Consider the system of equations: kx +9y = 1 For which values of k does the system above have a unique solution? (A) All k #0 (B) All k #3 (C) All k + -3 (D) All k #1 (E) All k + -1

Answers

Answer 1

The system of equations given by kx + 9y = 1 will have a unique solution for all values of k except k = 0.

To determine the values of k for which the system has a unique solution, we need to consider the coefficient of the x-variable, which is k. For a unique solution, the coefficient k should not be equal to zero.

If k = 0, the equation becomes 0x + 9y = 1, which simplifies to 9y = 1. This equation represents a line parallel to the x-axis, and any value of y will satisfy it. Therefore, there is no unique solution in this case.

For all values of k that are not equal to zero, the system will have a unique solution because the x-variable will have a non-zero coefficient, allowing us to uniquely determine its value based on the given equation.

Hence, the correct answer is (A) All k ≠ 0.

Learn more about x and y-variable here: brainly.com/question/8363707

#SPJ11


Related Questions

Round to the nearest hundredth 6.086​

Answers

Answer:

6.09

Step-by-step explanation:

Since the 6 in the thousadths place is greater than five, you round up on the place value to the right of the 6 which is 8, so that 8 becomes 9.

Hence, 6.09

Write an equation in slope intercept form for the line that passes through (5, -4) and is perpendicular to the line described by 2x-10y=0

Answers

solve the equation for y to find slope.
2x - 10y = 0
-10y = -2x
y = 1/5z
perpendicular lines have opposite reciprocal slopes, making it 5.
put it in point slope form.
y - (-4) = 5(x - 5)
solve for y.
y + 4 = 5x - 25
y = 5x - 21

Approximately how many liters are in 18 quarts?

Answers

Answer:

18 liquid quarts ≈ 17 litres

Answer:

18 us liquid quart =17.034 liters

Step-by-step explanation:

1) 1 us liquid quart = 0.946 liter

2) Multiply 0.946 *18 = 17.034

Determine if the improper integral is convergent or divergent, and calculate its value if it is convergent. for - 6x dx Calculate the value of the improper integral. Select the correct choice below and, if necessary, fill in the answer box to complete your choice. 0 O A. foe - 6x dx= 6 OB. The improper integral diverges.

Answers

To determine if the improper integral ∫(-6x)dx is convergent or divergent, we need to evaluate the integral over the given interval.

\(∫(-6x)dx = -3x^2 + C\)

To evaluate the improper integral, we need to determine the limits of integration. However, the given integral does not specify any limits. Without the limits, we cannot evaluate the integral.

Therefore, we cannot determine if the improper integral is convergent or divergent, and we cannot calculate its value without the limits of integration.

learn more about improper integral here.

https://brainly.com/question/15086429

#SPJ11

Amy, ravi, and bob have a total of $127 in their wallets. bob has 4 times what ravi has. ravi has $7 less than amy. how much do they have in their wallets

Answers

Amy has $ 27, Bob has $ 80 and Ravi has $ 20 amounts in their wallets.

Finding unknown quantity using Linear Equation:

A mathematical statement used to find an unknown quantity in a given problem is known as a Linear Equation. Here to represent the unknown quantity we will use variables like x, y, and so on.  

Here we have,

Amy, Ravi, and Bob have a total of $127 in their wallets.  

Since we don't know the amount of each person we represent them with different variables

Let 'a' be Amy's amount

'b' be Bob's amount

'r' be Ravi's amount  

Then the total amount a + b + r = 127 -----(1)  

Given that,

Bob has 4 times what Ravi has

=> b = 4r ----(2)

Ravi has $7 less than Amy

=> r = a - 7 ----(3)

From (2) and (3)

b = 4(a - 7)

b = 4a - 28 ----(4)

Now substitute (3) and (4)  

=> a + 4a - 28 + a - 7 = 127

=>  6a - 35 = 127

=> 6a = 162

=>  a = 27

From (3)    

r = a - 7 = 27 - 7 = 20

From (2)

b = 4r = 4(20) = 80  

Learn more about Linear Equation problems at

https://brainly.com/question/22234977

#SPJ4

SOMEONE PLS HELP ME THIS IS HARD

SOMEONE PLS HELP ME THIS IS HARD

Answers

The answer, is A or #1.

answer pleaseeeeee i dont get this

answer pleaseeeeee i dont get this

Answers

Answer:

I don't really now! What grade are you in? I think he needs 10 cherry tomatoes or 24 I don't really know! Don't listen to me! I just making a educated guess.

Step-by-step explanation:

Answer:

60 cherry tomatoes for large salad and 24 cherry tomatoes for small salad

Step-by-step explanation:

10 x 6 equals 60 cherry tomatoes for the first row, for the second multiply 4 times 6 which equals 24 cherry tomatoes.

A fruit basket contains only apples and bananas. If there are 8 apples and 13 bananas, what is the ratio of bananas to fruit? Select all that apply.
13:8
13:21
StartFraction 8 Over 13 EndFraction
21 to 13
StartFraction 13 Over 21 EndFraction

Answers

Answer:

answer is 13:21

Step-by-step explanation:

Your answer is attached below <3

A fruit basket contains only apples and bananas. If there are 8 apples and 13 bananas, what is the ratio

Factor f(x)=3x³ + 7x²2-18x+8 into linear factors given that -4 is a zero of f(x).

f(x) = 3x³ + 7x²-18x+8 =

(Factor completely.)

Answers

Factor f(x)=3x³ + 7x²2-18x+8 into linear factors is f(x) = (x+4)(3x+7)(x-7/3)

Define factorization

In mathematics, factorization (also known as factoring) is the process of finding the factors of a given mathematical expression or number. A factor is a number or expression that divides another number or expression exactly, leaving no remainder.

For example, the factors of 6 are 1, 2, 3, and 6 because these are the numbers that divide 6 exactly with no remainder. Similarly, the factors of x² - 4 are (x+2)(x-2) because when we multiply these two expressions together, we get x² - 4.

If -4 is a zero of f(x), then x+4 is a factor of f(x) by the factor theorem

f(x) = (x+4)(3x² - 5x - 78)

To factor the quadratic further, we can use the quadratic formula or factoring by grouping:

3x² - 5x - 78 = 0

x = (5 ± √(5² + 4(3)(78))) / (2(3))

x = (5 ± 19) / 6

x = -7/3 or x = 13/3

Therefore, we have:

f(x) = (x+4)(3x+7)(x-7/3)

To know more about remainder, visit:

https://brainly.com/question/29019179

#SPJ1

What is 2/3 + 1/6 + 2/8

Answers

Answer:

2/3 + 1/6 + 2/8

=(2×8+1×4+2×3)/24

=(16+4+6)/24

=26/24

=13/12

*mark me brainliest

Use Euler's method with step size \( 0.5 \) to compute the approximate \( y \)-values \( y_{1}, y_{2}, y_{3} \) and \( y_{4} \) of the solution of the initial-value problem \( y^{\prime}=y-2 x, y(2)=2

Answers

Using Euler's method with a step size of 0.5, the approximate y-values are 0, 1.25, 1.625, and 2.3125 for the given initial-value problem.



To apply Euler's method with a step size of 0.5, we begin with the initial condition \(y(2) = 2\). We use the formula \(y_{i+1} = y_i + h \cdot f(x_i, y_i)\), where \(h\) is the step size, \(f(x, y) = y - 2x\) is the given differential equation, and \(x_i\) and \(y_i\) represent the values of \(x\) and \(y\) at the \(i\)-th step.

At \(x = 2\), we substitute \(x_1 = 2\) and \(y_1 = 2\) into the formula to get \(y_2 = 2 + 0.5 \cdot (2 - 2 \cdot 2) = 0\).

At \(x = 2.5\), we substitute \(x_2 = 2.5\) and \(y_2 = 0\) to find \(y_3 = 0 + 0.5 \cdot (0 - 2 \cdot 2.5) = 1.25\).

At \(x = 3\), we substitute \(x_3 = 3\) and \(y_3 = 1.25\) to obtain \(y_4 = 1.25 + 0.5 \cdot (1.25 - 2 \cdot 3) = 1.625\).

Finally, at \(x = 3.5\), we substitute \(x_4 = 3.5\) and \(y_4 = 1.625\) to calculate \(y_5 = 1.625 + 0.5 \cdot (1.625 - 2 \cdot 3.5) = 2.3125\).

Therefore, the approximate \(y\)-values are \(y_1 = 0\), \(y_2 = 1.25\), \(y_3 = 1.625\), and \(y_4 = 2.3125\) using Euler's method with a step size of 0.5.

To learn more about Euler's method click here brainly.com/question/32513127

#SPJ11

A __________ is a box that identifies the patterns or colors assigned to the data series in a chart.

Answers

Answer:

legend

Step-by-step explanation:

Answer this for me please! thanks very much <3

Answer this for me please! thanks very much &lt;3

Answers

the answer is b lil boy ggggggg

If f(x)= 3x-2 find x if f(x)= 19

Answers

Answer:

19= 3x-2

3x= 21

X= 7

Step-by-step explanation:

Hope it helps!!

You are at a bank to setup a bank account with an ATM card. The
bank requires you to enter a 4-digit PIN, and each digit can be 0,
1, 2, … , 9.
a) What is the probability that the first two digits o

Answers

The probability that the first two digits of a 4-digit PIN are 2 and 5 respectively, if the digits can be any number from 0 to 9, is calculated as follows: To begin, there are 10 choices for the first digit (0, 1, 2, ..., 9) and 10 choices for the second digit since the same digits can be repeated (0, 1, 2, ..., 9).

Therefore, the total number of possible two-digit combinations is 10*10=100.To get the probability that the first two digits are 2 and 5, we need to divide the number of ways we can obtain this result by the total number of possibilities. Since the digits can be repeated, there are two possibilities for the first digit (2 or 5) and two possibilities for the second digit (2 or 5), resulting in a total of 2*2=4 possible outcomes.

Therefore, the probability of obtaining the first two digits as 2 and 5 is 4/100, which can be simplified to 1/25 or 0.04. This means that there is a 4% chance that the first two digits of the PIN will be 2 and 5.

To know more about probability visit:

https://brainly.com/question/31828911

#SPJ11

Ms. Alba is on a business trip. Her company gave her $20 for 6 meals. She has spent $95 and has eaten 5 meals. Find x, the amount Alba might spend on her next meal.



A: x ≤ 25

B: x ≥ 25

C: x ≤ 26

D: x ≥ 26

Answers

Answer:

A

Step-by-step explanation:

I will MARK THE CROWN IF SOMEONE ANSWERS THESES

I will MARK THE CROWN IF SOMEONE ANSWERS THESES
I will MARK THE CROWN IF SOMEONE ANSWERS THESES
I will MARK THE CROWN IF SOMEONE ANSWERS THESES
I will MARK THE CROWN IF SOMEONE ANSWERS THESES
I will MARK THE CROWN IF SOMEONE ANSWERS THESES

Answers

Answer:

the last picture answer is

[alternate exterior angle ]

the third picture answer is

[alternate interior angle]

what equation in slope intercept form for the line that passes through point (8,-3) and has a y intercept of -2

Answers

Answer:

y=-8x-2

Step-by-step explanation:

The formula for slope is y2-y1/x2-x1. Take coordinate (0,-2), which is the y-intercept. We'll call that (y2,x2). Coordinate (8,-3) is (y1,x1). Put that into the formula you get, 0-8/-2-(-3). You get -8/1 which is negative 8. We now have the slope. Slope intercept form equation is y=mx+b. M is slope, so we put our slope in the equation and get, y=-8x+b. B is the y-intercept which is given. So we know that the equation to this line in slope-intercept form is y=-8x-2.

A polynomial has one root that equals 5 -7i. Name one other root of this poynomial.

Answers

Answer:

5+7i

Step-by-step explanation:

Answer:

(5 + 7i)

Step-by-step explanation:

recall that the complex conjugate root theorem states that for a polynomial with real coefficients and with a complex root a + bi, then the other root must be the complex conjugate a - bi

in our case we are given that the polynomial (which we will assume to have real coefficients) has a complex root (5 - 7i)

if we compare this with our explaination above, we can see that a = 5 and b = -7.

hence the other root must be the complex conjugate of (5 - 7i) which is (5 + 7i)

erin wants to find the circumference of a circle with radius 7cm . which of following can she use to find the circumference of the circle ?

A. 2x 7 x π
B 2 x 14 x π
C 7/2 x π
D 14 xπ
E. 49 x π

Answers

To find the circumference of a circle with a radius of 7 cm, Erin should use 2×7×π. This is because the circumference of a circle is calculated by the formula 2×π×r.

What is the circumference of a circle?

The circumference is the measure of the perimeter of a circle. Since we know that from every point on the circle to its center has an equal length and is said to be its radius, the perimeter of the circle we can write as

Circumference = 2 × π × r units.

Here r is the radius of the circle.

Calculation:

It is given that Erin wants to find the circumference of a circle with a radius of 7 cm.

So, first, she has to know the formula for finding the circumference.

Here the radius is given as 7 cm i.e., r = 7 cm

Then, the circumference of the given circle is

= 2 × π × r

On substituting the radius value into the above formula, we get

Circumference = 2 × π × 7 cm

⇒ 14π cm

So, she needs to use option A. 2 × 7 × π  for finding the required circumference. This is the first step for finding the circumference of a circle.

Learn more about the circumference of a circle in the following link:

https://brainly.com/question/20489969

#SPJ1

how many sides does a regular polygon have if each of its interior angle is 165°

Answers

Answer:

24 sides

Step-by-step explanation:

exterior angle + interior angle = 180°

exterior angle + 165° = 180° ( subtract 165° from both sides )

exterior angle = 15°

the sum of the exterior angles of a polygon = 360°

since the polygon is regular each of the exterior angles are congruent

number of sides = 360° ÷ 15° = 24

Find the area of the region between the graphs of f(x)=10x+8 and g(x)=x2+5x+2 over [0,2]. (Use symbolic notation and fractions where needed.)

Answers

The area of the region between the graphs of f(x) = 10x + 8 and g(x) = \(x^{2}\) + 5x + 2 over the interval [0, 2] is 28.67 square units.

To find the area between two curves, we need to integrate the difference of the two functions over the given interval. In this case, the area is given by the integral of (f(x) - g(x)) from x = 0 to x = 2.

The integral can be computed as follows:

∫[0,2] (10x + 8 - (\(x^{2}\) + 5x + 2)) dx

Simplifying the expression inside the integral:

∫[0,2] (10x + 8 - \(x^{2}\) - 5x - 2) dx

= ∫[0,2] (-x^2 + 5x + 6) dx

Integrating the function:

= [-1/3 x^3 + (5/2) \(x^{2}\) + 6x] evaluated from x = 0 to x = 2

= [-1/3 (2)^3 + (5/2) (2)^2 + 6(2)] - [-1/3 (0)^3 + (5/2) (0)^2 + 6(0)]

= [-8/3 + 10 + 12] - [0]

= 28.67

learn more about integration here:

https://brainly.com/question/31744185

#SPJ11

A recently televised broadcast of a popular television show had a 15 share, meaning that among 5000 monitored households with TV sets in use, 15% of them were tuned to the show. A 0.01 significance level is used to test an advertiser’s claim that among the households with TV sets in use, less than 20% were tuned in to the show. Find the P-value.

1.9998

0.9999

0.0001

0.0002

Answers

The p-value of the given hypothesis is; 0.9999

How to find the p-value of the statistics?

The formula for the z-score of proportions is;

z = (p^ - p)/√(p(1 - p)/n)

where;

p^ is sample proportion

p is population proportion

n is sample size

We are given;

p^ = 15% = 0.15

p = 20% = 0.2

n = 5000

Thus;

z = (0.15 - 0.2)/√(0.2(1 - 0.2)/5000)

z = -8.8388

From p-value from z-score calculator, we have;

P(Z < -8.8388) = 1 - 0.0001 = 0.9999

Read more about p-value at; https://brainly.com/question/4621112

#SPJ1

Which statement is true about the factorization of 30x2 + 40xy + 51y2?
O The polynomial can be rewritten after factoring as 10(3x2 + 4xy + 5y2).
O The polynomial can be rewritten as the product of a trinomial and xy.
The greatest common factor of the polynomial is 51x?y2.
The greatest common factor of the terms is 1.

Answers

Answer:

The Answer Is That "The Greatest Common Factor Of The Terms Is 1."

Step-by-step explanation:

Took The Test.

The polynomial is factorized and greatest common factor of the terms is 1

What is Factorizing?

Brackets should be expanded in the following ways to factorize an expression

For an expression of the form A = a ( b + c ) , the expanded version is given by A = ab + ac, i.e., multiply the term outside the bracket by everything inside the bracket

For an expression of the form A = ( a + b ) ( c + d ) , the expanded version is given by A = ac + ad + bc + bd, in other words everything in the first bracket should be multiplied by everything in the second.

Given data ,

Let the polynomial be represented as A

Now , the value of A is

A = 30x² + 40xy + 51y²    be equation (1)

Now , the expression can be factorized as

The factors of 30 = 1 , 2 , 3 , 5 , 6 , 15 and 30

The factors of 40 = 1 , 2 , 4 , 5 , 8 , 10 , 20 and 40

The factors of 51 = 1 , 17 , 51

Therefore , the greatest common factor is 1

Hence , the factorized form of the equation is A = 30x² + 40xy + 51y²  

To learn more about factorization click :

https://brainly.com/question/804076

#SPJ7

What is the answer. Plz help.

What is the answer. Plz help.

Answers

Answer:

312in^2

Step-by-step explanation:

The Surface Area formula for a rectangular prism is:

\(2(wl +hl+ wh)\)

where l is length, h is height, and w is width.

Take the values given and plug them into the formula to get the answer.

If I helped, a brainliest answer would be greatly appreciated!

что 900 умножить на 1000000

Answers

Answer:

900,000,000

Step-by-step explanation:

900×1,000,000

=900,000,000

Надеюсь, это помогло тебе, хорошего дня)

12. You are measuring the height of a Sitka spruce tree in Alaska. You stand 45 feet from the base of
the tree. You measure the angle of elevation from a point on the ground to the top of the tree
to be 59º. Estimate the height of the tree.

Answers

Answer:

tangent 59° = Tree height / 45 feet

Tree Height = 1.6643 * 45

Tree Height = 74.8935 Feet

Step-by-step explanation:

12. You are measuring the height of a Sitka spruce tree in Alaska. You stand 45 feet from the base ofthe

For any normally distributed random variable with mean μ and standard deviation σ, the proportion of the observations that fall outside the interval [μ - σ, μ + σ] is the closest to _________.a. 0.1687b. 0.8413c. 0.0466d. 0.3174

Answers

The proportion of observations that fall outside the interval [μ - σ, μ + σ] for a normally distributed random variable is closest to 0.3174 (option d).

In a standard normal distribution, approximately 68% of the observations fall within one standard deviation of the mean. This means that the proportion of observations outside this range is approximately 1 - 0.68 = 0.32.

For any normally distributed random variable with mean μ and standard deviation σ, we can standardize it to a standard normal distribution by subtracting the mean and dividing by the standard deviation. The interval [μ - σ, μ + σ] in the original distribution corresponds to the interval [-1, 1] in the standardized distribution.

In the standardized normal distribution, the proportion of observations outside the interval [-1, 1] is approximately 1 - 0.68 = 0.32. Since this holds true for any normally distributed random variable, the proportion of observations that fall outside the interval [μ - σ, μ + σ] is also approximately 0.32.

Therefore, the closest option to the proportion is 0.3174 (option d).

Learn more about standard normal distribution here:

https://brainly.com/question/17199694

#SPJ11

Find the surface area of the hexagonal pyramid.

The base area is 166.3 cm2.

Answers

Answer:

The surface area of the hexagonal pyramid is 291.93 cm2

Step-by-step explanation:

The complete question is

Given -

Base area of pyramid = 166.3 cm2

Height of the pyramid = 12 cm

Surface area of hexagonal pyramid is

\(A=\frac{1}{3} * 3^{\frac{3}{4}}*\sqrt{A_B*(6h^2+\sqrt{3} A_B)+A_B}\)

Here AB is the base area and h is the height

Substituting the given values we get

\(A=\frac{1}{3} * 3^{\frac{3}{4}}*\sqrt{166.3*(6*12^2+\sqrt{3} * 166.3)+166.3}\\A = \frac{1}{3} * 2 * \sqrt{(166.3 *1152.04)+166.3)}\\A = \frac{2}{3} * 437.893\\A = 291.93 }\)

The surface area of the hexagonal pyramid is 291.93 cm2

Find the surface area of the hexagonal pyramid.The base area is 166.3 cm2.

If 25 is 40% of a value, what is that value? A. 85 B. 12.5 C. 62.5 D. 60

Answers

Answer:

If 25 is 40% of a value, what is that value?

A. 85

B. 12.5

C. 62.5

D. 60

Step-by-step explanation:

You're welcome.

Answer:

C) 62.5

Step-by-step explanation:

Write the expression:

40% of x = 25

Then calculate:

4x/10 = 25

4x = 250

x = 62.5

Other Questions
The best time to stretch to increase flexibility isexercise. 6. Write the sequence of the mRNA transcript that corresponds to the following gene segment of duplex DNA; indicate which of the two sequences represents the coding strand. Initiation site 5'TATAATGCGCCCATCATGCCGCTAGATTAGA3' 3'ATATTACGCGGGTAGTACGGCGATSTAATCT5' What is most plastic made of? A) synthetic materials B) carbon containing compounds C) inorganic compounds D) organic compoundsE) petroleum or coal materials Help with question number 2 .Question 1: Which of the following sets of quantum numbers contains an error?Group of answer choicesn = 4, l = 3, ml = -2, ms = -1/2n = 2, l = 0, ml = +2, ms = -1/2n = 3, l = 2, ml = 0, ms = -1/2n = 3, l = 1, ml = +1, ms = +1/2n = 2, l = 1, ml = 0, ms = -1/2Question 2: Which of the following quantum numbers describes the shape of an orbital?Group of answer choicesangular momentum quantum numbermagnetic quantum numberprincipal quantum numberspin quantum number MARKING BRAINLIEST!what does motto mean to you? Which of the following equations is not a linear equation? A. x 4y = -1 B. x = 2 C. y = x - 1/2 D. x^2 = 5y ^2 Solve for y.-5y = 60Enter your answer in the box Y= which of the following were identified by seligman and peterson as core virtues present in nearly all world religions and wisdom traditions? of the following, which sales job requires the least creative selling Consider the following output generated by the show interface fa0/0 command generated on a router:FastEthernet0/0 is up, line protocol is up[...]Auto-duplex, 100Mb/s, 100BaseTX/FX[...]Input queue: 0/75/1771/0 (size/max/drops/flushes); Total output drops: 0[...]5 minute input rate 0 bits/sec, 0 packet/sec5 minute output rate 0 bits/sec, 0 packet/sec15387 packets input, 1736263 bytes, 0 no bufferReceived 15241 broadcasts, 0 runts, 0 giants0 input errors, 1 CRC, 0 frame, 0 overrun, 0 ignored, 0 abort0 watchdog, 0 multicast0 input packets with dribble condition detected607 packets output, 6141 bytes, 0 underruns4 output errors, 10 collisions, 3 interface resets, 0 restarts0 babbles, 0 late collision, 0 deferred0 lost carrier, 0 no carrier0 output buffer failures, 0 output buffers swapped outWhich of the following statements are true about the fa0/0 interface? (Select three.)- No input or output errors have occurred.- The interface is running in half-duplex mode.- Several collisions have occurred.- One cyclic redundancy check error has occurred.- The interface is dropping incoming packets.- There have been no interface resets. Select the correct answer.Your heart rate is not a good way to measure the intensity of your workout.A.TrueB.False To define a mail server for the domain, a(n) ____ entry must be made in the DNS database file for forward resolution in the vertebrate kidney almost everything is filtered out of the blood plasma and then useful solutes and water are reabsorbed. why? multiple choice question. this process has evolved because it saves the vertebrates a great amount of energy. this process evolved because most of the molecules in the blood plasma are waste molecules and not much has to be reabsorbed. this provides greater flexibility and opportunities to fine-tune the final urine content. Part BAt your sink, turn on your faucet slowly, until you have achieved a steady drip, drip, drip of lukewarm water. Make sure you can visually see and count the drips. Align the center of the bar of soap with the dripping water and set it down. Make sure the soap is in a sturdy location and does not move during the experiment. The soap represents a rock, and the dripping faucet represents precipitation.While the soap is being weathered, calculate the number of drips that hit it in a minute. Do this by using your stopwatch to count the number of drips that occur in 10 seconds, and then multiply that number by 6 (because there are 60 seconds in a minute, 6 10 = 60). What is the number of drips hitting your bar of soap per minute? What is the message? List evidence from the cartoon or your knowledge about the cartoonist that led you to your conclusionWhat did you find out from this cartoon that you might not learn anywhere else?What other documents or historical evidence are you going to use to help you understand thisevent or topic? Eleanor and Max used two rectangular pieces of plywood, placed end-to-end, to make a long rectangular stage for the school play. One board was 6 feet long, and the other was 6 1/2 feet long. The two pieces of plywood had equal widths. The total area of the stage was 59 3/8 square feet. What was the width of the plywood? metabolism is the chemical process your body uses to breakdown and transform food How many people know 2 3/2 times 4,000? Select the correct answer from the drop-down menu. what connection does obama draw between lindsay early and himself? both obama and lindsay . A 42.6kg lamp is hanging from wires as shown in figure.The ring has negligible mass. Find tensionsT1, T2,T3 if the object is in equilibrium.