Check all that occur at visceral effectors as a result of both parasympathetic and sympathetic innervation. Check All That Apply Sympathetic stimulation increases the heart rate. Parasympathetic stimu

Answers

Answer 1

The autonomic nervous system's sympathetic and parasympathetic divisions innervate specific visceral effectors, causing varied physiological reactions. The following assertions describe visceral effector effects from parasympathetic and sympathetic innervation:

The sympathetic nervous system produces norepinephrine, which binds to beta-adrenergic receptors in the heart, increasing heart rate. Heart rate, force of contraction, and cardiac output increase due to this binding. Parasympathetic stimulation lowers heart rate because the vagus nerve releases acetylcholine, which binds to heart muscarinic receptors. This binding decreases heart rate by slowing electrical impulses and contraction force.

It's vital to note that while sympathetic stimulation raises heart rate, parasympathetic stimulation lowers it. To address physiological needs, sympathetic and parasympathetic activity balances the heart rate.

To know more about nervous system

https://brainly.com/question/2114466

#SPJ11


Related Questions

Many snakes and lizards live in the desert, where temperatures are high during the day and cold at night. How does the temperature range affect the size of the snakes and lizards?


A. High daytime temperatures allow them to grow as large as the food supply will allow.


B. Cold nighttime temperatures limit their size, because large ectotherms need a long time to warm up in the sun.


C. High daytime temperatures limit their size, because large endotherms would overheat on very hot days.


D. Cold nighttime temperatures limit their size, because large endotherms would lose too much of their body heat.

Answers

Answer:

A. High daytime temperatures allow them to grow as large as the food supply will allow.

Explanation:

Snakes and lizards are cold-blooded animals. This type of animal cannot maintain a constant body temperature and depends on the temperature of the environment to keep warm and keep its organs and metabolism working.

Room temperature is so important to these animals that they even determine the size of their bodies. For these animals, high temperatures allow them to have their metabolism accelerated, so they can grow as much as the availability of food allows. On the other hand, if there is not enough food, or very cold temperatures, they will need to be smaller in size, as the metabolism will be slow.

what is DNA replication similar to

Answers

Answer:

i wanna say RNA

Explanation:

DNA sequencing.
I remember this from Biology Freshman year!

(GIVING BRAINLIEST!!)

Which sentence correctly explains the process and conditions needed for rain to form?

A) Rain only falls during thunderstorms and extreme weather in below freezing temperatures.

B) Ice crystals melt as they fall through a layer of warm air and then refreeze into a solid form as they fall.

C) Water vapor freezes into solid ice crystals, and the temperature of the air should be below freezing.

D) The temperature in the sky needs to be above freezing, and water vapor condenses into liquid water.

Explain Why.

Answers

the correct answer is is d

Answer: D

Explanation:

As shown in Figure 1.2, because human population continues to expand, Earth's finite resources are naturally being depleted at an exponential rate. One reason for the exponential depletion rate is that population is increasing exponentially. Describe another factor (related to industrialization) that is causing resources to become depleted exponentially.

Answers

The main environmental issues are overpopulation, exponential population growth and development, the rapid use of resources as a result of exponential population increase, the difficulty of predicting population growth, and unequal population distribution around the globe.

What are environmental issues?

Environmental problems are the results of human activities on the biophysical environment, most frequently negative consequences that lead to the degradation of the ecosystem. The practice of defending the environment is known as environmental protection, and it can be carried out on a personal, group, or governmental basis. Environmentalism is a social and environmental movement that uses advocacy, legislation, education, and activism to address environmental challenges. Humans' impact on the environment is a persistent, global issue. Marine life is also hampered by water pollution. Most academics believe that if human society managed to live sustainably within planetary constraints, the projected peak global population of between 9 and 10 billion people could do so.

To learn more about environmental issues visit;

https://brainly.com/question/28211138

#SPJ4

When we_____ the diaphragm moves downward, and the space in the chest becomes.

exhale;smaller

exhale; larger

inhale; larger

inhale; smaller

Answers

Answer:

inhale; larger

Explanation:

I think this is the right answer

PLEASEEEEE Draw the generic structure of the basic building block of nucleic acids and label its threekey parts.

Answers

The main building blocks that could be used to construct a nucleic acid as shown in the diagram are a nitrogenous base, a sugar molecule and the phosphate group.

What is the nucleic acid?

The term nucleic acid have to do with the substance that is composed of the nitrogenous base and the phosphate group. The nitrogenous base is a cyclic structure that has nitrogen as one of the atoms that have been attached to it. This nitrogen atom is responsible for the basicity of the substance because of the presence of lone pair on the nitrogen atom.

Now we also have the phosphate group which attaches to the nitrogenous base in a remarkable position which now allows the compound to function as a nucleic acid.

We could now agree that the basic building blocks for the nucleic acid are the phosphate moiety as well as the nitrogenous base. The nucleic acid plays an important role in the sense that it is used to code the genetic material that is required for reproduction in the body.

Learn more about nucleic acids:https://brainly.com/question/11309892

#SPJ1

PLEASEEEEE Draw the generic structure of the basic building block of nucleic acids and label its threekey

Can some bacteria grow on the streak plate and not be seen if the pour plate technique is used?
This given statement is :
True
False

Answers

The statement "Some bacteria may have different growth requirements or characteristics that make them more likely to grow on a streak plate method compared to the pour plate technique" is true.

The streak plate method involves streaking a sample onto the surface of solid agar in a petri dish, allowing bacteria to grow and form visible colonies.

However, in the pour plate technique, the sample is mixed with molten agar before being poured into the petri dish, resulting in the bacteria being evenly distributed throughout the agar.

This may make it easier to detect certain bacteria that may not grow well on the surface of agar but can thrive within the agar matrix. Therefore, some bacteria that may be present on a streak plate may not be visible on a pour plate, highlighting the importance of using different techniques to increase the chances of detecting various bacterial species.

To know more about streak plate method refer here :    

https://brainly.com/question/31936064#

#SPJ11                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      

Cells called transport oxygen and carbon dioxide between the tissues and the lungs.a. Trueb. False

Answers

the answer is true I

Which statement provides evidence that petroleum is a nonrenewable resource?(1 point)

Answers

Answer:

Petroleum is a non renewable resources because they cannot be formed quickly.

Explanation:

Petroleum takes a lot of time to form. They take even millions and billions of year to be formed.

The statement that provides evidence that petroleum is a nonrenewable resource is: "Petroleum is formed over millions of years from the remains of dead organisms and cannot be replenished in our lifetime, making it a nonrenewable resource." That is in Option A.

What is a nonrenewable resource?

Petroleum is a fossil fuel that is formed over millions of years from the remains of dead organisms, such as plankton and algae, that were buried under layers of sedimentary rock.  These remains are subjected to high pressure and heat over time, causing them to break down and transform into petroleum.

Since petroleum formation is a slow and lengthy process, it is considered a nonrenewable resource. This means that the amount of petroleum that exists on Earth is limited and cannot be replenished at the same rate that it is being consumed by humans.

Hence, the statement that provides evidence that petroleum is a nonrenewable resource is: "Petroleum is formed over millions of years from the remains of dead organisms and cannot be replenished in our lifetime, making it a nonrenewable resource." That is in option A.

Learn more about this nonrenewable resource here.

https://brainly.com/question/6684678

#SPJ2

complete question is below

Which statement provides evidence that petroleum is a nonrenewable resource?(1 point)

A)"Petroleum is formed over millions of years from the remains of dead organisms and cannot be replenished in our lifetime, making it a nonrenewable resource.

B)it is good for climate

Complementary to CTG is:

Answers

GACI'm assuming you're talking about DNA base pairs?

Please help with this bio problem!

Please help with this bio problem!

Answers

The reactants and products of the light-dependent and light-independent reactions of photosynthesis are as follows:

Light-dependent reactions:

Reactants: Light energy, water, and ADP + Pi Products: Oxygen, ATP , and NADPH

Light-independent reactions:

Reactants: Carbon dioxide (CO2), ATP, and NADPHProducts: Glucose (C6H12O6) and ADP + Pi

What are the light-dependent and light-independent reactions of photosynthesis?

During light-dependent reactions, light energy is absorbed by chlorophyll in the chloroplasts of plant cells. This energy is used to split water molecules into oxygen, hydrogen ions, and electrons. The oxygen is released as a waste product, while the hydrogen ions and electrons are used to produce ATP and NADPH.

In the light-independent reactions (also known as the Calvin cycle), carbon dioxide is fixed into glucose using the ATP and NADPH produced during the light-dependent reactions. The ATP and NADPH provide the energy and reducing power needed to power the reactions that convert carbon dioxide into glucose.

Learn more about light-dependent and light-independent reactions at: https://brainly.com/question/13349357

#SPJ1

SOMEONEEEEEE HELPPPP MEEEE

SOMEONEEEEEE HELPPPP MEEEE

Answers

Answer:

The answer is B.

Explanation:

Answer:I think it’s A

Explanation:

I hope this helps:)

Because ammonia is very toxic, it is kept atlow levels in the body by being: (Select allthat apply.)A)eliminated.B)converted to urea.C)stored away from body tissues.D)converted to uric acid.E)converted to amino acids.

Answers

Because ammonia is very toxic, it is kept at low levels in the body by being eliminated as well as converted to uric acid and to urea.

So, the correct options are A, B, and D.

A high blood ammonia level can be reduced using the following treatments: For newborns, limit their protein intake by The coma-causing metabolic inborn causes of hyperammonemia in newborns may be treated by reducing their protein intake. Hemodialysis: The process of cleansing the blood using a dialysis machine and a device referred to as an artificial kidney. In addition, it is produced in the human gut as a result of various bacterial enzymatic processes. Ammonia is quickly converted into urea in the liver by the urea cycle and eliminated by the kidneys, but this is due to the fact that ammonia is highly toxic.

Learn to know more about Ammonia on

https://brainly.com/question/14854495

#SPJ4

Discuss how knowing about the scientific method is useful as an allied health professional.

Answers

Answer:

The Scientific Method is a way of doing research. It is useful for an allied health professional to know about the scientific method because it will help them in their work. This essay will discuss how knowing about the scientific method is useful as an allied health professional.

The first step in any type of science is to have a question or problem that you want to solve. You then need to find out if anyone else has had the same problem before and see if they have already solved it using some sort of evidence, such as facts or data, that support their solution.

Explanation:

The knowledge of the scientific method helps health professionals to make decisions that are based on scientific principles. It helps them to make accurate decisions.

What is meant by the scientific method?

The process of performing testing and experimentation in order to establish facts and experimentation is known as the scientific method. The principles of scientific methods have various applications.

A series of steps are used in the scientific method to establish facts or generate knowledge. The general procedure is well known, but depending on what is being examined and who is performing it, each step's specifics may change. Only questions that can be tested and either proven true or false can be answered using the scientific method.

To learn more about the scientific method, refer to the link:

https://brainly.com/question/8483218

#SPJ2

Why do you adapt to your environment?

Answers

All organisms need to adapt to their habitat to be able to survive. This means adapting to be able to survive the climatic conditions of the ecosystem, predators. and other species that compete for the same food and space

Answer:

basically to be part of it and be comfortable in living under the that environment. Also, to have harmonious connection around you.

an ecologist studied the effect of biotic and abiotic factirs in a population of bacteria at the bottom of a pound. his study would include all but which levels in the structual hierchy of life?

Answers

Answer:

The ecologist's study of the population of bacteria at the bottom of a pond would likely include several levels in the structural hierarchy of life, such as the individual level (individual bacteria), the population level (all the bacteria in the pond), and the community level (the bacteria and other organisms living in the pond).

However, the study may not include higher levels in the structural hierarchy of life, such as the ecosystem level (the pond and all its biotic and abiotic components) or the biome level (the larger geographical area with similar climate and vegetation). Therefore, the level that the study would likely not include is the biome level.

can someone help me with this question pls

can someone help me with this question pls

Answers

Answer: Uranium is a scarce resource

What is the primary source of energy in a food chain?

oxygen
sun
carbon dioxide
water

Answers

The Sun is the primary food source of energy in a food chain.

Answer:

The sun is the primary source of energy in a food chain.

Explanation:

By having sun light shining directly onto plants, it causes the plants to produce chemical energy that is able to sustain all their cellular functions.

Hope this helps! :)

GIVING 50 POINTS AND BRAINLIEST TO CORRECT ANSWER


What important events happen during the Krebs cycle? (Chose all that apply)

releases energy in the form of FADH2 and NADH

uses oxygen to form carbon chains and store energy

breaks down oxygen molecules to produce ATP

builds up and breaks down carbon chains

Answers

Krebs cycle releases energy in the form of FADH_2 and NaDH

Krebs cycle also known as Citric acid cycle As it was invented by Sir Hans Krebs So its known as Krebs cycle .

First 1 sedimentary second 1 is igneous

Answers

Sedimentary rock materializes as a geological formation arising from the aggregation of sediments, comprising fragments of rock, minerals, and organic substances.

What is an igneous rock?

Igneous rock, on the other hand, emerges as a geological specimen crafted through the process of cooling and crystallization of molten rock, referred to as magma or lava.

Magma lurks beneath the Earth's crust, while lava represents the molten rock that has spewed onto the surface. The classification of igneous rocks depends on their texture, elucidated by the dimensions of the crystals embedded within the rock.

Learn about Sedimentary rock here https://brainly.com/question/7437433

#SPJ1

Complete question:

Define:

First 1 sedimentary

second 1 is igneous

How does evolution work to create the diversity of life on Earth?

Answers

Answer:

People adapt and mate with others

Explanation:

Describe how water balance is maintained in a mammalian body please help am left with ten minutes

Answers

Answer:

body's water needs, conserving water if the body is dehydrated or making urine more dilute to expel excess water when necessary. ADH is a hormone that helps the body to retain water by increasing water reabsorption by the kidneys.

Explanation:

i hope it helps

Correctly label the anatomical features of a continuous capillary - Tight junction - Pericyte - Intercellular cleft - Basal lamina - Basal lamina - Erythrocyte - Endothelial cell - Pinocytotic vesicle

Answers

The anatomical features of a continuous capillary include tight junctions, pericytes, intercellular clefts, basal lamina, erythrocytes, endothelial cells, and pinocytotic vesicles.

To correctly label the anatomical features of a continuous capillary, follow these steps:

1. Locate the endothelial cells, which are the cells that line the inner surface of the capillary. They form the barrier between the blood and surrounding tissues.
2. Identify the tight junctions, which are the connections between adjacent endothelial cells. These junctions help maintain the integrity of the capillary wall and regulate the movement of substances.
3. Find the intercellular clefts, which are small gaps between endothelial cells. These clefts allow for the exchange of certain substances between the blood and surrounding tissues.
4. Recognize the basal lamina, which is a thin layer of the extracellular matrix that provides support to the capillary. It is located beneath the endothelial cells.
5. Locate the pericytes, which are cells that wrap around the capillary and provide structural support. They can be found along the basal lamina.
6. Identify the erythrocytes (red blood cells) inside the capillary. These cells transport oxygen and carbon dioxide.
7. Find the pinocytotic vesicles, which are small membrane-bound structures within the endothelial cells. They facilitate the transport of substances across the capillary wall.

In summary, the anatomical features of a continuous capillary include tight junctions, pericytes, intercellular clefts, basal lamina, erythrocytes, endothelial cells, and pinocytotic vesicles.

To know more about continuous capillary:https://brainly.com/question/14928302

#SPJ11

Describe the ways that carbon is ‘locked up’ so it is not in the atmosphere.

Answers

(1) as organic molecules in living and dead organisms found in the biosphere

(2) as organic matter in soils

(3) in the lithosphere as fossil fuels and sedimentary rock deposits

original DNA: TACTTTAATCCCAAATTTACT

DNA: TACTTTAATCCCAAGTTTACT
mRNA: ?
amino acid: ?
what type of mutation is this: ?​

Answers

Answer:

substitution mutation

Explanation:

The original DNA sequence is: TACTTTAATCCCAAATTTACT

The mutated DNA sequence is: TACTTTAATCCCAAGTTTACT

The mRNA transcribed from the mutated DNA sequence is: AUGAAAUUAGGGUUAAUUAGA

The amino acid sequence encoded by the mRNA is: Met-Lys-Ser-Trp-Lys-Lys-Ser

This is an example of a substitution mutation, in which a single nucleotide in the DNA sequence is changed. In this case, the original DNA sequence contains the nucleotide A at position 13, while the mutated sequence contains the nucleotide G at the same position. This change causes a different mRNA sequence to be transcribed and a different amino acid to be encoded. Substitution mutations can have a variety of effects on gene function, depending on the location and nature of the mutation. Some substitution mutations may have no effect, while others may cause the protein encoded by the gene to function improperly or not at all.

i crosscut my nail with a knife . will it ever heal???

Answers

Yes it will by the process of Regeneration

Similarities between the digestion of Amoeba and Ruminants

Answers

The digestion of Amoeba and Ruminants is similar to each other. The digestive system of Amoeba is very simple. It includes only one opening mouth, but Ruminants have a more complex digestive system. It includes four compartments stomach. In this post, we'll be discussing the similarities between the digestion of Amoeba and Ruminants.

The following are some similarities between the digestion of Amoeba and Ruminants: Both have a digestive system: Amoeba and Ruminants have a digestive system. Amoeba's digestive system is a single opening mouth, but Ruminants have a more complex digestive system with four compartments stomach. Extracellular digestion:

Amoeba and Ruminants both undergo extracellular digestion. It's a process in which food is digested outside of the cell. Both have enzymes for digestion: Both Amoeba and Ruminants have enzymes to break down food. Ruminants secrete digestive enzymes in the stomach while Amoeba secretes digestive enzymes in its pseudopodia.

The absorption of nutrients: Both Amoeba and Ruminants absorb nutrients through their cell membrane. Amoeba absorbs nutrients through the pseudopodia, and Ruminants absorb nutrients through the small intestine. The breakdown of carbohydrates:

To know more about digestion visit:

https://brainly.com/question/29030031

#SPJ11

John is completing an internship in biology at the Clearwater Marine Aquarium. While interning there, he monitors an outdoor phytoplankton exhibit to observe how populations of phytoplankton change when exposed to light. It is observed that each year the phytoplankton population within the exhibit increases when it was exposed to high amounts of sunlight. A new apartment complex that overlooks the aquarium is being built. The phytoplankton that were receiving 8-12 hours of sunlight each day will now have between 2-5 hours of sunlight. How will the phytoplankton be affected by the new apartment building?

Answers

Answer:A

Explanation:

It will decrease over time

If there are 3 ft in 1 yd, which of the following are possible conversion factors for feet and yards? Check all that apply

Answers

Can u pls attach the answers so I can help? :))

Answer: 1yd over 3ft and 3ft over 1yd ( a and d)

Explanation: ….

the population of humans on earth increased gradulaly unitil the nineteen centery, after which it increased exponitally due to the abaiblity of better medicicne and food prodict describe the kind of growth curve that human population has followed

Answers

If the population of humans have increased exponentially due to availability of medicine and food, then The S growth curve is the growth curve that has been followed.

What is the growth curve about?

The kind of growth curve that human population has followed is an S-shaped logistic growth curve.

Initially, the growth rate was slow due to various factors such as limited access to resources and high infant mortality rates. However, with the advent of better medicine and agricultural practices in the 19th century, the growth rate started to increase exponentially.

As the population increased, the availability of resources became more limited, leading to a decrease in the growth rate. This decrease in growth rate is due to a combination of factors such as increased competition for resources, decreased fertility rates, and improved family planning.

Read more on growth curve here:https://brainly.com/question/29408056

#SPJ1

Other Questions
which of these cardiovascular changes is the primary cause of age-related decrements in vo2max ? An aqueous solution of nickel(II) bromide, , is made by dissolving 9.27 grams of nickel(II) bromide in sufficient water in a 300. mL volumetric flask, and then adding enough water to fill the flask to the mark. What is the weight/volume percentage of nickel(II) bromide in the solution a beach house in southern california now costs $350,000. inflation is expected to cause this price to increase at 5 percent per year over the next 20 years before eric and karinna retire from successful careers in commercial art. how large an equal annual end-of-year deposit must be made into an account paying an annual rate of interest of 13 percent in order to buy the beach house upon retirement? One of the features of spreadsheet is the if-statement wherein it allows you to make a logical comparison between a value and what you expect. Explain the importance of if-statement in predicting sales forecast and how this statement helps you in coding your data Diana is telling her father about her busy day. Write the vocabulary words that best complete her sentences.A las 5:15 voy a ___ a los nios de los Gonzlez why was President Andrew Johnson ahargedwith breaking Tenure of Office Act How does high blood pressure affect peoples moods When 6M sodium hydroxide is added to an unknown white solid, the solid dissolves. What is a possible identity for this solid? The options include: Mg(OH)2, Al2(SO4)3, BaCO3, and AgBr. Which one would the solid be and why? How many bytes begin with 101? How did the Roman Empire treat their citizens?. Scarlett Squirrel teaches a hula dancing class to young squirrels. 141414 squirrels showed up to class on Monday, 101010 squirrels on Tuesday, 888 squirrels on Wednesday, 1010squirrels on Thursday, and 1212squirrels on Friday.Find the mean number of squirrels. write an equation in slope intercept form of the line what couse falling of France Review the definition of exaptation in Concept 25.6. Summarize the process by which exaptation occurs and explain how the incorporation of the articular and quadrate bones into the mammalian inner ear is an example. What major historical events and factors caused the baby boom. How is the baby boom related to both the Great Depression and World War II. What are some negative consequences of the baby boom? The liver is known for its ability to remove certain toxins from the blood. it can it is made up of hepatocytes that contain large quantities of lysosomes and peroxisomes, as well as having an extensive smooth endoplasmic reticulum. describe how these three organelles contribute to this major function of the liver (briefly). Find the 12 term of the geometric sequence 7,-35,175 solve each system by substitution. y=2x-1 3x+8y=11 Elizabeth Kibler begins this passage by saying, "My sleepy little town used to be a blip on the worlds radar screen." Identify the figure of speech in this statement and explain its meaning. Then, tell how this relates to the meaning of the passage. 2^-5/2^-6 PLEASE HELP NO LINKS