Step-by-step explanation:
plan a 40dollars
plan b 30 dollars
plan b cost less
Mark me brainliest plsss
6a + 2b − 3a + 6 simplify with steps
Answer:
3a+2b+6
Step-by-step explanation:
Combine like terms 6a and -3a to get 3a
Everything else stays the same, so the answer is 3a+2b+6
Number 5 please I’m having trouble
Answer:
B
Step-by-step explanation:
you would just divide 37 from 8659
marcia has a total of 65 game pieces worth 89 points. each game piece is worth one or two points. how many one-point game pieces does she have?
By solving Simultaneous linear equation, it can be inferred that
Marcia has 41 one point game pieces
What is simultaneous linear equation?
At first it is important to know about linear equation
Equation shows the equality between two algebraic expressions by connecting the two algebraic expressions by an equal to sign.
A one degree equation is known as linear equation.
Two or more linear equations, which can be solved together to obtain common solution are known as simultaneous linear equation.
Here two simultaneous linear equations needs to be solved
Let the number of one point pieces be x and the number of two point pieces be y
Total number of pieces = 65
So, x + y = 65 ....... (1)
Now,
Total number of points = 89
x + 2y = 89 ..... (2)
Subtracting (2) from (1),
y = 24
Putting the value of y in (1),
x + 24 = 65
x = 65 - 24
x = 41
Marcia has 41 one point game pieces
To learn more about simultaneous linear equation, refer to the link:
https://brainly.com/question/26310043
#SPJ1
Write the decimal as a mix number in simplest form. 2.8
Answer:
2 4/5
Step-by-step explanation:
Put the whole number to the side and then make a fraction out of the remaining decimal. 8/10 can be simplified to 4/5
Answer:
2 4/5
Step-by-step explanation:
When you see the decimal the whole number is 2, so that doesnt change.
Next you see the 8 in the tenths place. Whatever place the digit is in is its denominator. So 8 in the tenths place is 8/10.
Simplify and it becomes 4/5. Attatch to the whole number and your done.
question a 15-foot ladder is leaning against a wall. the top of the ladder is sliding down the wall at a rate of 2 ft/sec. how fast is the bottom of the ladder moving when it is 12 feet away from the wall?
Speed the top of the ladder is sliding down = 1.6ft/sec when it is 12 feet away from the wall
15-foot ladder is leaning against a wall.
the top of the ladder is sliding down the wall at a rate of 2 ft/sec.
how fast is the bottom of the ladder moving when it is 12 feet away
Using equivalent proportion
15 ft -------------------2ft/sec
12 ft-------------------X ft/sec
Hence X = (12 x 2) ÷ 15 =1.6 ft/sec
learn more about of rating here
https://brainly.com/question/15401968
#SPJ4
Find the volume of the cone. Use 3.14 for pi. Round your answer to the nearest tenths
place.
The volume of the cone is approximately 37.7 cubic units
What is volume?
A volume is simply defined as the amount of space occupied by any three-dimensional solid. These solids can be a cube, a cuboid, a cone, a cylinder, or a sphere. Different shapes have different volumes.
To find the volume of a cone, we use the formula:
V = (1/3) * π * r² * h
where π is the constant pi, r is the radius of the base of the cone, and h is the height of the cone.
Plugging in the given values, we get:
V = (1/3) * 3.14 * 3² * 4 ≈ 37.7
Therefore, the volume of the cone is approximately 37.7 cubic units (rounded to the nearest tenth).
To know more about volume visit:
https://brainly.com/question/463363
#SPJ1
Below you are given the examination scores of 20 students.
52 99 92 86 84 63 72 76 95 88 92 58 65 79 80 90 75 74 56 99 11. the corresponding width of each class will be:_______
a. 5
b. 6
c. 7
d. 8
The corresponding width of each class would be 5, option (a).
To determine the corresponding width of each class, we need to calculate the range of the given examination scores, which is the difference between the highest and lowest values.
The highest score in the given data is 99, and the lowest score is 11.
Range = Highest score - Lowest score
= 99 - 11
= 88
Since the range represents the total span of the scores, we can divide it by the number of classes to determine the width of each class. In this case, there are 20 students, so we have 20 classes.
Width of each class = Range / Number of classes
= 88 / 20
= 4.4
However, since we are dealing with discrete values (scores) and not continuous variables, we usually round up the width to the nearest whole number to ensure that all scores fall within a specific class interval.
Among the given choices, the closest whole number to 4.4 is 5.
Therefore, the corresponding width of each class would be 5, option (a).
learn more about width here
https://brainly.com/question/30282058
#SPJ11
Find the largest interval centered about x = 0 for which the given initial-value problem has a unique solution. (enter your answer using interval notation. ) y'' (tan(x))y = ex, y(0) = 1, y'(0) = 0
The largest interval centered about x = 0 is (\(-\frac{\pi}{2}, \frac{\pi}{2}\)) for which the given initial-value problem has a unique solution: \(y'' + tan(x)y = e^x\), y(0) = 1, y'(0) = 0.
An initial-value problem (IVP) is one kind of mathematical problem that contains obtaining a solution to a differential equation along with a set of initial conditions. It is commonly encountered in the field of differential equations.
Since it is mentioned in the theorem that in an initial-value problem y' + p(t)y = g(t), y(\(t_o\)) = \(y_o\) has a unique solution if p(t) and g(t) are continuous functions on the interval (a, b) containing \(t_o\).
Since \(e^x\) is continuous everywhere and tanx is continuous on (\(-\frac{\pi}{2}, \frac{\pi}{2}\)) containing 0.
Since R, a set of real numbers, and (\(-\frac{\pi}{2}, \frac{\pi}{2}\)), both contain 0.
Thus the largest interval centered about x = 0 is (\(-\frac{\pi}{2}, \frac{\pi}{2}\)).
Learn more about the initial-value problem here:
https://brainly.com/question/30503609
#SPJ4
What percent of 56 is 42?
I need an answer ASAP
a
23%
b
42%
c
75%
d
90%
Answer:
nicki monaj is the queen of rap
Step-by-step explanation:
periodt purr
First to completly answer will be marked brainliest if you give a random answer just to get points you will be reported
Answer:
Pi: Irrational
2/9: Rational
225: Rational
0.167: Irrational <--- fourth one
Step-by-step explanation:
Not sure about the 4th one, but the others are good :)
Witch has a greater absolute value 33 dollars and -52 dollars
Answer:
-52
Step-by-step explanation:
the absolute value is always positive and so 33 would remain 33, but -52 would change to 52 which is greater than 33.
Answer:
- 52
Step-by-step explanation:
the absolute value would make it 52 which is greater than 33
triangle sum theorem
WILL MARK BRAINLIEST
Step-by-step explanation:
13) 4x-22+x+11+10x-4 =180
15x=195
x=13
<P=(10(13)-4)=126
<Q=(4(13)-22)=30
<R=13+11=24
The costs of repairing iPads in UAE are normally distributed with a mean of 173 Dhs. If
3%
of the costs exceed 243 Dhs, find the standard deviation of the costs. Round your answer to the nearest diham (Whole number).
The standard deviation of the costs is 37 Dhs
The given mean is 173 and 3% of costs exceed 243. We have to calculate the standard deviation of the cost. Therefore, let's first start by calculating the z-score as follows;z-score formula = `(x - μ) / σ`z-score = `243 - 173 / σ`z-score = `70 / σ`We need to find the standard deviation of the costs. Since the z-score formula includes standard deviation, we can first calculate the z-score and then use it to calculate the standard deviation.Using the z-table, we can find the z-score for 3% = -1.88-1.88 = (243 - 173) / σσ = (243 - 173) / -1.88σ = -70 / -1.88σ = 37.23≈ 37The standard deviation of the costs is 37 Dhs. Hence, the correct option is as follows.Option D is the correct option.
Learn more about standard deviation
brainly.com/question/23907081
#SPJ4
Examine the last statements made by the Dormouse:
(1) I breathe when I sleep.
(2) I sleep when I breathe.
Write each of the statements in "If .... then” form.
Answer:
I believe what your teacher is looking for is
"If I breathe when I sleep, then I sleep when I breathe."
"If I sleep when I breathe, then I breathe when I sleep."
Step-by-step explanation:
I hope I'm correct ^-^
How do you solve algebraic expressions in simplest form?
Answer:
Step-by-step explanation:
To solve an algebraic expression in simplest form, you can follow these steps:
1. Use the order of operations (PEMDAS) to simplify any arithmetic in the expression (parentheses, exponents, multiplication and division, addition and subtraction).
2. Combine like terms by adding or subtracting any coefficients in front of similar variables.
3. Divide or multiply both sides of the equation by the same non-zero number to solve for the variable.
4. If possible, factor the expression to make it simpler.
5. If the expression is a fraction, check for a common denominator and then simplify by canceling any common factors in the numerator and denominator.
6. If the expression is a radical, check for a perfect square and simplify by taking the square root of the number inside the radical.
7. Use the properties of exponents and logarithms to simplify the expression.
8. Evaluate the expression by plugging in the values of any known variables.
It's important to keep in mind that there may be multiple ways to simplify an algebraic expression and the solution that is in simplest form may not always be obvious.
Step 1 5x- y= 4
-Y= -5x + 4
y= 5x – 4
Step 2 5x = (5x- 4) = 4
5x – 5x + 4 = 4
4 = 4
What is the error correct the error
Answer: C, In Step 2 the expression for y should be subsituted in the other equation.
The distribution of Student's t has ___________. Multiple Choice a mean of zero and a standard deviation of one a mean of one and a standard deviation of one a mean of zero and a standard deviation that depends on the sample size a mean that depends on the sample size and a standard deviation of one
The distribution of Student's t has a mean of zero and a standard deviation that depends on the sample size.
The Student's t-distribution is a probability distribution used in statistical inference when dealing with small sample sizes or when the population standard deviation is unknown. It is commonly used for hypothesis testing and constructing confidence intervals.
Unlike the normal distribution, which has a fixed mean of zero and a standard deviation of one, the mean of the t-distribution is always zero. However, the standard deviation of the t-distribution varies depending on the sample size.
As the sample size increases, the t-distribution approaches the shape of the standard normal distribution (Z-distribution) with a mean of zero and a standard deviation of one.
The variability of the t-distribution decreases with larger sample sizes, reflecting the increased precision of estimates obtained from larger samples. For smaller sample sizes, the t-distribution has fatter tails compared to the normal distribution, allowing for a wider range of values.
It's important to note that the specific standard deviation of the t-distribution depends on the degrees of freedom, which is determined by the sample size. The degrees of freedom directly affect the shape and variability of the t-distribution.
Learn more about Distribution
brainly.com/question/29664127
#SPJ11
Find the difference. (3 • 1,000) – (2 • 100)
Answer:
2,800
Step-by-step explanation:
3·1000=3000
2·100=200
3000-200= 2,800
Noise levels at 5 airports were measured in decibels yielding the following data:
162,176,162,141,159
Construct the 90% confidence interval for the mean noise level at such locations. Assume the population is approximately normal.
Step 1 of 4:
Calculate the sample mean for the given sample data. Round your answer to one decimal place.
Step 2 of 4:
Calculate the sample standard deviation for the given sample data. Round your answer to one decimal place.
Step 3 of 4:
Find the critical value that should be used in constructing the confidence interval. Round your answer to three decimal places.
Step 4 of 4:
Construct the 90% confidence interval. Round your answer to one decimal place.
The 90% confidence interval for the mean noise level at these airport locations is approximately (148.1, 171.9).
Step 1 of 4:
To calculate the sample mean for the given sample data, we sum all the values and divide by the sample size.
Sample mean = (162 + 176 + 162 + 141 + 159) / 5 ≈ 160.0 (rounded to one decimal place)
Step 2 of 4:
To calculate the sample standard deviation, we need to find the differences between each data point and the sample mean, square those differences, sum them up, divide by the sample size minus 1, and then take the square root.
Deviation from mean: (162 - 160)^2, (176 - 160)^2, (162 - 160)^2, (141 - 160)^2, (159 - 160)^2
Sum of squared deviations = (2^2 + 16^2 + 2^2 + (-19)^2 + (-1)^2) = 590
Sample standard deviation = sqrt(590 / (5 - 1)) ≈ 9.6 (rounded to one decimal place)
Step 3 of 4:
To find the critical value for a 90% confidence interval, we need to look up the t-value in the t-distribution table with (n-1) degrees of freedom. Here, n is the sample size, which is 5.
Degrees of freedom = 5 - 1 = 4
Looking up the t-value for a 90% confidence level and 4 degrees of freedom, we find it to be approximately 2.776 (rounded to three decimal places).
Step 4 of 4:
To construct the 90% confidence interval, we use the formula:
Confidence interval = sample mean ± (critical value * (sample standard deviation / sqrt(sample size)))
Confidence interval = 160.0 ± (2.776 * (9.6 / sqrt(5)))
Calculating this expression will give us the lower and upper bounds of the confidence interval.
Confidence interval = 160.0 ± (2.776 * 4.297) ≈ 160.0 ± 11.9 (rounded to one decimal place)
Using the sample mean, standard deviation, and critical value, we constructed a 90% confidence interval for the mean noise level, which is approximately (148.1, 171.9) decibels. This confidence interval provides an estimate of the range within which the true mean noise level at these airports is likely to fall with 90% confidence.
To know more about confidence interval refer here:
https://brainly.com/question/32278466?#
#SPJ11
PLEASE HELP!! DUE REALLY SOON (LINK)
Answer:
youngest=115
middle=150
elder=230
Step-by-step explanation:
let the youngest be x
the middle will be x+35
the oldest will be 2x
x+x+35+2x=495
4x+35=495
4x=495-35
4x=460
x=115
since the youngest is x,the money he will receive is $115.
the middle will be x+35 which is equal to 115+35=$150.
lastly the oldest will be 2x which is equal to 2×115=$230.
Answer:
Defined variables:
Y - amount the youngest son gets
M - amount the middle son gets
O - amount the oldest son gets
Y got $115
M got $150
O got $230
Step by Step explaination:
If Y is the youngest, then the middle son, M = Y + $35 since the middle child gets $35 more than the youngest gets. The oldest son, O = 2Y since it’s twice the amount the youngest gets.
If you add each of those up, the equation you get is 2Y + (Y+$35) + Y = $495. Now you can solve for Y, the youngest son.
2Y + (Y+$35) + Y = $495
4Y + $35 = $495
4Y = $460
Y = $115
If Y gets $115 and M gets $35 more, M gets $150.
If Y gets $115 and O gets twice that amount, O gets $230.
To double check my work add 230 + 115 + 150. This equals $495. Hope this helps!
suppose it is reported that 80% of all people subscribe to a cable television service versus others. a student believes it is different and decides to test this claim by randomly sampling people and responded that they subscribe to cable or satellite television versus others at a level of significance. student work: : : the test z-statistic is , and the p-value is . since we fail to reject . therefore, there is not sufficient evidence at level of significance to conclude the proportion of people who subscribe to a cable television service versus others is different from %. task: the student who submitted their work failed to check the conditions for the problem. let's help them out. remind the student of the conditions and how to check them. tell the student why we need to check each condition.
To perform a hypothesis test on the proportion of people who subscribe to a cable television service versus others, we need to check the following conditions:
1. Random Sampling: Ensure that the sample is randomly selected, which means each person has an equal chance of being selected. This is important to avoid biases and ensure the sample is representative of the population.
2. Independence: If sampling without replacement, the sample size (n) should be less than 10% of the population size (N) to assume independence. This is called the 10% Rule. Independence is important because the outcome of one person's choice should not affect another person's choice.
3. Normality: We need to ensure that the sampling distribution of the sample proportion (p-hat) is approximately normal. This can be checked using the success-failure condition, which states that both np and n(1-p) should be greater than or equal to 10. This ensures that the distribution is sufficiently normal to apply the z-test.
To help the student, remind them to:
1. Verify that the sample is random.
2. Check the independence condition by confirming the sample size is less than 10% of the population size.
3. Check the normality condition by calculating np and n(1-p) and making sure both values are greater than or equal to 10.
It is crucial to check these conditions because if they are not met, the hypothesis test's results may not be valid or reliable. Meeting these conditions ensures that the statistical methods applied are appropriate and provide accurate results for making conclusions.
To learn more about Distribution - brainly.com/question/31197941
#SPJ11
Find the coordinates of the point P along the directed line segment AB so that AP to PB is the given ratio. A(-2, -4), B(6, 1); 3 to 2
In order for the ratio of AP to PB to be 3/2, the coordinates of point P along the directed line segment AB are (14/5, -1).
What exactly is a section formula?The section formula returns the coordinates of a point that divides the line connecting two points in a ratio, either internally or externally.
Section formula is given as follows:
\((\frac{mx_{2 }+nx_{1} }{m+n} , \frac{my_{2} +ny_{1} }{m+n})\)
In math, how do you find coordinates?Start at the point and trace a vertical line up or down to the x-axis. There you have your x-coordinate. Then repeat the process, but this time follow a horizontal line to find the y-coordinate.It is given that the coordinates of the points A and B are A(-2, -4), B(6, 1) and AP/PB = 3/2
Let the coordinates of the point P be (a, b).
By using section formula,
(a, b) = \((\frac{mx_{2 }+nx_{1} }{m+n} , \frac{my_{2} +ny_{1} }{m+n})\)
(a, b) = \((\frac{3(6)+2(-2)}{3+2} , \frac{3(1) +2(-4)}{3+2} )\)
(a, b) = \((\frac{18 - 4}{5} , \frac{3-8}{5})\)
(a, b) = \((14/5, -5/5)\)
(a, b) = \((14/5, -1)\)
Therefore, the coordinates of the point P along the directed line segment AB so that the ratio of AP to PB is 3/2 are (14/5, -1).
Learn more about coordinates based problems here:
https://brainly.com/question/12959377
#SPJ13
Baka borrows $2,000 to buy a piano. The simple interest owed at the end of 3 years is $1,080. What is the annual interest rate on Baka’s loan for the piano?
a researcher recorded reaction time to respond to a sound. if the data of the research subjects are presented in a frequency distribution graph, what type of graph should be used?
If the data of the research subjects are presented in a frequency distribution graph, a histogram-type graph should be used.
If the data are presented in a frequency distribution graph, then the type of graph that should be used is a histogram. A histogram is a type of bar graph that displays the distribution of a continuous variable by dividing the range of values into intervals, and bins, and counting the number of observations that fall within each bin.
If the academic majors were nominal a bar graph could also be used to display the frequency of each major. In a bar graph, each category would be plotted on the horizontal axis, and the frequency of students in each category would be plotted on the vertical axis.
To learn more about the histogram
https://brainly.com/question/30701461
#SPJ4
Amy, Bruce, and Carlos collected a total of 168 pounds of cans to recycle. Bruce collected 1/3 the number of pounds of cans Carlos collected. Amy collected the same number of pounds of cans as Bruce and Carlos combined. Solve the equation for c, and then determine the number of pounds of cans Bruce collected.. Show all work necessary to support your answer
Answer:
\(c = 63\\b=21\)
Step-by-step explanation:
Let number of pounds of cans collected by Amy = \(a\)
Let number of pounds of cans collected by Bruce = \(b\)
Let number of pounds of cans collected by Carlos = \(c\)
As per question statement, total number of cans collected = 168
\(a+b+c=168\) ..... (1)
Number of pounds collected by Bruce is \(\frac{1}{3}\)rd of the pounds of cans collected by Carlos.
\(b = \dfrac{1}{3}c ..... (2)\)
Number of pounds collected by Amy is equal to number of pounds collected by Bruce and Carlos combined.
\(a = b+c\)
Using equation (2):
\(a = \dfrac{1}{3}c +c \\\Rightarrow a =\dfrac{4}{3}c ..... (3)\)
Using equations (2) and (3) in equation (1), we get:
\(\dfrac{4}{3}c+\dfrac{1}{3}c+c =168\\\Rightarrow \dfrac{8}{3}c = 168\\\Rightarrow c =63\)
Using equation (2):
\(b = \dfrac{63}{3} = 21\)
The conditional relative frequency table was generated using data that compares the favorite subjects of male and female students at a high school. The survey was given to 120 male students and 180 female students. How many students in the survey said that math was their favorite subject? 42 81 120 123.
123 Students to the poll who used data from the conditional relative frequency table indicated that math was their preferred topic.
1. A total of 120 male students were surveyed.
According to the data, 0.35 percent of male students report math as their favorite subject. The percentage of male students who like math would be:
Male students: 0.35(120)=42
2. A total of 180 female students were surveyed.
According to the data, 0.45 percent of female students report math as their preferred subject. The percentage of female students that like math would be:
81 female students out of 180 total
Following that, the percentage of respondents who indicated that math was their favorite subject would be:
42 male students + 81 female students = 123 students
So, 123 Students who responded to the survey and used information from the conditional relative frequency table said that math was their favorite subject.
To learn more about frequency table click here:
brainly.com/question/28931302
#SPJ4
Whats an EQUATION that shows a population of 10,000 is growing at the rate of 5% per year?? PLEASE INCLUDE A GRAPH PLSS!
EZ PTS PLS HELP :D TY YALL
Answer:
A.
Step-by-step explanation:
\(4\sqrt{3} =\sqrt{48} \\3\sqrt{6} =\sqrt{54} \\2\sqrt{7} =\sqrt{28} \\5\sqrt{2} =\sqrt{50}\)
The file sequences.mat contains a set of fictitious bio-sequence in a cell array sequences {mu}(t). Thus sequences {3}(:) is the third sequence, GTCTCCTGCCCTCTCTGAAC which consists of 20 timesteps. There are 20 such sequences in total. Your task is to cluster these sequences into two clusters, assuming that each cluster is modelled by a Markov chain. State which of the sequences belong together by assigning a sequence v^n to that state for which p(h∣v^n) is highest. You may wish to use mixMarkov.
The exact code or specific sequence assignments cannot be provided without knowledge of the programming context or access to the mixMarkov function and the sequences data.
Clustering bio-sequences into two clusters using Markov chains can be achieved by applying a mixture model approach. In this case, the mixMarkov function can be utilized to assign the sequences to their respective clusters based on the highest conditional probability.
Given the file sequences.mat containing the bio-sequences in the cell array sequences, the mixMarkov function can be employed to perform the clustering. This function models each cluster as a separate Markov chain and calculates the conditional probability of each sequence belonging to a particular cluster.
By running the mixMarkov algorithm on the sequences data with two clusters, the function will assign each sequence to the cluster for which the conditional probability p(h∣v^n) is highest. The resulting clustering will group together sequences that share similar characteristics based on their Markov chain modeling.
It is important to note that the implementation details of the mixMarkov function and the specific assignment of sequences to clusters will depend on the programming language or software used for analysis.
Therefore, the exact code or specific sequence assignments cannot be provided without knowledge of the programming context or access to the mixMarkov function and the sequences data.
To learn more about sequence from the given link
https://brainly.com/question/12491544
#SPJ4
4) Differential equation a, (x)y" + a₁(x)y' + a₂(x)y = 0 is given. The functions ao. a₁, a2 are continuous on a ≤ x ≤ b and a(x) = 0 for every x in this interval. Let f₁ and f₂ be linearly independent solutions of this DE and let A₁B₂-A₂B₁ 0 for constants A₁ A2, B₁, B₂. Show that the solutions A₁f₁ + A₂f2 and B₁f1 + B₂f2 are linearly independent solutions of the given DE on a ≤x≤b. (Hint: Use Wronskian determinant to prove the linearly independence)
The linear combinations A₁f₁ + A₂f₂ and B₁f₁ + B₂f₂ are indeed linearly independent solutions of the given differential equation on the interval a ≤ x ≤ b.
We are given a second-order linear homogeneous differential equation of the form a(x)y" + a₁(x)y' + a₂(x)y = 0, where ao, a₁, and a₂ are continuous functions on the interval a ≤ x ≤ b, and a(x) = 0 for every x in this interval. Let f₁ and f₂ be linearly independent solutions of this differential equation.
We want to show that the solutions A₁f₁ + A₂f₂ and B₁f₁ + B₂f₂, where A₁, A₂, B₁, and B₂ are constants, are also linearly independent solutions on the interval a ≤ x ≤ b.
To prove their linear independence, we can calculate the Wronskian determinant, denoted as W(f₁, f₂), which is given by:
W(f₁, f₂) = |f₁ f₂|
|f₁' f₂'|
where f₁' and f₂' represent the derivatives of f₁ and f₂ with respect to x.
If the Wronskian determinant is nonzero for a given interval, then the functions are linearly independent on that interval.
Calculating the Wronskian determinant for the linear combinations A₁f₁ + A₂f₂ and B₁f₁ + B₂f₂, we obtain:
W(A₁f₁ + A₂f₂, B₁f₁ + B₂f₂) = |(A₁f₁ + A₂f₂) (B₁f₁ + B₂f₂)|
|(A₁f₁ + A₂f₂)' (B₁f₁ + B₂f₂)'|
Expanding and simplifying this determinant will yield a nonzero value if A₁B₂ - A₂B₁ is nonzero.
Since A₁B₂ - A₂B₁ is given to be nonzero, we can conclude that the linear combinations A₁f₁ + A₂f₂ and B₁f₁ + B₂f₂ are indeed linearly independent solutions of the given differential equation on the interval a ≤ x ≤ b.
To learn more about differential equation click here, brainly.com/question/25731911
#SPJ11