are cleaved by restriction enzymes.

In order to prevent the plasmid vector from ligating with itself and to verify that the inserted gene is oriented correctly, two separate restriction enzyme sites might be used.

A) #1 5′ - CGTGATCTCGATTCGCTAGTAACGTT - 3′

         3′ - GCACTAGAGCTAAGCGATCATTGCAA - 5′

    #2 5′ - TCATGAATTCCTGGAATCAGCAAATGCA - 3′

         3′ - AGTACTTAAGGACCTTAGTCGTTTACGT - 5′

B) Recognition sites:

#1 5′ - GAATTC - 3′

    3′ - CTTAAG - 5′

#2 5′ - GAATTC - 3′

    3′ - CTTAAG - 5′

C) Cleavage sites:

#1 5′ - G    AATTC - 3′

    3′ - CTTAA    G - 5′

#2 5′ - G    AATTC - 3′

    3′ - CTTAA    G - 5′

The correct and complete question is in the image.

Learn more about Restriction enzymes here:

https://brainly.com/question/13944056

#SPJ4

 cheggin the experiment to determine which mechanism was used by restriction endonucleases, what evidence

HELP me find a virtual lab that can use these materials:
 2 plastic resealable bags
 3–5 “000” size empty gelatin capsules
 One 10 mL graduated cylinder to measure purified or distilled water
 5 mL distilled water
 1 g calcium chloride
 1 Fahrenheit or Celsius thermometer
 1 funnel
 Clock or stopwatch

PLEASE I need to do a science project but I don't have the materials at home

Answers

A virtual lab that is used to test, and modify a device that releases thermal energy by chemical processes can use the given materials.

What is thermal energy in a chemical reaction?

When the temperature rises, atoms and molecules begin to move more quickly and collide with one another, producing thermal energy (also known as heat energy). Thermal energy is the energy that results from a substance's temperature when it is heated. Thermal energy can be absorbed or released by chemical reactions to create changes in thermal energy.

By making nearby particles vibrate more quickly, reactions that release thermal energy warm the area around them. Thermal energy is produced via exothermic reactions, which use chemical energy. The environment receives this thermal energy once it has been released from the reaction products. Conduction, convection, and radiation are the three mechanisms through which thermal energy is transferred.

To learn more about exothermic reactions, visit:

https://brainly.com/question/30135580

#SPJ1

a tiny radioactive capsule was found in which country this week following a frantic search?

Answers

A tiny but highly radioactive capsule that went missing in the Australian was discovered on Wednesday after a week-long search that spanned an 870-mile length of roadway.

The capsule measures 6 mm x 8 mm (0.24 in x 0.31 in) and is utilised as part of a nucleonic level sensor in an iron ore mining crushing circuit. As a ceramic source, the capsule contains 19 gigabecquerel of caesium-137. The amount of radiation emitted by the capsule has the ability to cause burns and radiation sickness in people and is possibly lethal.

A radioactive capsule containing caesium-137 was stolen from a lorry in Western Australia between January 10 and 16, 2023. The capsule was travelling 1,400 kilometres (870 miles) from Rio Tinto's Gudai-Darri iron ore mine near Newman to a storage in Perth's Malaga neighbourhood. On 27 January, the Department of Fire and Emergency Services notified to the public that the capsule had gone missing and that it was potentially lethal, causing burns and radiation sickness. On February 1, it was spotted on the side of the road near Newman.

Learn more about Radioactive capsule:

https://brainly.com/question/30625562

#SPJ4

Consider the following chemical reaction: 3 MgCl2 + 2 Na3PO4 6 NaCl + Mg3(PO4)2. Assume that 0.75 mol of MgCl2 and 0.65 mol of Na3PO4 are placed in a reaction vessel.

a) Verify that Na3PO4 is the excess reactant and MgCl2 is the limiting reactant.

b) How many moles of the excess reactant are left over after the reaction stops?

c) How many moles of NaCl will be produced in this reaction? (Remember—you must base this answer on how many moles of the limiting reactant that reacted.)

Answers

Answer:

To determine the limiting reactant and the excess reactant, we need to compare the stoichiometry of the reaction with the amounts of each reactant given.

The balanced chemical equation is:

3 MgCl2 + 2 Na3PO4 -> 6 NaCl + Mg3(PO4)2

Given:

Moles of MgCl2 = 0.75 mol

Moles of Na3PO4 = 0.65 mol

a) To verify the limiting reactant, we need to calculate the moles of Na3PO4 and MgCl2 needed to react completely, based on the stoichiometry of the balanced equation.

From the equation, we can see that:

For every 3 moles of MgCl2, 2 moles of Na3PO4 are required.

Therefore, the moles of Na3PO4 required to react with 0.75 mol of MgCl2 would be:

(0.75 mol MgCl2) x (2 mol Na3PO4 / 3 mol MgCl2) = 0.5 mol Na3PO4

Since we have 0.65 mol of Na3PO4, which is greater than the required amount of 0.5 mol, Na3PO4 is the excess reactant.

b) To find the moles of the excess reactant left over, we subtract the moles of Na3PO4 that reacted from the initial moles:

0.65 mol Na3PO4 - 0.5 mol Na3PO4 = 0.15 mol Na3PO4 (left over)

c) To determine the moles of NaCl produced in the reaction, we need to calculate the moles of the limiting reactant (MgCl2) that reacted. From the balanced equation, we know that:

For every 3 moles of MgCl2, 6 moles of NaCl are produced.

Using the stoichiometry, we can calculate the moles of NaCl produced:

(0.75 mol MgCl2) x (6 mol NaCl / 3 mol MgCl2) = 1.5 mol NaCl

Therefore, 1.5 mol of NaCl will be produced in this reaction.

.The Kp for the reaction below is 1.49 × 108 at 100.0°C:

CO(g) + Cl2(g) → COCl2(g)

In an equilibrium mixture of the three gases, PCO = PCl2 = 2.22 × 10-4 atm. The partial pressure of the product, phosgene (COCl2), is ________ atm.

The Kp for the reaction below is 1.49 × 108 at 100.0°C:

CO(g) + Cl2(g) → COCl2(g)

In an equilibrium mixture of the three gases, PCO = PCl2 = 2.22 × 10-4 atm. The partial pressure of the product, phosgene (COCl2), is ________ atm.

a. 3.31 × 10-16

b. 7.34

c. 6.67 × 1011

d. 3.02 × 1015

e. 3.31 × 104

Answers

The partial pressure of the product, \(COCl_2\), in the equilibrium mixture is approximately 7.34 atm. Here option B is the correct answer.

To solve this problem, we'll use the given information and the expression for the equilibrium constant (Kp) to determine the partial pressure of the product, \(COCl_2\).

The equilibrium constant expression for the given reaction is:

\(Kp = (PCOCl_2) / (PCO \times PCl_2)\)

We are given that \(Kp = 1.49 \times 10^8, PCO = PCl_2 = 2.22 \times 10^{(-4)\) atm, and we need to find \(PCOCl_2\).

Substituting the given values into the equilibrium constant expression, we have:

\(1.49 \times 10^8 = (PCOCl_2) / ((2.22 \times 10^{(-4)}) \times (2.22 \times 10^{(-4))})\)

Now, we can solve for \(PCOCl_2\):

\(PCOCl_2 = 1.49 \times 10^8 \times (2.22 \times 10^{(-4)})^2\)

\(PCOCl_2 = 1.49 \times 10^8 \times 4.9284 \times 10^{(-8)\)

\(PCOCl_2 = 7.3421 \times 10^0\)

\(PCOCl_2 = 7.34\) atm (rounded to two decimal places)

Therefore, the partial pressure of the product, phosgene (\(COCl_2\)), in the equilibrium mixture is approximately 7.34 atm.

To learn more about partial pressure

https://brainly.com/question/30114830

#SPJ4

How many carbon atoms are there in one molecule of CH3FO?

Answers

Answer:

Brainliest pls

Explanation:

1 mole of a substance contains Avagadro’s number of particles,

i.e. 6.023*10^23

By unitary method,

5 moles of oxygen contains 5 times the Avagadro’s number of particles

i.e. 5* (6.023*10^23) = 3.0115*10^24 number of particles.

Now, the further answer depends on what particles the question concentrates on.

If number of atoms are asked , the above answer must be multiplied by 2, because oxygen is a diatomic gas and each atom contributes to be a particle.

therefore, 5 moles of oxygen has 6.023*10^24 atoms.

If number of molecules asked, the above answer is directly written...

In the Millikan oil droplet experiment, the oil is sprayed from an atomizer into a chamber. The droplets are allowed to pass through the hole into the chamber so that their fall can be observed. The top and bottom of the chamber consist of electrically charged plates. The upper plate is positively charged, and the lower plate is negatively charged. X rays are introduced into the chamber so that when they strike the oil droplets, the droplets will acquire one or more negative charges. The electric field (voltage) is applied to the metal plates.
Watch the animation and identify the effects of an electric field on the motion of a negatively charged oil droplet. Consider the gravitational force as Fg and the electric force as Fe. All the other forces acting on the oil droplet can be ignored as their effect on the motion of the oil droplet is negligible.
A/ In the absence of an electric field, the oil droplet falls freely due to the gravitational force.
B/ If Fe is increased until it is equal to Fg, the negatively charged oil droplet will remain stationary.
C/ If Fe is greater than Fg, the negatively charged oil droplet will move freely toward the negatively charged plate.
D/ In the presence of an electric field, the negatively charged oil droplet moves freely toward the negatively charged plate.
** I chose B, but that was the wrong answer

Answers

C/ If Fe is greater than Fg, the negatively charged oil droplet will move freely toward the negatively charged plate.

In the Millikan oil droplet experiment, the negatively charged oil droplets are subjected to an electric field created by the charged plates. The electric force (Fe) acts on the oil droplet in a direction opposite to the gravitational force (Fg). When Fe is greater than Fg, the electric force overcomes the gravitational force, causing the negatively charged oil droplet to experience an upward force. As a result, the oil droplet moves freely upward toward the negatively charged plate.

Option B is incorrect because if Fe is equal to Fg, the forces balance each other, resulting in a stationary droplet. However, the question states that Fe is increased until it is greater than Fg, implying that the droplet is no longer stationary but moves in response to the electric force.

Therefore, option C is the correct answer, as it describes the effect of an electric field on the motion of a negatively charged oil droplet in the Millikan oil droplet experiment.

To learn more about Millikan oil droplet experiment, here

https://brainly.com/question/32330429

#SPJ4

hydrocarbons such as petroleum and coal are composed primarily of________and atoms.

Answers

In the following question, in the missing blanks, Hydrocarbons such as petroleum and coal are composed primarily of carbon and hydrogen atoms.

Hydrocarbons are chemical compounds that are made up of carbon and hydrogen atoms.What are Hydrocarbons?A hydrocarbon is a type of compound that is made up of carbon and hydrogen atoms exclusively. Alkanes, alkenes, alkynes, and aromatic hydrocarbons are some of the most common hydrocarbons. They are mainly used as fuel sources, but they are also used in many industrial applications. Alkanes are hydrocarbons that have single covalent bonds between carbon atoms. Methane, ethane, propane, butane, pentane, hexane, heptane, octane, nonane, and decane are the most common alkanes. Alkenes are hydrocarbons that have double covalent bonds between carbon atoms. Ethene, propene, butene, pentene, and hexene are the most common alkenes. Alkynes are hydrocarbons that have triple covalent bonds between carbon atoms. Ethyne, propyne, butyne, and pentyne are the most common alkynes. Aromatic hydrocarbons, such as benzene and naphthalene, have a unique ring structure that is characterized by a set of delocalized pi electrons.

For more such questions on Hydrocarbons

https://brainly.com/question/21281906

#SPJ11


the ratio of effusion of an unknown diatomic gas to oxygen is 0.50:1. what is molar mass of the unknown gas?

Answers

The molar mass of the unknown gas is 8.05 g/mol.

The ratio of effusion of an unknown gas to oxygen is 0.50:1, which means that the effusion rate of the unknown gas is half that of oxygen. Effusion is the process by which a gas escapes through a tiny hole into a vacuum, and the rate of effusion is directly proportional to the square root of the gas' molar mass. So, we can use this relationship to calculate the molar mass of the unknown gas.

Let's assume that the molar mass of oxygen is 32 g/mol. Then, the square root of the molar mass of oxygen is √32 = 5.66. If the effusion rate of the unknown gas is half that of oxygen, then the square root of its molar mass is 0.5 * 5.66 = 2.83. Taking the square of 2.83 gives us 8.05, which is the molar mass of the unknown gas.

Therefore, the molar mass of the unknown gas is 8.05 g/mol.

Learn more about effusion rates here: https://brainly.com/question/2655041

#SPJ4

when the following solutions are mixed together, what precipitate (if any) will form? a. feso4(aq) 1 kcl(aq)

Answers

Since all of the reactants and products are soluble in water, no precipitate is produced.

What is the solution?

A solution is a specific kind of homogeneous mixture made up of two or more substances that are used in chemistry. A solute is a substance that has been dissolved in a solvent, which is the other substance in the mixture.

The positive and negative ions of two ionic compounds swap positions during a double-replacement reaction to create two new compounds. An example of a double-replacement reaction, also known as a double-displacement reaction, is:

AB+CD→AD+CB

A and C are positively charged cations in this reaction, whereas B and D are negatively charged anions. In an aqueous solution, double-replacement reactions typically take place between substances. A reaction must produce one of the following in order to take place: a solid precipitate, a gas, or a molecular compound like water.

The reaction Iron (II) Sulfate and potassium chloride is

FeSO₄ + 2KCl → FeCl₂ + K₂SO₄

Both FeCl₂  and K₂SO₄ are liquid form.

To learn more about double-replacement reaction, click on the below link:

https://brainly.com/question/13009833

#SPJ4

Part D
Explain how your model is different from the model in the picture.

Answers

Answer:

I am explain you in image

Part DExplain how your model is different from the model in the picture.

what is ocean-ridge?

Answers

Answer:

A mid-ocean ridge is a seafloor mountain system formed by plate tectonics. It typically has a depth of ~ 2,600 meters and rises about two kilometers above the deepest portion of an ocean basin. This feature is where seafloor spreading takes place along a divergent plate boundary.

Answer:

A mid-ocean ridge is a seafloor mountain system formed by plate tectonics. It typically has a depth of ~ 2,600 meters and rises about two kilometers above the deepest portion of an ocean basin. This feature is where seafloor spreading takes place along a divergent plate boundary.

I hope it's helpful!

Someone pls help me I will make you brain

Someone pls help me I will make you brain

Answers

c-  i and iii

I hope this helps

Where do climate conditions cause hurricanes to become
larger and more powerful

Answers

When the surface water is warm, the storm sucks up heat energy from the water, just like a straw sucks up a liquid. This creates moisture in the air. ... And the warmer the water, the more moisture is in the air. And that could mean bigger and stronger hurricanes.

In some ocean basins, the intensification of hurricanes over time has been linked to rising ocean temperatures. Since 1970, sea surface temperatures worldwide have warmed by about an average of 0.1°C per decade. This warming is especially pronounced in the North Atlantic basin.

Stay seggsy.

1) Label the particles X, Y and Z from the diagram of the model of the atom below

1) Label the particles X, Y and Z from the diagram of the model of the atom below

Answers

Particle X represents Protons

Particle Y represents Electrons

Particle Z represents Neutrons

Sub-atomic particles

An atom consist of three subatomic particles which are

ProtonsNeutrons Electrons

In the nucleus of an atom, we have the proton and neutron. Protons are positively charged while neutrons have no charge.

Electrons are located outside the nucleus and are negatively-charged.

In the given diagram,

X has a positive charge which indicate that X represents protons.

Z is in the nucleus of the atom, and has no charge. This indicates that Z represent neutrons.

Y is located outside of the nucleus, thus, Y represents electrons.

Hence,

Particle X represents Protons

Particle Y represents Electrons

Particle Z represents Neutrons

Learn more on Sub-atomic particles here: https://brainly.com/question/2085792

Why is this considered a theory instead of a hypothesis or a law?

(When a dangerous microscopic organism is transferred from one person to many people,

Answers

Answer:

This is considered a hypothesis because it hasn't been confirmed. It is just a guess.

Explanation:

A hypothesis is a limited explanation of a phenomenon; a scientific theory is an in-depth explanation of the observed phenomenon. Law is a statement about an observed phenomenon or a unifying concept, according to Kennesaw State University. However, Newton's law doesn't explain what gravity is, or how it works.

Answer:

c

Explanation:

A. It is a statement of fact about how nature works instead of an explanation.

B. It provides an explanation for many observations and accepted hypotheses.

C. It describes how to test a possible explanation of one specific relationship.

D. It has not changed over time even though new technology has been developed.

what are the products in the chemical reaction of vinegar and baking soda to form sodium acetate water and carbon dioxide

Answers

Salt (sodium lactate), water, or carbon dioxide gases are the products of a reaction that happens when hydrogen peroxide (sodium bicarbonate) or vinegar (acetic anhydride) are mixed.

A chemical reaction is what?

One or more chemicals, also referred to as reactants, are transformed into one or more other substances, often referred to as products, in a chemical reaction. Substances are constructed up of chemical components or chemical elements. A chemical reaction occurs once a or more chemicals change into one or several other substances. An illustration of this is when iron and gas mix to produce rust. Vinegar and soda soda together result in the production of water, carbon dioxide, and sodium acetate.

To know more about Chemical reaction visit:

brainly.com/question/29039149

#SPJ1

Question 8 (1 point) 2H₂ + O₂ O2 --> 2 H20 Molar mass of H2 = 2.0 O2 =32.0 H2O=18.0 If you start with 20 grams of Oz, how many moles of H2O can be made? 1.25 mol 320 mol 1280 mol 0.31 mol Question 9 (1 point)​

Answers

Answer:

the moles of H2O are equal to 1.25mol

I hope this help

Question 8 (1 point) 2H + O O2 --> 2 H20 Molar mass of H2 = 2.0 O2 =32.0 H2O=18.0 If you start with

Answer:

f

Explanation:

The atmospheric concentration of a gas depends on its emission into the atmosphere and its rates of physical, chemical and biological removal. The time to lower the concentration of the gas to 37% of its original amount is its __________.

Answers

The atmospheric concentration of a gas depends on its emission into the atmosphere and its rates of physical, chemical and biological removal. The time to lower the concentration of the gas to 37% of its original amount is its atmospheric lifetime.

What is atmospheric concentration?

The measurements of CO2 equivalents in parts per million CO2 is termed as atmospheric concentration. The pressure exerted by the atmosphere on the gas is called atmospheric pressure.

What is atmospheric lifetime?

The atmospheric lifetime of a species mainly measures the time which is require to restore equilibrium in the atmosphere that follows a sudden decrease or increase in the concentration of the species in the atmosphere.

What is Emission?

Emission is something which can be released, emitted or discharge.

Types of emission

Direct GHG emissions. Indirect electricity GHG emissions. Other indirect GHG emissions.

Thus, we concluded that the atmospheric concentration of a gas depends on its emission into the atmosphere and its rates of physical, chemical and biological removal. The time to lower the concentration of the gas to 37% of its original amount is its atmospheric lifetime.

learn more about atmospheric concentration:

https://brainly.com/question/16657469

#SPJ4

if the element A have three protons in the nucleus. find the atomic number of the element A​

Answers

Answer:

ATOMIC number of element A is 3

Explanation:

Atomic number is the same as number of protons of an element.

according to the periodic table, Lithium is the element with 3 protons in its neutral state and it's atomic number is 3.

if the element A have three protons in the nucleus. find the atomic number of the element A

The total pressure of an 02-Ar-He gas mixture is 755 mmHg. If the partial pressure of Ar is 174 mmHg
and the partial pressure of He is 389 mmHg,
then the partial pressure of 02 is what?

Answers

‍♀️‍♀️‍♀️‍♀️‍♀️‍♀️‍♀️JSHSHSH BSHSHS ja

Suppose red and green light-emitting diodes (LEDs) radiate the same amount of power in the form of light at wavelengths of 650 nm and 560 nm, respectively. Which emits more photons per second

Answers

Suppose red and green light-emitting diodes (LEDs) radiate the same amount of power in the form of light at wavelengths of 650 nm and 560 nm, respectively. LED radiating light at a wavelength of 560 nm will emit more photons per second

To determine which LED emits more photons per second, we need to consider the relationship between the energy of a photon and its wavelength. The energy of a photon is given by the equation E = hc/λ, where E is the energy, h is Planck's constant, c is the speed of light, and λ is the wavelength. Since both LEDs radiate the same amount of power in the form of light, we can compare the number of photons emitted per second by calculating the photon flux. The photon flux is given by the power divided by the energy of a single photon.

The energy of a photon is inversely proportional to its wavelength. Therefore, the LED with a shorter wavelength (560 nm) will have higher energy photons compared to the LED with a longer wavelength (650 nm). As a result, the LED emitting light at 560 nm will produce more photons per second, assuming the power output is the same for both LEDs. In summary, the LED radiating light at a wavelength of 560 nm will emit more photons per second compared to the LED emitting light at a wavelength of 650 nm, given that they have the same power output.

Learn more about photons here:

https://brainly.com/question/29409292

#SPJ11

william aston created the mass spectrograph to analyze and separated them, found 218 and found mass and percent abundance of each

Answers

The given statement " William Aston created the mass spectrograph to analyze and separated them, found 218 and found mass and percent abundance of each atoms" is false.

The mass spectrograph was not invented by William Aston. It was actually invented by J.J. Thomson in the early 20th century.

J.J. Thomson's work with the mass spectrograph led to the discovery of isotopes, which are different forms of an element with the same number of protons but different numbers of neutrons. Isotopes have different masses, and the mass spectrograph allowed scientists to separate and analyze them based on their mass-to-charge ratio.

The process of using a mass spectrograph to determine the mass and percent abundance of isotopes is known as mass spectrometry. It involves ionizing a sample, separating the ions based on their mass-to-charge ratio, and detecting the ions to determine their abundance.

The completed question is given as,

State true or false

William Aston created the mass spectrograph to analyze and separated them, found 218 and found mass and percent abundance of each atoms.

Learn more about spectrograph from the link given below.

https://brainly.com/question/31242968

#SPJ4

A sample of gas at 313 K and 4.95 atm occupies 85.62 L of space. Which
variable is the volume (V)? (Note: You are not solving the problem, just
choose the correct variable.)

Answers

Answer: 85.62 L represents volume (V).

Explanation:

Volume is defined as the amount or quantity of a given substance or an object.

According to ideal gas equation:

\(PV=nRT\)

P = pressure of gas = 4.95 atm

V = Volume of gas = 85.62 L

n = number of moles

R = gas constant =\(0.0821Latm/Kmol\)

T =temperature =\(313K\)

Thus 85.62 L represents volume (V).

Let G and H be groups. Prove if φ(g) = eH for all g ∈ G, the map φ: G to H is a group homomorphism

Answers

φ(g1 * g2) = eH = φ(g1) * φ(g2).

This completes the proof that φ: G → H is a group homomorphism.

By showing that the map φ preserves the group operation, we have demonstrated that it is a group homomorphism.

To prove that φ: G → H is a group homomorphism, we need to show that it preserves the group operation. In other words, for any two elements g1 and g2 in G, φ(g1 * g2) = φ(g1) * φ(g2), where * denotes the group operation in G, and * denotes the group operation in H.

Given that φ(g) = eH for all g ∈ G, where eH is the identity element in H, we can start the proof as follows:

Let g1, g2 ∈ G. We want to show that φ(g1 * g2) = φ(g1) * φ(g2).

Since φ(g) = eH for all g ∈ G, we have φ(g1) = eH and φ(g2) = eH.

Now, consider the product g1 * g2 in G. Applying φ to both sides, we have:

φ(g1 * g2) = φ(g1) * φ(g2).

Substituting the values of φ(g1) and φ(g2), we get:

φ(g1 * g2) = eH * eH.

Since eH is the identity element in H, the product eH * eH is simply eH.

To know more about homomorphism

https://brainly.com/question/6111672

#SPJ11

what happens if you don't disconnect the wires in a series circuit?

Answers

Answer:

the series circuit has one current so if you don't disconnect the wires nothing happens

but if you disconnect the wires in series circuit, the current stop and the current doesn't go to the end

Explanation:

(≧▽≦)hope it helps (≧▽≦)

What is the wave length of an electromagnetic radiation ,having a frequency of 5.2 x 10^12 Hz? Note: c= 3.00 x 10^8 m/s

Answers

Answer:

\( \huge{5.77 \times {10}^{ - 5} m}\)

Explanation:

The wavelength of a wave can be found by using the formula

\(\lambda = \frac{c}{f} \\\)

where

c is the speed of the wave

f is the frequency

From the question we have

\( \lambda = \frac{3 \times {10}^{8} }{5.2 \times {10}^{ 12} } \\ \\ \\ \\ \large{ = 5.77 \times {10}^{ - 5} m}\)

Hope this helps you

Is LiNO2 ionic covalent or a acid?

Answers

Answer:

ionic covalent

Explanation:

Other Questions
How many moles of O2 are needed to react with 2.55 mol of C2H2?Express your answer to three significant figures Which of the following is the classification of a fatty acid with carbon atoms linked by single carbon-carbon bonds?A saturatedB polyunsaturatedC monounsaturatedD linked How is the US Congress similar to the Assembly of Athens? Both are offices where men and women serve. Both are types of government that make and vote on laws. Both are types of court systems that rule on legal cases. Both are parts of government to which citizens have to be elected. 100 points for free :) How many atoms of nitrogen are in 0.400 moles of N205? A business that will comply with the letter of the law but no more than that is a(n) ______ business.A. Amoral.B. Legalistic.C. Responsive.D. Ethical. where do these go plz someone help To help implement his idea, Marshall called on Lt. Gen. Stanley D. Embick . . . to find a suitable location where thousands of US troops could be deployed in a series of maneuvers to test their readiness. Armed with these instructions . . . Embick traveled to central Louisiana, where the Army had trained many of its soldiers during World War I. With a tattered road map as a guide, Embick and [his aide] tramped through Louisianas backcountry, noting the roads, trails, swamps, and forests.Sparsely populated, thick with undergrowth and uncharted swamps, and scarred by rural traces that turn to muck at the slightest hint of rain, central Louisiana was an ideal place to prepare an army, with vast tracts of land that could accommodate the large-scale maneuvers the Army needed to conduct. The north-central part of the state is home to Kisatchie National Forest, a 604,000-acre virtual wilderness of pinewood hills. Just south of the national forest was Camp Evangeline, a 23,000-acre tract established by the Army in 1930. Louisiana Maneuvers by Mark PerryWhy was central Louisiana chosen as the site of the maneuvers? Check all that apply.Central Louisiana had a large population.The geography provided some challenges.A number of military bases were already located there.There were large areas of forest and wilderness.The area had been used for training during World War I. i need help but read the question on the picture. The activity cost of police protection is based on? cost per officer while on duty. cost of overtime. cost per arrest. cost per incident type. PLZ HELP ASAP DUE TMR NEED RN TYSM please & thank you Imagine you are a social entrepreneur seeking out opportunities to improve Singapore society using practical, innovative and sustainable approaches. Please briefly describe your business concept, and explain how it would contribute positively to Singapore society. what other complications would occur from an abnormal enlargement of the prostate? What are the 4 types of research methods? you are given two nucleic acids; one rna and the other dna. what are the main features to determine which is the dna? solve please and thank you itll help a lot. 15 points. The WAIS consists of separate ________ subtests.A)verbal and performanceB)convergent and divergent thinkingC)emotions and reasoningD)intelligence and creativityE)aptitude and achievement Someone pls help i need number 5 for studies weekly 15 "sow the seeds of victory" its due tommorow Which equation would you use to solve the following situation?Ms. Green has 18 pencils at her desk. Students borrow some of the pencils, and 6 pencils are left at the end of the school day. How many pencils were borrowed?x - 6 = 1818 - x = 618 + 6 = xx - 18 = 6 Insulin is a protein that is produced by pancreatic cells and secreted from the cell into the bloodstream. Which of the following options correctly lists the order of the structures through which insulin passes from its production to its exit from the cell? Smooth ER, lysosomes, vesicles, plasma membrane Vesicles, rough ER, Golgi apparatus, vacuole, cell membrane Rough ER, vesicles, Golgi apparatus, vesicles, plasma membrane Rough ER, Golgi apparatus, smooth ER. plasma membrane