Crossing an individual who is homozygous dominant for a trait with an individual whose genotype is unknown will most likely produce which set of offspring?.

Answers

Answer 1

This type cross is called as test cross.

Mendel also devised a method to determine whether an organism had a dominant phenotype (such as a yellow-seeded pea plant) and whether it was heterozygote (Yy) or homozygote.

Breeders of plants and animals still employ this method, which is known as a test cross.

All the offspring produced by the parent with the unknown genotype will have at least one dominant allele if the parent is homozygous dominant.

A recessive allele will be inherited from both parents and result in a recessive phenotype in 50% of the offspring if the parent with the unknown genotype is heterozygous.

To know more about the test cross :

https://brainly.com/question/20419521.

#SPJ4.


Related Questions

where does the life in the forest start

Answers

Answer:

I would think migration, or evolution to a new species to adapt to the rain forest, temperate forest, or a climate temperate forest.

Explanation:

Explain the importance of active transport in humand and plants​

Answers

Answer:

Hey

Active transport is important because it allows the cell to move substances against the concentration gradient.

Hope this helps..

Answer:

Active transport is important because it's essencial for the movement of nutrients and substances all around the body and plant

A father has blond hair. A mother has black hair. Their three offspring have brown hair, blond hair, and red hair, respectively. Which pattern of inheritance could account for human hair color? Explain your answer.

Answers

Answer:

polygenic inheritance

Explanation:

The pattern of inheritance that could account for human hair color according to the illustration is polygenic inheritance.

In polygenic inheritance, multiple alleles (the alternate versions of the same genes) controls the trait for hair color. Individuals that inherit different combinations of alleles from the same parents will have different hair colors.

In this case, there are alleles that determines blond hairs, black hairs, brown hairs, and red hairs. All these alleles are alternate versions of the same gene. The father could be carrying blond/brown alleles and the mother is carrying black/red alleles or vice versa, their offspring will exhibit different hair color depending on which allele is dominant or recessive.

which observation makes this theory less likely than the idea that the universe may continue to expand?

Answers

Answer:

Explanation:

I would assume you mean it will shrink

because of the rocks in the universe and gasses, etc. This should create more planets causing the universe to get enlarged

Which is the RNA made during transcription of the following DNA template?
-G-C-T-T-A-G-T-C-C-A-T-T-
A) -C-G-A-A-U-CA-G-G-U-A-A-
B) -C-G-U-U-T-C-U-G-G-T-U-U-
C) -C-G-A-A-T-C-A-G-G-T-A-A-
D) -C-G-T-T-U-C-T-G-G-U-T-T-

Answers

Answer:

Explanation:

A

Part A

In this experiment, you will place the container in the freezer. What do you think will happen?
30points✌✌✌

Answers

If you put a container of water in the freezer and the container is completely full and sturdy enough to prevent any expansion, the water will not remain liquid. Water expands when it freezes, and this expansion creates a significant amount of force.

How to explain the information

In such a situation, the water will exert pressure on the walls of the container as it freezes. If the container is strong enough to withstand this pressure, it may remain intact, but the expansion of the water will cause the container to deform or rupture eventually.

However, it's worth noting that it is highly unlikely to find a container that is completely rigid and strong enough to prevent any expansion of water. The force exerted by freezing water is quite powerful, and it can typically overcome the strength of most containers.

Learn more about water on

https://brainly.com/question/1313076

#SPJ1

What happens if you put a container of water in the freezer, and the container is so full and so sturdy that the water has no space to expand into as it becomes ice? Does the water remain liquid?

A statement in the introduction read, “All other factors remained the same between the two groups.” Make a list of factors that must remain constant in the experiment.

Answers

The factors that must remain the same in an experiment are known as control variables.

In order to conduct a proper experiment, there must be 3 kinds of variables. These are:

Dependent variableIndependent variableControl variable

A dependent variable is a variable that the experiment seeks to observe, this variable is expected to change in value throughout the experiment and depends on other variables. An independent variable is one that the researcher changes throughout the experiment in order to see what effect it will have on the dependent variable.

The variables referred to in the question are control variables. Control variables are the factors that must remain constant in an experiment. This is to ensure that when we measure a change in the dependent variable, we know to attribute it to the correct cause of the change. The presence of control variables helps to ensure a valid experiment and limits the influence of other factors on the outcome.

For more on Experiment variables see:

https://brainly.com/question/24372733

on 1 in this exercise, the kirby-bauer diffusion test was used to test the sensitivity of s. epidermidis to penicillin, novobiocin, and gentamicin. what results would you predict if the sensitivity of e. coli was tested. explain your answer.

Answers

In the Kirby-Bauer test, bacteria are plated on solid growth medium and antibiotic wafers (white disks, pictured) are added to the plate.

After allowing the bacteria to grow overnight, areas of clear medium surrounding the discs indicate that the antibiotic inhibits bacterial growth. If the observed inhibition zone is greater than or equal to the size of the standard zone, the microorganism is considered to be sensitive to the antibiotic. On the contrary, if the observed inhibition halo is smaller than the standard size, the microorganism is considered to be sensitive. it is resistant. Advantage. This test is used to determine the antibiotic of choice to treat an infection. It can be useful for monitoring antimicrobials and for the selection of suitable antibacterial agents. It does not require special equipment for its performance and can be interpreted by all medical personnel. The test is done by taking a sample from the infected site. The most common types of tests are listed below. A health professional will take a blood sample from a vein in his arm with a small needle. After the needle is inserted, a small amount of blood will be collected in a test tube or vial.

To learn more about microorganism  please click on below link

https://brainly.com/question/6699104

#SPJ4

Using the diagram, which of the structures is the oldest?

H
F
M
B

Using the diagram, which of the structures is the oldest?HFMB

Answers

I would say B so yea...hope ur day doing well

Answer:

Im saying that its B or H

Explanation:

How does water enter the atmosphere? a. liquid water evaporates from lakes when heated by the sun. b. frozen water sublimates from ice and snow. c. liquid water is lost from tree leaves during evapotranspiration. d. all of the above. please select the best answer from the choices provided a b c d

Answers

Answer:

d

Explanation:

Water enters the atmosphere by :

liquid water evaporates from lakes when heated by the Sun

frozen water sublimates from ice and snow

⇒ liquid water is lost from tree leaves during evapotranspiration

Answer:

d. all of the above

Explanation:

tried on ed and it was correct :)

Fruits grown in hot climates are usually less sweet than those grown in cooler temperatures. The high temperatures increase the rate of respiration in the plants, thus reducing the sugar content in some fruits. Why does increased respiration in the leaves and stems reduce the sugar content in the fruits of a plant

Answers

Answer:

The correct answer is - Sugars produced in the leaves are used as an energy source instead of being stored in fruits.

Explanation:

The high temperature in climate leads to an increase in the respiration rate in the plants so they require more energy in the process.

They produce sugars in the leaves which leads to a decrease in the sugar content in the fruit as energy is the primary focus in such situation to survive in high temperatures.

What is it like to be a dog? Humans can answer, but I really want the opinion of someone who has experience being a dog.

Answers

Answer:

this probably isn't a real answer but if I were a dig I would love the fact I could pee anywhere

how the structure of dna determines the structure of proteins which carry out the essential functions of life through systems of specialized cells.

Answers

The structure of DNA determines the structure of proteins because proteins are made by the central dogma process where DNA is the initial component.

In the process of the central dogma, transcription is the process through which the DNA is transcribed into the mRNA. Through the information in the mRNA, proteins are produced by the translation process.

Hence, the structure of proteins as well its function etc are all determined by the DNA whose information is transcribed and translated for the formation of that particular protein.

Each protein formed from the transcription and translation of DNA has a specialized function to perform.

To learn more about the DNA, click here:

https://brainly.com/question/16099437

#SPJ4

A plant leaf is an organ. In what way is a human lung similar to a plant leaf? Choose the correct answer. Both organs make chemical energy. Both organs are made up of only one kind of cell. Both organs are made up of protective dermal tissue. Both organs exchange oxygen and carbon dioxide.

Answers

Answer:

Both organs exchange oxygen and carbon dioxide.

Explanation:

This is because the plant leaf exchange gases during photosynthesis where it uses carbondioxide and water in the presence of light energy and chlorophyll to produce carbohydrates and oxygen. Therefore oxygen is given out to the atmosphere and carbondioxide is taken in.

The lungs also is an organ of respiration, it is where exchange of gases take place where oxygen is taken in through breathing and carbondioxide is given out as by product.

7. Considere un sistema que contiene un mol de un gas monoatómico retenidito por un pistón. ¿Cuál es el cambio de energía interna del gas, Q: 40?0J y W: 200.0J?

Answers

Un mol de un gas monoatómico cuyo calor absorbido es 40.0 J y cuyo trabajo recibido es 200.0 J experimenta un cambio de energía interna de 240.0 J.

Tenemos un mol de un gas monoatómico en un recipiente con un pistón y suceden las siguientes transferencias de energía:

El gas absorbe 40.0 J de calor, ya que Q > 0.El gas recibe 200.0 J de trabajo, ya que Q > 0.

Podemos calcular el cambio de energía interna del gas (ΔU) usando la siguiente fórmula.

\(\Delta U = Q + W = 40.0 J + 200.0 J = 240.0 J\)

Un mol de un gas monoatómico cuyo calor absorbido es 40.0 J y cuyo trabajo recibido es 200.0 J experimenta un cambio de energía interna de 240.0 J.

Aprende mas: https://brainly.com/question/21913262

7. Considere un sistema que contiene un mol de un gas monoatómico retenidito por un pistón. ¿Cuál es el cambio de energía interna del gas, Q: 40.0 J y W: 200.0J?

paleolithic peoples used swan bones for what creative purpose?
A. Clothing ornaments
B. Body piercings
C. Paint brushes
D. Flutes

Answers

Paleolithic peoples used swan bones for Flutes creative purpose

Paleolithic peoples used swan bones to create flutes. The oldest known flute, made from the bone of a vulture, is over 43,000 years old and was discovered in Hohle Fels cave in Germany.

Flutes were likely used for musical performances and religious rituals. Other bone flutes have been found throughout Europe and Asia, indicating that music was an important part of Paleolithic culture.

The use of bone for musical instruments also suggests the creativity and resourcefulness of these early humans, who were able to repurpose animal remains for artistic expression.

The discovery of these flutes offers insights into the cognitive and social capabilities of Paleolithic peoples, and sheds light on the evolution of human culture and creativity.

To know more about "Paleolithic peoples " refer here:

https://brainly.com/question/18102917#

#SPJ11

Which of these are functions of the ear? (Select all that apply.) A.receiving light energy B.hearing C.emitting sound waves D.balance​

Answers

Answer:

B. Hearing.

D. Balance.

Explanation:

The ears are organs that provide two main functions: hearing and balance that depend on specialized receptors called hair cells.

Which reasons are the best for using only the fine-focus knob under high power? Select two.

The diaphragm will not open wide enough by using the fine-focus knob.

The stage or objectives move very little when the knob is turned.

The objective will not move enough to risk breaking the glass slide.

The coarse-focus knob will not turn when the microscope is set for high power.

Answers

Under high power, only the fine-focus knob should be used: When the knob is turned, neither the stage nor the goals move much. The objective won't move fast enough to put the glass slide at risk.

Option B and C are  correct.

What exactly are the purposes of microscopes?

A microscope is a tool for magnifying small objects. Some microscopes can be used to study an object even at the cellular level, allowing researchers to observe the shape of a cell as well as its nucleus, mitochondria, and other organelles.

To precisely adjust the specimen's focus, use the Fine Focus knob. Also, featuring explicit region of the specimen is utilized. Before switching to the fine focus knob for fine tuning, the coarse focus knob should be used frequently to get close. Move the fine adjustment knob with care in your body's direction. You might not be able to turn this knob all the way around.

Incomplete question:

Which reasons are the best for using only the fine-focus knob under high power? Select two.

A. The diaphragm will not open wide enough by using the fine-focus knob.

B. The stage or objectives move very little when the knob is turned.

C. The objective will not move enough to risk breaking the glass slide.

D. The coarse-focus knob will not turn when the microscope is set for high power.

To learn more about microscope :

brainly.com/question/820911

#SPJ1

the skin, mucus, cilia, and lymph nodes are components of

Answers

The skin, mucus, cilia, and lymph nodes are components of the body's immune system, which is responsible for defending against pathogens and foreign substances.

The skin acts as a physical barrier, preventing entry of microorganisms. Mucus, found in the respiratory and digestive tracts, traps pathogens and particles, preventing their entry into the body.

Cilia, hair-like structures in the respiratory tract, help to sweep out mucus and trapped particles, further protecting against infection. Lymph nodes, located throughout the body, contain immune cells that help filter and destroy pathogens.

Together, these components form a complex defense system that plays a vital role in maintaining overall health and fighting off infections.

To know more about microorganisms, refer here:

https://brainly.com/question/9004624#

#SPJ11

Match each environmental change with its description.



Chemicals react with water and oxygen that enter water systems.


arrowBoth


Nutrients in excessive amounts enter water systems, causing algal bloom.


arrowBoth


A high concentration of toxic chemicals is present in the bodies of animals at the highest trophic levels.


arrowBoth

Answers

Answer:

The question is incomplete, the missing part i.e. the environmental change is:

(A) biomagnification

(B) acid rain

(C) eutrophication

The answers are:

1. Acid rain- Chemicals react with water and oxygen that enter water systems.

2. Eutrophication- Nutrients in excessive amounts enter water systems, causing algal bloom.

3. Biomagnification- A high concentration of toxic chemicals is present in the bodies of animals at the highest trophic levels

Explanation:

1. Acid rain is an environmental disorder in which rainfall becomes acidic due to pollution. The pollution is as a result of the release of gaseous chemicals e.g sulfur, nitrogen oxide, which are produced by industries, into the atmosphere. These chemicals then react with water in the atmosphere to form acidic solutions, which then falls back as rain. Hence, chemicals reacting with water and oxygen that enter water systems describes ACID RAIN.

2. Eutrophication is the pollution of water bodies with substances containing chemicals like nitrogen, phosphorus etc. The chemicals, which are in excess, serve as nutrients to algae, which uses them to grow excessively forming a bloom called ALGA BLOOM. Hence, nutrients in excessive amounts entering water systems, causing algal bloom describes EUTROPHICATION.

3. Biomagnification refers to the build up or accumulation of toxic chemical substances in the body systems of living organisms higher up in the food chain. Pollutants like pesticides, herbicides flow into water bodies and are absorbed by certain aquatic organisms. When these organisms are fed on by consumers, the harmful substances accumulates in their tissues until it reaches a maximum concentration. Hence, a high concentration of toxic chemicals present in the bodies of animals at the highest trophic levels describes BIOMAGNIFICATION.

Answer:

1. Acid rain- Chemicals react with water and oxygen that enter water systems.

2. Eutrophication- Nutrients in excessive amounts enter water systems, causing algal bloom.

3. Biomagnification- A high concentration of toxic chemicals is present in the bodies of anima

Explanation:

16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form • Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe

Answers

The phenotype is affected by mutations 1 and 2 because in the first, the complete protein is altered, and in the second, the new amino acid may cause the protein to have altered or no function.

What is Mutation?

Mutations can happen naturally or as a result of UV rays, congenital conditions, ionic radiations, or specific free radicals.

Even with the point mutation, there is no alteration to the amino acid sequence, hence the protein will not be affected.

In mutation 1, a new nucleotide is added at codon 9, changing the whole sequence of amino acids and codons in the process,  mutation frameshift.

Because a new codon was created as a result of the substitution of one nucleotide by another in mutation 2, produced a new amino acid, so Point mutation.

Therefore, in mutation 3, one nucleotide is swapped out for another, and the resulting codon codes the same amino acid as the one before it, so point mutation.

Learn more about mutation, here:

https://brainly.com/question/17130462

#SPJ4

what does several mean



Answers

More than one/once.

Which part of the brain is responsible for coordination and balance?
Spinal cord
1
Cerebrum
2
Cerebellum
3
Brainstem
4

Answers

Answer:

The answer is cerebellum.

Explanation:

As the function of cerebellum are,

To maintain equlibrium and control the posture of a body.It makes body movements smooth , steady and co- ordinated.It also coordinate and regulates the contraction of skeletal muscles.

Hope it helps...

regulates glycogen phosphorylase b in the muscle___

Answers

The regulator of glycogen phosphorylase b in muscle is the hormone adrenaline (also known as epinephrine).

Adrenaline activates a signaling pathway in muscle cells that leads to the activation of glycogen phosphorylase b, which in turn leads to the breakdown of glycogen into glucose.

Another important regulator of glycogen phosphorylase b in muscle is the enzyme protein kinase A (PKA). PKA is activated by another hormone called glucagon, which is released by the pancreas when blood glucose levels are low. Activated PKA then phosphorylates and activates glycogen phosphorylase b, leading to the breakdown of glycogen.

In addition to these hormonal and signaling pathways, glycogen phosphorylase b in muscle can also be regulated by other factors such as calcium ions, which can activate an enzyme called phosphorylase kinase, leading to the activation of glycogen phosphorylase b

Know more about Adrenaline here :

brainly.com/question/1082168

#SPJ11

A community in ecology is defined as ________. A. living and nonliving things in one place B. populations from multiple species interacting in the same place C. a population and its surrounding environment D. populations from multiple species interacting in the same place, and their surrounding environment

Answers

The correct answer is option D.

A community in ecology is defined as populations from multiple species interacting in the same place, and their surrounding environment.

What is Ecology?

Ecology is the study of organisms, the environment and how the organisms interact with each other and their environment.

It is studied at various levels, such as;

organismpopulationcommunitybiosphereecosystem.

The main goal of ecology is to improve the understanding of life processes, adaptations and habitats, interactions and biodiversity of organisms.

A community may involve different populations from different species interacting within themselves and other species in the same place, and also interacting with their surrounding environment.

Learn more about ecology:https://brainly.com/question/780274

#SPJ1

Which statement best describes an organ? A. Different types of tissues work together to carry out a function. B. Cells of one type work together to carry out a function. OC. This is the simplest level of organization of life OD. This is the most complex level of organization of life​

Answers

Explanation:

The statement that best describes an organ is:

A. Different types of tissues work together to carry out a function.

An organ is a structure composed of different types of tissues that work together to perform a specific function in an organism. Organs are more complex than cells and tissues, but they are not the most complex level of organization in life. The most complex level of organization would typically refer to systems or organisms as a whole.

What is the medical term used for changes in virility or sexual desire in middle-aged men?a. menarcheb. viropausec. perimenopaused. male menopause

Answers

The medical term used for changes in virility or sexual desire in middle-aged men is "male menopause," also known as andropause or testosterone deficiency syndrome.

This term refers to the age-related decline in testosterone levels, which can lead to changes in sexual desire, energy levels, and other aspects of men's health.It is characterized by a gradual decline in testosterone levels in men over the age of 50, leading to symptoms such as decreased libido, erectile dysfunction, fatigue, and mood swings. Unlike menopause in women, which is a sudden cessation of ovarian function, andropause is a gradual process and testosterone levels can vary widely among individuals. Treatment options may include testosterone replacement therapy, lifestyle modifications, and medications to manage specific symptoms.

To know more about andropause:

https://brainly.com/question/29611014

#SPJ11

Which of the following is not being undertaken to reduce the risks to human health from pesticides?

a. only promote pesticide use in rural environments
b. protect workers exposed to pesticides occupationally
c. regulate the safe use of pesticides
d. reduce the concentration of pesticides found in watersheds

Answers

Answer:

A

Explanation:

pesticides are normally used in rural environments anyway, doing this would make it worse

a. only promote pesticide use in rural environments is not being undertaken to reduce the risks to human health from pesticides.

Pesticides are chemicals used to control pests, but they can also pose risks to human health and the environment. To reduce the risks to human health from pesticides, it is important to regulate their safe use and protect workers who are occupationally exposed.

Additionally, it is important to reduce the concentration of pesticides found in watersheds to further minimize their impact on human health and the environment.

Pesticides can have negative impacts on human health, such as causing cancer, reproductive problems, neurological effects, and developmental delays. Therefore, efforts are being made to reduce these risks by regulating the safe use of pesticides, protecting workers who are exposed to pesticides occupationally, and reducing the concentration of pesticides found in watersheds.

Learn more about Pesticides at:

https://brainly.com/question/30295459

#SPJ7

4. Why is it is more important for DNA replication to be exact than for transcription or translation to be exact? (1 point)



5. A gene has a base sequence of GTC. Due to a mutation, the base sequence changes to GTG. Answer the following questions using the codon table below.

4. Why is it is more important for DNA replication to be exact than for transcription or translation

Answers

It is more important for DNA replication to be exact than for transcription or translation to be exact because DNA is the genetic material that contains the instructions for building proteins.

The mutation from GTC to GTG within the genetic sequence induces a modification in the amino acid generated from the gene. This has the potential to exert an adverse influence on the functionality of the resulting protein.

What is mutation?

A mutation denotes an alteration in the DNA sequence of an organism. Various factors, such as inaccuracies during DNA replication, exposure to mutagenic agents in the environment, or viral infections, can instigate mutations. These genetic modifications can manifest as advantageous, detrimental, or inconsequential.

Mutations serve as a significant wellspring of genetic diversity within a population. This genetic diversity plays a vital role in the process of evolution, as it empowers populations to acclimate to shifts in their surroundings.

Learn about mutation here https://brainly.com/question/17031191

#SPJ1

You type the keywords "formation of coal" into a
search engine. Which of the following search
results would you expect to provide the most
accurate information about how coal forms?

You type the keywords "formation of coal" into asearch engine. Which of the following searchresults would

Answers

The most accurate information would most likely come from source C
Other Questions
Which European countries colonized Africa as a result of the Berlin Conference list them? how could you determine whether the turbidity in your nutrient broth tube was from a mixture of different microbes or from the growth of only one kind of microbe 1) Expand and simplify the following:a)3(x squared plus 3x cubed - 2) if you want to prevent sales reps from changing the contents of a bundle, which field do you update on the bundle product? In the light reactions of photosynthesis, atp is produced by photophosphorylation. Which of the listed processes is most similar to photophosphorylation?. 2000 note length in world of Rohani is tool that is an example of stock or flow variable Find the QT plzzzzzzz If there was no system of writing in the world today describe one way that your life would be different that doesnt involve school or school work.take your time and answer when you are ready :) help ASAP please plz Find (f g)(0). *f(x) = 5x 4g(x) = x^2 1O A.3OB. -9O c.-4O D.-17 TRUE / FALSE. the early years of prohibition did show positive effects in the area of public health and alcohol-related deaths, cirrhosis, mental disorders, and alcohol-related crime declined. Mayan Civilization:describe the classic period of the Mayan civilization here! what were their achievements? art/architectures? /science/math: write a user-defined function, called reverser, that takes a string, s, as input and returns a string that is that one in reverse. How does The Great Gatsby connect to the American Dream? Why did French never resolve the issue with Mi'kmaq? ( the issue is Mi'kmaq loosing the territory) Need the final answer please You are given a set of n (closed) intervals on a line: [a, b], [a2, b2), ..., [an, bn). Design an O(n log n) time greedy algorithm to select the minimum number of points on the line between [min; Q, max; bj] such that any input interval contains at least one of the chosen points. Example: If the following 5 intervals are given to you: [2,5), (3,9), (2.5, 9.5], [4,8], [7,9), then a correct answer is: {5,9} (the first four intervals contain number 5 and the last contains number 9; we also definitely need two points since (2,5) and (7,9) are disjoint and no single point can take care of both of them at the same time). Which of the following terms includes all the others? a. angiosperm b. gymnosperm c. vascular plant d. fern e. seed plant correct the error 4- 4=4 What is the importance of identifying the problem and asking questions in making a research paper?