{{c1::aneuploidy}} is the deletion or duplication of an entire chromosome

Answers

Answer 1

Aneuploidy refers to an abnormal number of chromosomes, which can be caused by the deletion or duplication of an entire chromosome.

A chromosome is a long, coiled-up molecule of DNA that carries genetic information in the form of genes. Humans have 23 pairs of chromosomes, for a total of 46 chromosomes in each cell. Chromosomes are located in the nucleus of a cell and play a crucial role in cell division, as they must be replicated and distributed evenly between daughter cells during mitosis and meiosis.

To know more about chromosome visit :

https://brainly.com/question/30993611

#SPJ11


Related Questions

Which organelle makes the proteins that are needed by the cell?
cell membrane
Golgi apparatus
ribosomes
nucleus

Answers

Answer: The answer is "Ribosomes".

Explanation: Ribosomes are responsible for making protein through amino acids. The proteins created are essential to cell and organismal function. Some ribosomes are attached to the endoplasmic reticulum (rough ER), others float freely within the cytoplasm.

Answer:

ribosomes is right

Explanation:

i just did it and passed sooooo

A table of four types of carbohydrates is shown below. Which list correctly matches the functions to the types of carbohydrates? Type of carbohydrate Cellulose Chitin Description Major component of plant cell walls Major component of fungal cell walls and arthropod exoskeletons Stored in liver and muscle cells, broken down to glucose when blood glucose levels decrease Glycogen Starch Stored in plant roots and seeds, provides food for seeds to germinate or for animal consumption A Energy: glycogen and starch & Structure: cellulose and chitin B Energy: cellulose and chitin & Structure: Glycogen and starch С Energy: chitin and glycogen & Structure: cellulose and starch D Energy: cellulose and starch & Structure: chitin and glycogen​

Answers

Answer is A:

Explanation:

A table of four types of carbohydrates is shown below. Which list correctly matches the functions to

Glycogen and starch are for ENERGY while cellulose and chitin are for STRUCTURE

Polysaccharides are complex carbohydrate molecules formed from monomeric molecules called monosaccharides. Polysaccharides perform varying functions in living organisms that possess them.

The types of polysaccharides that we have are as follows:

Cellulose: Cellulose is the major component of plant's cell wall. It gives the cell additional structural strength.

Chitin: Chitin is the major component found in the cell wall of fungi and exoskeletons of arthropods where it provides structural strength.

Glycogen: Glycogen is the form of carbohydrate glucose is converted to when in excess in the bloodstream. It is stored in the liver and muscles. Glycogen is changed back to glucose when it is needed for energy production.

Starch: Starch is the form by which plant cells store food. It is stored in the root and seed of plants. Starch is broken down into glucose when need arises for energy.

Therefore, glycogen and starch are for ENERGY while cellulose and chitin are for STRUCTURE

Learn more: https://brainly.com/question/16580858?referrer=searchResults

during the s phase of interphase, the cell replicates its

Answers

During the S (synthesis) phase of interphase, the cell replicates its DNA. This is a critical stage in the cell cycle as it ensures that each daughter cell receives a complete and accurate copy of the genetic material.

The replication process begins with the unwinding of the DNA double helix, which allows the replication machinery to access the individual strands. The replication machinery, composed of enzymes such as helicases and polymerases, then adds new nucleotides to the exposed strands, creating two identical copies of the DNA molecule. This process is called semi-conservative replication, as each new DNA molecule is composed of one original strand and one newly synthesized strand. The S phase ensures the proper distribution of genetic information to the daughter cells, ensuring the continuation of the cell cycle and the preservation of the genetic material.

Learn more about DNA:

brainly.com/question/264225

#SPJ4

What is it called when vertebrates have well-developed sense organs on the head?

A) Endoskeleton
B) Dorsal Root Ganglia
C) Cephalization
D) Enclosed Nervous System

Answers

Answer:

Your answer is C) Cephalization

Explanation:

Cephalization is the mouth, sense organs, and nerve ganglia that become concentrated at the front end of an animal, producing a head region. And it is also a evolutionary trend spanning over many generations. Hope this helped :)

Answer:

I hope this helps.

What is it called when vertebrates have well-developed sense organs on the head?A) EndoskeletonB) Dorsal

Why do different individuals of the same species have different traits?
A.
Individuals have proteins that produce genes with completely different functions from other individuals.
B.
Individuals have different genes that produce proteins with completely different functions from other individuals.
C.
Individuals have differences in their genes that result in protein variations.
D.
Individuals have different proteins that cause variations among their genes.
Which detail from the passage best creates a suspenseful mood?

Answers

Answer:

Offspring acquire a mix of traits from their biological parents. Different organisms vary in how they look and function because they have different inherited information. In each kind of organism there is variation in the traits themselves, and different kinds of organisms may have different versions of the trait.

How does deforestation affect the water cycle:

A. It increases the amount of percolation
B. It increases the amount of runoff
C. It increases the amount of transpiration
D. It increases the amount of precipitation

Answers

Answer:

B. It increases the amount of runoff

1. Explain the difference between
transcription and translation in DNA.
Make sure you are able to take a DNA
segment and transcribe it and
translate it into mRNA and proteins.

Answers

Transcription is the process by which an RNA molecule is produced from one of the DNA strands whereas translation, on the other hand, is the process by which the mRNA molecule is used to synthesize a specific protein.

What is the difference between transcription and translation in DNA?

Transcription is the process by which RNA polymerase enzyme reads the DNA sequence and synthesizes an RNA molecule that is complementary to one of the DNA strands.

During transcription, the DNA double helix is unwound, and the RNA polymerase enzyme adds nucleotides to the growing RNA molecule following the base-pairing rules of A-U and G-C. The resulting RNA molecule is called messenger RNA (mRNA), and it carries the genetic information from DNA to the site of protein synthesis.

Translation, on the other hand, is the process by which the mRNA molecule is used to synthesize a specific protein. Translation occurs in the ribosome, where transfer RNA (tRNA) molecules with attached amino acids bind to the mRNA codons in a complementary fashion. This process results in the formation of a polypeptide chain that folds into a functional protein.

To demonstrate these processes, let's take the following DNA segment as an example:

DNA sequence: TACAGCGACGCGTATCGAGG

Transcription:

The first step in transcription is to identify the DNA strand that will serve as the template for the RNA synthesis. In this case, we will use the template strand (the complementary strand to the coding strand).

Template DNA strand: ATGTCGCTGCGCATACTCC

The RNA polymerase enzyme will read this template strand and synthesize a complementary RNA molecule by adding nucleotides to the growing chain. The resulting mRNA molecule will have the same sequence as the coding strand (except for U instead of T).

mRNA sequence: AUGUCGCUGCGCAUACUCCG

Translation:

The mRNA sequence can now be translated into a protein sequence using the genetic code, which is a set of rules that determine how the nucleotide sequence of an mRNA molecule is translated into the amino acid sequence of a protein.

AUG-UCG-CUG-CGC-AUA-CUC-CG

Using the genetic code table, we can determine the amino acid sequence of the protein:

AUG: Methionine

UCG: Serine

CUG: Leucine

CGC: Arginine

AUA: Isoleucine

CUC: Leucine

The resulting protein sequence is: Met-Ser-Leu-Arg-Ile-Leu.

Learn more about transcription and translation at: https://brainly.com/question/11214205

#SPJ1

According to this cladogram, what do amphibians and birds have in common? 1. Four limbs2.Egg Shells3.Amniotic egg4.Hair/fur

According to this cladogram, what do amphibians and birds have in common? 1. Four limbs2.Egg Shells3.Amniotic

Answers

Like any cladogram, we have traits that will mark differences among groups and will allow us to solve phylogenies, in this case, each dot is a trait, so if we look at the point where amphibians diverge from the rest of the groups we have four limbs, therefore the correct answer is option 1.

4. How does the description of chores in paragraph 3
contribute to the author's explanation of division of
labor?
OA. It explains that the division of chores in a household
is how cells split into different pieces.
OB. It reveals that responsibility is stressful and workers
often divide their workload to finish quickly.
OC. It explains how work can get done more quickly
when it is divided between many workers.
OD. It demonstrates that workers paying attention to
details is more important than finishing a job quickly.

THINGS GET MORE COMPLICATED WHEN YOU’RE OLDER
ON COMMON LIT

Answers

The description of chores in paragraph 3

contributes to the author's explanation of division of labor through option C. It explains how work can get done more quickly when it is divided between many workers.

What is division of labor?

Division of labor is the practice of breaking down a complex task or job into smaller, more specialized tasks or sub-tasks.

This allows each person or group to focus on a specific part of the job, using their skills and expertise to perform that task more efficiently and effectively than if they were responsible for the entire job themselves.

It is often seen as a key driver of economic growth and productivity.

learn more about Division of labor: https://brainly.com/question/2671091

#SPJ1

A segment of RNA has the sequence AUU. What explanation can be made about how this codon came to be?
A
The RNA strand formed from the rearrangement of the bases in a DNA strand.

B
The RNA strand broke off from a DNA strand that had a much longer genetic code.

C
The RNA codon was transcribed from a DNA strand with the sequence TAA.

D
The RNA codon was transcribed from a DNA strand that had the sequence UAA.

Answers

Answer:

C - The RNA codon was transcribed from a DNA strand with the sequence TAA.

Explanation:

transcription describes the process by which a strand of mRNA is coded for by the protein RNA polymerase taking RNA bases and matching them in complimentry with the DNA bases

Do y’all know each of these ?
HELP PLEASE !!!

Do yall know each of these ?HELP PLEASE !!!

Answers

Answer:

5. inner membrane

Explanation:

Answer:

1 - rough endoplasmic reticulum

2 - the purple is chromatin and the red is the nucleolus

3 - mitochondria

5 - cytoplasm

11 - lysosomes

12 - ribosomes

Explanation:

I'm not sure about the rest of them and these are for if it is an animal cell. Hope this helps!

A section of a topographic map is shown below.



What is the difference in elevation in meters between Point X and Point Y on the map?

A section of a topographic map is shown below.What is the difference in elevation in meters between Point

Answers

Answer:

360 m

Explanation:

Answer:

fish

Explanation:

moment

Which best determines the health of a lake used as a source of freshwater?
A. its depth and width
B. its temperature and pH
C.its location and depth
D.its temperature and depth

Answers

Answer:

B

Explanation:

A measure of the natural populations of algae, plants, fish, and other wildlife provides evidence of the health of a body of water.

how have governments been involved in the protection of vulnerable species? Provide an example of a government policy.

Answers

Governments have been involved in the protection of vulnerable species through the Endangered Species Act or ESA which is managed through the program for endangered species.

The initiative aims to facilitate the recovery of species on the Endangered Species List and, via proactive conservation activities, to stop further species from being added to the list.

According to the provisions of the Wild Life (Protection) Act, 1972, Protected Areas, including National Parks, Sanctuaries, Conservation Reserves, and Community Reserves, covering important habitats across the nation, were established to better protect wildlife, including threatened species and their habitat. These species and the ecosystems they depend on are protected by the ESA.

To learn more about  Endangered Species Act visit:

https://brainly.com/question/10415903

#SPJ1

The San Marcos salamander, Eurycea nana, is a light reddish-brown
translucent salamander about 2-5 cm in length. E. nana is found only in
Spring Lake and a portion of the San Marcos River.
Which human activity would most likely decrease the ability of the
salamanders to survive?

The addition of a new food source into the river that limits competition for
resources

Tourism that helps fund the educational programs related to river ecosystem
conservation

Public transportation that reduces the number of automobiles that contribute to
pollution runoff into the river

Increasing water consumption that decreases the flow of clean water from the
springs that feed the river

Answers

Answer: Increasing water consumption that decreases the flow of clean water from the

springs that feed the river

Explanation: Because the salamanders have less clean water, pollution becomes more of a problem, also all of the other options would help the salamanders.

The human activity that would most likely decrease the ability of the salamanders to survive is increasing water consumption, which decreases the flow of clean water from the springs that feed the river, which is the last option.

What are the human activities that lead to habitat loss?

The salamander is only found in a limited area of the San Marcos River, which relies on clean water from the springs, so decreasing the flow of clean water would negatively impact the salamander's survival, as it depends on specific water conditions for survival. As water is withdrawn from the springs to meet human needs, such as agriculture, industry, or household use, less water is available, which can have a detrimental effect on the habitat that the salamander requires because of human needs.

Hence, increasing water consumption decreases the flow of clean water from the springs that feed the river, so the last option is the correct option.

Learn more about the human activities that lead to habitat loss here.

https://brainly.com/question/8493086

#SPJ6

Each gram of fat you consume provides over twice as many calories as a gram of protein or carbs. What does this tell you about the body's ability to burn off these fuels? which would require the most energy to burn?

Answers

Since each gram of fat provides over twice as many calories as a gram of protein or carbs, this indicates that the body needs almost double the energy in order to burn each gram of fat and therefore the body needs to workout extra to achieve that.

Fats are the fatty acids that are present stored inside the body of an organism. The fats take more time to burn off and yields around 9 calories when each gram of fat is burned off.

Calories are the energy content present in the food. The higher the calories the higher energy it provides to the body. This energy gets stored in the body in forms of fats.

To know more about fats, here

brainly.com/question/18934340

#SPJ4

Explain what determines Christchurch's air temperature during normal years.

Answers

Answer:The closer a location is to the equator, the more energy it receives from the sun. Therefore, a location's air temperature is affected by its distance from the equator. The amount of energy from the Sun does not change during El Niño years so there must be some other cause for cooling in New Zealand

Explanation:

Energy from the sun is transferred to Earth’s surface. Some of that energy is then transferred to the air above the surface. The closer a location is to the equator, the more energy it receives from the sun. Therefore, a location’s air temperature is affected by its distance from the equator. The amount of energy from the Sun does not change during El Niño years.

What else affects the air temperature of Christchurch?

The energy transmits from warmer substances to colder substances. Warmer air transmits energy to cooler currents whereas warmer currents transmit energy to cooler air. In normal years, a warm current passes by New Zealand and warms its air. Something may disturb this current during El Niño years.

Thus, In normal years, a warm current passes by New Zealand and warms its air.

To learn more about the temperature of Christchurch click here:

https://brainly.com/question/16847701

what is it that enables proteins to perform different tasks in the body?

Answers

Proteins are able to perform different tasks in the body due to their unique three-dimensional structure, which is determined by the sequence of amino acids in the protein.

The specific arrangement of amino acids allows proteins to interact with each other and with other cellular components in specific ways, allowing them to perform a wide variety of functions. For example, some proteins act as enzymes and catalyze chemical reactions, while others transport molecules across cell membranes or act as structural components of tissues. Additionally, the activity of many proteins can be regulated by the addition or removal of chemical modifications, such as phosphorylation or acetylation, which can alter their structure and activity. The ability of proteins to perform different tasks is crucial for the proper functioning of the body, as they carry out a wide range of essential processes, including metabolism, cell signaling, and gene expression.

Learn more about amino acids here:

https://brainly.com/question/28409615

#SPJ4

Plants are producers because they make their own food from _____, carbon dioxide, and water.

sunlight


hydrogen chloride


sodium hydroxide


carbon monoxide

I NEED AN EXPLANATION I will GIVE Brainliest whoever answers first

Answers

i hope this helps!!!!!!!!!

Plants are producers because they make their own food from _____, carbon dioxide, and water.sunlighthydrogen
Plants are producers because they make their own food from _____, carbon dioxide, and water.sunlighthydrogen

Answer:

sunlight

Explanation:

plants absorb sunlight > using their chlorophyll to convert it to food

as a nations move through the ------ demographic trends change

Answers

As a nations move through the Demographic transition, demographic trends change.

What are Demographic trends?

Demographic trend is defined as the popular term for any measurable change in the characteristics of a population over time such as increase or decrease of a particular ethnic group, sex ratio etc.

In this study of the population, in terms of size and density, fertility, mortality, growth, age distribution, migration, and the integration of all these with vital statistics and social and economic conditions.

Thus, as a nations move through the Demographic transition, demographic trends change.

Learn more about Demographic trends, here:

https://brainly.com/question/28967833

#SPJ1

Which is NOT involved at the beginning
of a nerve impulse?
A. reaching the threshold
B. strong stimulus
C. sodium leaving the cells
D. negative charge inside the cell

Answers

Answer: the answer would be C

Sodium ion do not leave at the beginning of the nerve impulse.

They leave after the gated channel opens up after receiving a stimulus.What is a nerve impulse? It is an electrical signal that travels along a nerve fiber in response to a stimulus and serves to transmit record of sensation from a receptor or an instruction to act to an effector.Nerve impulse begin at dendrite and then move toward the cell body of neuron.

To know more about nerve impulse here

https://brainly.com/question/13126722

#SPJ2

The Earth is made up of 75% water. Sources such as oceans, lakes, anD rivers have an important role in keeping Earth’s surface insulated and warm. What property of water provides this protection?

Answers

Answer:

The  high specific heat capacity of water.

Explanation:

When there is a need to raise the temperature of a given amount of a substance by a given amount,the amount of heat required is called heat capacity for that substance.Therefore the amount of heat energy required to  raise the  temperature of I g of water by 1 degree is called the specific heat capacity of  water.

This property of water is due to abundant hydrogen bonds in water molecules.These bonds restricts moment of molecule of water,and thus thier diffusion. Thus in order to free these molecules the hydrogen bonds must be heated up to break so that they could gain kinetic energy to escape. This characteristic makes molecules of water to resist wide fluctuations in body temperature.Hence stabilizing the body fluid in living organism

A change in earth temperature is managed by water specific heat capacity because,it takes significant amount of heat for the water to boil,and when there is a need  release heat during cooling this is done slowly with insignificant rise in the earth temperature.,(since 75% of earth is water,)this keeps the earth temperature in a tolerable limits.

7) a single bacterial cell can live at various temperatures during its lifetime in part because it can alter the composition of its lipid bilayer. how would lipid composition differ when the bacterium finds itself in warmer temperatures vs when the bacterium finds itself in cooler temperatures?

Answers

When a bacterium moves from a warm to a cold environment, an adjustment is performed to create lipids with shorter hydrocarbon tails and more double bonds. In higher temperatures, the membrane should be more saturated and stiff.

In cooler temperatures, you want the membrane to be more fluid, so you shorten and unsaturate the chains.

Prokaryotes are single-celled creatures that belong to the Bacteria and Archaea domains. Prokaryotic cells are significantly smaller than eukaryotic cells, lack a nucleus, and are devoid of organelles. A cell wall surrounds all prokaryotic cells.

Bacteria are classified as unicellular life-forms because they lack a membrane-bound nucleus and other internal components.

Learn more about single bacterial cell

https://brainly.com/question/8883278

#SPJ4

Which protein attaches HIV-1 to the surface of a sensitive cell?

Answers

The protein that attaches HIV-1 to the surface of a sensitive cell is gp120.

What is HIV-1? Human immunodeficiency virus (HIV) is a retrovirus that causes acquired immunodeficiency syndrome (AIDS). HIV-1 is a strain of HIV that is responsible for most infections in humans.

When HIV infects immune system cells, it progressively destroys or incapacitates them, resulting in a weakened immune system that cannot fight off other infections and diseases. HIV is transmitted via bodily fluids, typically through unprotected sexual activity, but also via sharing needles or coming into touch with contaminated blood.

To enter the host cell, the virus must first attach itself to the host cell. HIV does this with the assistance of its surface protein, gp120. HIV attaches to the CD4 receptor on human immune cells (primarily T helper cells) using the gp120 protein. After binding to CD4, HIV attaches to a chemokine coreceptor (usually CCR5 or CXCR4).

These receptors allow HIV to enter the cell after binding.

To know more about HIV-1, refer here:

https://brainly.com/question/29602728#

#SPJ11

lysosomes >
chloroplasts >
mitochondria >
centrioles >
cilia and flagella >
endoplasmic reticuli >

Answers

The eukaryotic cells contain the lysosomes, chloroplasts, mitochondria, centrioles, cilia, flagella, and the endoplasmic reticulum, and these structures help the cell in a variety of functions such as digestion, photosynthesis, energy production, etc.

What is the function of the organelles?

Plant and animal cells have endoplasmic reticulum, which aids protein synthesis; mitochondria, which aid in energy synthesis; chloroplasts, which aid in photosynthesis; and some unicellular cells have cilia and flagella, which aid in movement; the centriole can make microtubules.

Hence, the eukaryotic cells contain the lysosomes, chloroplasts, mitochondria, centrioles, cilia, flagella, and the endoplasmic reticulum, and these structures help the cell in a variety of functions such as digestion, photosynthesis, energy production, etc.

Learn more about the function of the organelles here.

https://brainly.com/question/29776469

#SPJ1

Which two statements describe forces that move water within the global
ocean conveyor belt?
A. Upwelling causes cold water to separate and sink below warmer
water.
B. Saltwater freezes, leaving behind warmer freshwater that flows
faster.
C. Water freezes, causing the saltier and denser remaining liquid
water to sink.
D. Wind pushes surface water away from shore, and cold water rises
to replace it.

Answers

The correct answer is C

Which sentence describes a feature of a large central vacuole that allows it to
maintain a plant cell's rigidity?
A. It contains chlorophyll for photosynthesis.
B. It is made of tough material that provides support.
C. It allows water to pass into the cell.
D. It exerts pressure on the wall of the cell.

Answers

The correct option is D. A large central vacuole exerts pressure on the walls of the cell.

What is a vacuole?

The vacuole is a membrane-bound organelle found in plant cells only. Vacuole performs various functions such as storage and digestion.

Chlorophyll is an important pigment for photosynthesis. It is located in the chloroplast. It plays a very important role in photosynthesis. The cell membrane helps water and other molecules to pass into the cell. It is called a semipermeable membrane.

Microfilaments provide support to the cell.  The vacuole is present in plants, bacteria, and algae. The main function of the vacuole is to maintain the turgor pressure in the cell. They also help in the storage of various substances.

Therefore,  The correct option is D. A large central vacuole exerts pressure on the walls of the cell.

To learn more about the cell, refer to the link:

https://brainly.com/question/3142913

#SPJ1

Answer:

D. It exerts pressure on the wall of the cell.

Explanation:

Verified!

Which of the following is a particle with a positive electrical charge?
Protron
Electron
Positron
Neutron

Answers

Answer:

Protron

Explanation:

Every proton has a positive charge, every electron has no charge, and every neutron has no charge. There is no such thing as a positron. I hope i help! :)

Which of the following is NOT a function of the skeletal system?

O protect body organs

o provides attachment site for
muscles

O produces blood cells

O produce heat


Somebody help me

Answers

Answer:

The option which does not represent a function of the skeletal system is production of body heat.

What are the basic functions of the skeletal system?

Locomotion: The skeletal system helps in the movement of bodies.

Support: The skeletal system provides support to the organism.

Production of erythrocytes: The bone marrow is a part of the skeletal system that produces red blood cells.

The question is not complete. The complete question is

Which of the following is not a function of the skeletal system?

A) Locomotion

B) Production of erythrocytes

C) Storage of minerals

D) production of body heat

The monosaccharides and the disaccharides are designated as _____ because they provide calories.

Answers

The monosaccharides as well as the disaccharides are designated as nutritive sweeteners since they provide calories.

Nutritive sweeteners, which are also sometimes termed as caloric sweeteners supply energy in the form of carbohydrates. A few nutritive sweeteners are naturally present in foods such as fructose, which is found in fresh fruits.

Monosaccharides are the simplest sugars or carbohydrates having the general formula (CH₂O)ₙ and are generally colorless, water soluble, crystalline solids. Glucose, fructose as well as galactose are all examples of monosaccharides.

Disaccharides are made up of two monosaccharides which are linked together by means of a glycosidic bond. They are also soluble in water. The examples of disaccharides are sucrose, lactose as well as maltose.

To learn more about glycosidic bond here

https://brainly.com/question/13265202

#SPJ4

Other Questions
What fraction of the original area is the area of the reduced blood vessel? How might a calculation like this help a biomechanical engineer working in the field? Include your understanding of the cardiovascular system in your answer.Diameter of inner area of reduced blood vessel is 4 Pretend that you were the president of a country. What are 3 things you will do to address the centrifugal forces and 3 things you will do to instill centripetal forces or nationalism in your country? Rewrite in simplest terms: 3(7u+4)-10(-4u+9)3(7u+4)10(4u+9) nurse oliver observes constant bubbling in the water-seal chamber of a closed chest drainage system. what should the nurse conclude? Find an equation of the tangent line to the curve at each given point.x=t2-4, y=t2 - 2t t2-2tat (0, 0)at (-3, -1)at (-3, 3) What are the 3 triangle similarity shortcuts? Determine if the statement is true or false. A six pack refers to a simultaneous array that shows six photos arranged in two rows of three photos each. Why should flag burning not be protected by the first amendment? Cite Text Evidence We should not judge people by their appearance is one of the themes of Frankenstein. How do the events in the story and the characters behavior convey Given triangle ADE shown below with overline BC || overline DE . if AB=16, BD=8, and DE = 30, which of the following is the length of overline BC1) 202) 603) 154) 22 How did some tyrants help the poor?In Ancient Greek. In economics, investment is the expenditure by businesses on new plant and equipment. true false HELP PLEASE!! GIVING BRAINLIEST!! If you answer this correctly ill answer some of your questions you have posted! (17pts) As the principal speaker in an inter school debate.Write your argument for the motion "African countries need military rule and not civilian rule" What is the connection between prescription opioids and illegal substances like heroin? The Civil War - The Gilded Age Review AnswersI just finished the test using answers I found on here and almost got 60% so I'll be posting the proper ones here.1- c) the shift the focus of the war...2- b) the act forced citizens to return runaway slaves...c) some northern states passed their own laws...3- a) people enjoyed free land provided by the Homestead Act...4- b) help the nation heal from the effects of the war5- c) the victory gave the union control of the mississippi river6- b) the destruction of the southern economy...7- b) he was acquitted...8- b) both supported policies...9- a) many people moved...10- a) the telephoned) electric lighting11- d) both were regulations...12- b) improving investment...e) helping create the company...13- b) they would go into small spaces...14- c) the plow was affordable...15- d) violent native american resistance...16- b) they were often pushed...17- b) farming communities had little...18- a) realism19- a) arrived from southern, central, and eastern europe20- c) after the compromise, northern troops were removed from the south...21- b) the senate is controlled by the railroad companies22- a) farmers' organizations became involved...c) farmers and other working-class people suffered...hope this helps a ball is thrown straight up from the edge of the roof of a building, at 20 meters above the ground. one second later, another ball is dropped from the roof with zero initial velocity. the two balls hit the ground at the same time. what was the initial speed of the first ball? Describe one effect of expanding trade networks within china hiiiiiii im soooooooo tired but i gotta clean my room lol Appropriate course of action after discovering classified information about Internet cyber-awareness?