convert the following to seconds 5 minutes 7 seconds

Answers

Answer 1

Answer: 307 seconds

Explanation: one second is 60 seconds. Do 60 times five which gives you 300. Then add the extra seven seconds. Your answer: 307 seconds!

I hope this is helpful!


Related Questions

Which of the following has NOT
contributed to the exponential
growth of the human population?
A. mass production of foods
B. advances in medicine
C. virulent and antibiotic-resistant bacteria
D. improved infant survival rates

Answers

Answer:

A

Explanation:

food does not contribute to exponential human growth

Mass production of foods is not contributed to the exponential growth of the human population, hence option A is correct.

What is exponential growth?

Quantity rises over time through a process called exponential growth. When a quantity's instantaneous rate of change with regard to time is proportionate to the quantity itself, it happens.

Exponential expansion is the name for this rapid pattern of population growth. Bacteria are the best example of exponential development.

Prokaryotes like bacteria divide by prokaryotic fission. For many bacterial species, this division takes around an hour.

Therefore, mass production of foods is not contributed to the exponential growth of the human population, hence option A is correct.

Learn more about exponential growth, here:

https://brainly.com/question/28638105

#SPJ2

In eukaryotes, the Krebs cycle takes place within the

Answers

It takes place within the mitochondria.

What are the types of tundra ecosystems? (Select all that apply.)

subarctic

antarctic

alpine

arctic

Answers

Answer:

all of the below except for the above.

Explanation:

Arctic Tundra which occurs north of the taiga belt in the far Northern Hemisphere

Alpine tundra which prevails above the tree line in mountains worldwide

Antarctic tundra which includes several sub-Antarctic islands and parts of the continent of Antarctica

what are the components of soil​

Answers

Hi! The components of soil are: minerals, organic matter, water, & air. Hope this helps!

Answer:

common components of the soil are

Rock and soil particles of different sizesvariety of mineral salts presents in soil soil water soil airsoil organisms : fungus microbes wormshumus

what are the components of soil

.5km/sec north by northwest is an example of
speed
acceleration
velocity
distance

Answers

Answer:

The answer is Distance.

What is it called when genes that travel on the x chromosomes

Answers

I don’t really understand this but each person usually has one pair of sex chromosomes in each cell. Females typically have two X chromosomes, whereas males typically have one X and one Y chromosome. Genetic disorders that are due to mutations in genes on the X chromosome are described as X linked.

how do you dispose of non-sharp contaminated materials that will not release blood or opim when compressed, and are not caked with blood/opim?

Answers

To dispose of non-sharp contaminated materials that will not release blood or opim when compressed and are not caked with blood/opim, it is essential to know the safe practices involved in medical waste management.

To dispose of non-sharp contaminated materials that will not release blood or opim when compressed and are not caked with blood/opim:

1. First, segregate all contaminated materials, and place them in medical waste containers that are correctly labelled.

2. The biohazard bags should be tightly sealed with a red bag tie and then placed in a secondary container (red trash bin).

3. A biohazard symbol must be placed on all containers that have medical waste material.

4. Once the biohazard bags have been sealed, they should be transported to the designated waste management area.

5. The healthcare facility should ensure that the waste management company used for medical waste disposal is compliant with all local and state regulations on medical waste management and disposal.

6. Once the medical waste has been collected, it should be treated or disposed of appropriately. This includes incineration, chemical disinfection, or autoclaving depending on the waste type.

7. A medical waste disposal certificate should be provided by the waste management company to verify that the medical waste has been properly disposed of.

To know more about medical waste, refer

https://brainly.com/question/32662534

#SPJ11

Which of the following cells do not have specialized tasks in an organism?

Answers

Explanation:

wat are the options fron the question

what happens during homeostasis?

Answers

I think Homeostasis pretty much means, your cells are in balance and are functioning smoothly. Your body is running smoothly.

The two systems most responsible for maintaining homeostasis are the:.

Answers

The two systems most responsible for maintaining homeostasis are the nervous system and the endocrine system.

Homeostasis is the body's ability to maintain stable internal conditions despite external changes. To maintain homeostasis, the body relies on two key systems: the nervous system and the endocrine system. The nervous system is responsible for controlling and coordinating body functions through electrical signals.

It is made up of the central nervous system (brain and spinal cord) and the peripheral nervous system (nerves that branch out from the spinal cord and connect to the rest of the body). The nervous system is responsible for sensing changes in the environment and responding to those changes to maintain homeostasis. The endocrine system, on the other hand, uses hormones to regulate body functions.

To know more about homeostasis visit:

https://brainly.com/question/28270473

#SPJ11

use the oxygen-dissociation curve below to answer the following question. how does affinity to hemoglobin in fetal blood compare to maternal blood and what does this mean regarding oxygen loading to hemoglobin?

Answers

The oxygen-dissociation curve shows the relationship between the partial pressure of oxygen (PO2) and the percentage of hemoglobin saturated with oxygen (% saturation).

The curve for fetal blood is shifted to the left of the curve for maternal blood. This means that fetal hemoglobin has a higher affinity for oxygen than adult hemoglobin, and as a result, fetal blood is able to pick up oxygen more easily from the maternal blood in the placenta. This shift is due to the presence of fetal hemoglobin, which has a different structure than adult hemoglobin and allows for a greater affinity for oxygen. This is important for the transfer of oxygen from the mother to the fetus during pregnancy.

Learn more about the oxygen-dissociation curve

https://brainly.com/question/28125533

#SPJ4

Plzz Help!! Do not do it for the points plz i really need help on this

Plzz Help!! Do not do it for the points plz i really need help on this

Answers

Answer:

0%

Explanation:

Answer:

0%

If you do a punnett square and cross multiply the genotypes,you will find that all the genotypes turn out to be Bb. Meaning black fur,to get white fur you will need Bb×Bb genotypes or Bb×bb genotypes:)

i attqched my work to help visualize

Plzz Help!! Do not do it for the points plz i really need help on this

Where are materials stored in single celled organisms?

Answers

Answer: Ribosomes most of the time.

Explanation:

Explain what white light is and what it's made of, what do we see it as
PLZ HURRY

Answers

Answer:

The electromagnetic spectrum covers electromagnetic waves with frequencies ranging from below one hertz to above 1025 hertz, corresponding to wavelengths from thousands of kilometers down to a fraction of the size of an atomic nucleus. This frequency range is divided into separate bands, and the electromagnetic waves within each frequency band are called by different names; beginning at the low frequency (long wavelength) end of the spectrum these are: radio waves, microwaves, infrared, visible light, ultraviolet, X-rays, and gamma rays at the high-frequency (short wavelength) end. The electromagnetic waves in each of these bands have different characteristics, such as how they are produced, how they interact with matter, and their practical applications. The limit for long wavelengths is the size of the universe itself, while it is thought that the short wavelength limit is in the vicinity of the Planck length.[4] Gamma rays, X-rays, and high ultraviolet are classified as ionizing radiation as their photons have enough energy to ionize atoms, causing chemical reactions.

Explanation:

Answer:Each color has a different wavelength. Red has the longest wavelength, and violet has the shortest wavelength. When all the waves are seen together, they make white light. White light is actually made of all of the colors of the rainbow because it contains all wavelengths, and it is described as poly chromatic light.

Explanation:

Hope this helps :)

Based on what you learned in PBS, what are three foods that would be considered good energy sources? Explain your choices. Bean, nuts, and green vegetables are considered good energy sources. They are high in fiber and low on the glycemic index.

Answers

Based on PBS, the three foods that would be considered good energy sources is bean, nuts, and green vegetables, these foods are recommended as they are high in fiber and low on the glycemic index that increase energy levels.

They are perfect for maintaining energy levels throughout the day without any sudden crashes. Basically, the glycemic index is a scale that ranks foods based on the impact they have on blood sugar levels. Foods that are high on the glycemic index are quickly digested and can cause a rapid increase in blood sugar levels followed by a quick crash. Nuts and beans are low on the glycemic index, and they contain healthy fats and protein, which provide long-lasting energy.

Green vegetables such as spinach, kale, and broccoli are high in nutrients such as iron, which is essential for carrying oxygen to the muscles. This makes them a great source of energy as they help maintain healthy blood flow, reduce inflammation and provide natural fuel to the body. In conclusion, incorporating beans, nuts, and green vegetables into your daily diet is an excellent way to increase energy levels. They provide lasting energy without sudden crashes and are nutrient-dense.

Learn more about glycemic index at

https://brainly.com/question/32417596

#SPJ11

Why are non-native, invasive species sometimes problematic for ecosystem stability?​

Answers

Answer:

The bring problems with them.

Explanation:

For example if you bring a insect from over seas and it gets releast into a farm land it could kill off all the crops.


Please answer ASAP.
Essay (10 pts) In a superheterodyne receiver, the selected RF signal is converted to IF signal before demodulation. Explain why this conversion process is necessary.

Answers

In a superheterodyne receiver, the selected RF signal is converted to IF signal before demodulation. This conversion process is necessary to make the demodulation process simpler and more effective. The conversion process also helps in increasing the receiver’s selectivity and sensitivity.

The superheterodyne receiver is the most commonly used type of receiver in modern radio receivers. The conversion process is done by using a local oscillator. The local oscillator frequency is usually set to a value that is higher than the incoming RF frequency. The difference between the local oscillator frequency and the incoming RF frequency is called the intermediate frequency (IF).The conversion process is necessary for the following reasons:

1. Improved selectivityThe conversion process makes it possible to use a high-Q filter at the IF. This makes the receiver more selective and helps to eliminate unwanted signals that may be present at the RF frequency.

2. Improved sensitivityThe conversion process helps to improve the sensitivity of the receiver. This is because the IF can be amplified more easily than the RF signal. This allows for the use of high-gain amplifiers, which results in improved sensitivity.

3. Simplification of the demodulation processThe demodulation process is made simpler and more effective by converting the RF signal to an IF signal.

This is because the IF signal is usually at a lower frequency and therefore easier to demodulate. The demodulator circuitry is also simpler because it only needs to operate at the IF frequency, rather than the higher RF frequency.In conclusion, the conversion of the RF signal to an IF signal is necessary in a superheterodyne receiver to improve selectivity, sensitivity, and to simplify the demodulation process.

To learn more about superheterodyne

https://brainly.com/question/33456279

#SPJ11

What are the three ways atoms get to eight valence electrons? Explain

Answers

Answer:

Any element in group 18 has eight valence electrons (except for helium, which has a total of just two electrons). Examples include neon (Ne), argon (Ar), and krypton (Kr).

Explanation:

Hello, I would love to know why do humans cry.

Answers

Answer:

because women(;

Explanation:

Answer:

The answer is at the bottom!! ;)

Explanation:

Humans have to cry because when you cry your body releases endorphins and oxytocin. These natural chemical messengers help relieve emotional distress along with physical pain. In other words, crying is a self-soothing behavior.

Hope this answers your question!! ;)

If a population of geese is sampled by scientists and is found to be experiencing growth, then which of the following is accurate?
Select one or more:
a. Births outnumbered deaths, on average, over the period studied
b. The birds are growing to a larger size each year
c. There is no limit to the population size
d. No geese are dispersing out of the population
e. Deaths outnumbered births every year of the study

Answers

If a population of geese is sampled by scientists and is found to be experiencing growth, then a. Births outnumbered deaths, on average, over the period studied. This indicates that there were more geese born than dying during the study, resulting in a growing population. A. Births outnumbered deaths, on average, over the period studied


Based on the information provided, if a population of geese is experiencing growth, the following statement is accurate:
a. Births outnumbered deaths, on average, over the period studied
This indicates that there were more geese born than dying during the study, resulting in a growing population.

To know more about deaths visit:

https://brainly.com/question/31108171

#SPJ11

what is a function of a gene that does not produce protein​

Answers

Answer:

Noncoding DNA does not provide instructions for making proteins. Scientists once thought noncoding DNA was “junk,” with no known purpose. However, it is becoming clear that at least some of it is integral to the function of cells, particularly the control of gene activity

explain photosynthesis in 3 stages (you may include more) you must use the following vocabulary words in your written explanation and underline them:chloroplasts chlorophyll stomata oxygen carbon dioxide raw material, products, glucose) sure to Define and state carbon dioxide role in the process and explain oxygen and why it's a byproduct

Answers

Answer:

Write one page about something that happened to youWith interest Grammar

The process by which plants convert carbon dioxide, water, and sunshine into oxygen and sugar-based energy is known as photosynthesis.

What is Photosynthesis?

Plants absorb water (H2O) and carbon dioxide (CO2) from the soil and atmosphere during photosynthesis. Water is oxidized, which means it loses electrons, while carbon dioxide is reduced, which means it receives electrons, inside the plant cell.

Water is converted into oxygen and carbon dioxide into glucose as a result. After storing energy within the glucose molecules, the plant releases the oxygen back into the atmosphere.

Light-dependent reactions and light-independent reactions are the two main stages of photosynthesis. The light-dependent reaction, as its name implies, occurs inside the thylakoid membrane and necessitates a constant supply of sunshine.

Therefore, The process by which plants convert carbon dioxide, water, and sunshine into oxygen and sugar-based energy is known as photosynthesis.

To learn more about photosynthesis, refer to the link;

https://brainly.com/question/1388366

#SPJ2

explain the two changes that rauch describes that weakened parties. make sure you understand his point.

Answers

Rauch identifies two changes that have weakened political parties which are the decline of party bosses and the rise of interest groups.

In his book Political Parties and Political Survival, Rauch explains that two changes have weakened parties. These changes are:

1. Decline of Party Bosses: The primary election system, where voters directly choose candidates, has diminished the power and influence of party bosses. Party bosses were traditionally influential figures who controlled candidate selection and enforced party discipline.

With the rise of primary elections, party bosses no longer have the same level of control over candidate selection. This shift has led to reduced party discipline and diminished party control over the candidates that run for office.

2. Rise of Interest Groups: Interest groups, independent organizations advocating for specific causes or interests, have gained prominence and influence in the political landscape. They operate outside of the party structure and pursue their own agendas.

Interest groups are able to support candidates who align with their causes and effectively lobby for their interests. As a result, they have become a powerful force in politics, potentially overshadowing the influence of political parties.

This development weakens parties by providing alternative channels of representation and by allowing interest groups to exert influence outside of the party system.

Both these changes have contributed to the weakening of political parties by undermining their control over candidate selection, reducing party discipline, and providing alternative avenues for political representation and influence.

Learn more about political parties here:

https://brainly.com/question/30107048

#SPJ11

This activity asks that you place the steps of phagocytosis in the correct order.
1. Chemotaxis of phagocyte to microbe occurs. 2.Phagocyte adheres or attaches to microbe. 3. Pseudopods of the phagocyte engulf and internalize the microbe, forming a phagosome. 4. Lysosome fuses with the phagosome, forming phagolysosome. 5. Digestion of microbe occurs within phagolysosome. 6. Indegistible material is discharged.

Answers

The lysosome contains digestive enzymes that break down the microbe into smaller molecules, which can be absorbed by the phagocyte. Any indigestible material is discharged from the cell.

The correct order for the steps of phagocytosis is:
1. Chemotaxis of phagocyte to microbe occurs.
2. Phagocyte adheres or attaches to microbe.
3. Pseudopods of the phagocyte engulf and internalize the microbe, forming a phagosome.
4. Lysosome fuses with the phagosome, forming phagolysosome.
5. Digestion of microbe occurs within phagolysosome.
6. Indigestible material is discharged.

During phagocytosis, the phagocyte is attracted to the microbe through a process called chemotaxis. Once it reaches the microbe, the phagocyte attaches to it and extends its pseudopods around it. The microbe is then engulfed and internalized within a phagosome. The phagosome fuses with a lysosome, forming a phagolysosome. The lysosome contains digestive enzymes that break down the microbe into smaller molecules, which can be absorbed by the phagocyte. Any indigestible material is discharged from the cell.

To know more about phagocytosis, visit

https://brainly.com/question/1900244

SPJ11

A student wanted to determine what concentration low, medium, or high of a chemical released from brown algae prevented coral larvae from settling and growing on the algae. Each concentration level of the chemical from one brown alga was added to the water Percent of Larvae Settled of each tank. Tank size, water temperature, and algae species were held constant. A different number and species of larvae were dropped into each tank. After three days, the percent of settled larvae for each concentration of inhibiting chemical was found.
1. Evaluate What are the design flaws in this experiment?How would you change the experiment to make the results more valid?
2. Analyze The student concluded that at all levels the inhibiting chemical affected the rate of settlement of marine larvae. Is this an accurate conclusion based on the data collected? Explain.

A student wanted to determine what concentration low, medium, or high of a chemical released from brown

Answers

The described experiment contains a number of design issues. The key problems are a lack of a control group, a small sample size, limited replication, and lack of randomization in 0ther words, the experiment should include a control group, be replicated, have the assignment be random, and have a larger sample size to ensure the results are more reliable.

The flaws in the experiment and the analysis

The experiment described has several design flaws that impact the validity of the results. The major flaws include the absence of a control group, limited sample size and replication, lack of information about the inhibiting chemical, and no randomization. To improve the validity of the results, the experiment should include a control group, increase the sample size and replication, randomize the assignment of larvae, provide information about the chemical, and follow standardized protocols.

Based on the information provided, it is not possible to accurately conclude whether the inhibiting chemical affected the settlement rate of marine larvae at all concentration levels. Without a control group and proper statistical analysis, it is difficult to determine the specific impact of the inhibiting chemical.

A comparison between the settlement rates observed in the presence of the inhibiting chemical and those in the control group, along with appropriate statistical tests, is necessary to make an accurate conclusion. Further analysis, such as effect sizes and confidence intervals, would provide a more comprehensive understanding of the relationship between the inhibiting chemical and larval settlement rates.

Learn more on algae here https://brainly.com/question/800121

#SPJ1

Researchers have found that mitochondria and chloroplasts in eukaryotic cells have their own DNA. This DNA is different from the DNA in a eukaryotic cell's nucleus. Chloroplasts and mitochondria use their own DNA and ribosomes to make some organelle-specific proteins.

Answers

Answer:

Mitochondria and chloroplast in Eukaryotic cells have their own DNA.

Explanation:

Researchers have found that mitochondria and chloroplasts in eukaryotic cells have their own DNA , they have their own DNA because Chloroplast and mitochondria are subcellular organelles that produces energy for the cells with their own genomes and genetic systems.

Therefore, when dna is replicated, it is transmitted to the daughter cells which produces cytoplasmic inheritance of traits and this is as a result of photosynthesis and respiration by the organelles Chloroplast and respiration.

what is guttation???​

Answers

Answer:

The exudation(To discharge through pores or incisions, as moisture or other liquid) of drops of water from the leaves of some vascular plants as a result of root pressure.

Note;- Text extracted from Wiktionary

the secretion of droplets of water from the pores of plants.

How many mongo seed are equal to 3. 50 moles of mongo seeds?​

Answers

50 moles of many mango seeds = 2.107.10²⁴ mango

One mole is equal to the number of particles (atoms, molecules, and ions) that are contained in a substance that is equal to the number of atoms that are included in one gram of carbon-12. A mole is a unit of many particles.

While you can alternatively calculate the number of moles by dividing the mass (in grams) by the molar mass of the element or molecule in question, this method is not as accurate.

With  Avogadro's number

N = number of gas particles

No = Avogadro number (6.02.10²³)

n = number of moles

n= N/No

The weight of 3.50 moles of numerous mango seeds is equivalent to

N mango seeds= 3.5 x 6.02.10²³

N mango seeds=2.107 x 10²⁴

Want to know more about moles visit the link which is given below;

https://brainly.com/question/26416088

#SPJ4

What is the correct numerical sequence for unlocking "DNA Structure?"

Answers

Answer:

3'TGACGACTACAACTTAATCT

Explanation:

Adenine bonds with thymine; guanine bonds with cytosine. This is the complement DNA sequence.

Which example is a specific question that could be used to start a scientific investigation?

A. Do long droughts increase the likelihood of forest fires

B. Should there be more services to prevent forest fires

C. Are forest fires as frightening as mudslides

D. What is the most devastating effect of a forest fire

Answers

Answer:

A specific question that could be used to start a scientific investigation is A. Do long droughts increase the likelihood of forest fires. This question can be tested and answered through scientific methods and data collection.

Other Questions
Which of the following characteristics describe a paramecium A.it moves by fiagellaB.it moves by pseudopodia How many electrons does each sphere contain? (the atomic mass of aluminum is 26. 982 grams per mole, and its atomic number is 13. ). How much money did Gemma have left in her checking account - Define the following terms and provide examples. (Actual Size; Bilateral Tolerance; Dimension; Feature; Limits of Dimension; Specified Dimension) - What are the recommended standard units of linear measurements on engineering documents? - Specify the ASME document that governs the standard for dimensioning and tolerancing. environmental effects of technological innovations have been extreme since when A/an ______ activity has more than one dependency arrow flowing from it. A. Parallel B. Critical path. C. Burst D. Merge E. Independent. Sweet Potatoe pie essay with conclusion Transporting honeybees is a niche field in agriculture yet, without it, current agriculture methods may not be successful. True or false jesus performed his first miracle in:GalileeSamariaCanaJerusalem a client with acute myeloid leukemia (aml) is scheduled to begin induction therapy. which treatments will the nurse expect to be prescribed to prevent life-threatening effects of this therapy? .4 Why would the Gamemakers use fire against Katniss? Consider everything that has happened can someone please help me Im having a hard time with this question Explain how weathering, erosion and deposition work together to change landforms and landscapes !! question is in the picture help me plsss 2x+7y=-64x-y=18\show step by step how it is solved Calculate the concentration for the following pH: PH = 13.8 you are a scientist monitoring disease potential of wastewater treated at a sewage treatment plant. you are most concerned with the concentration of which of the following? A currentcarrying wire lies in a region where there is an external magnetic field, but there is no magnetic force acting on the wire. How can this be?. Would intrinsically disordered polypeptide segments contain relatively more hydrophilic or hydrophobic residues? Javier's dad is building a bookcase. Javier made a line plot to show the lengths of some nails that his dad is using. X = 1 nail Which 3 STATEMENTS are true about the line plot?A. The total length of nails that measure 3 1/2 in each is 7B. the difference between the total length of the nails that measure 3 and 3/4 in and the total length of the nails that measure 2 and 3/4 in 6 in 1/4 in C. the difference in length between the shortest nail in the longest nail is 1 and 1/2 in D. the total length of the nail Less Than 3 1/2 in each is less than the total length of the nails greater than 3 1/2 inches each E. the sum of the lengths of nails that measure 13 1/2 in + 3 and 3/4 in is a whole number I'll give BRAINLEST. What is the unit for Gradient of Temperature(C) vs Time(secs)? Show how u got the unit.