Without the need for mechanical or chemical digestion, a liquid diet comprising glucose, amino acids, and other building blocks might be consumed and absorbed.
Which vitamins and minerals can be consumed without digestion?Foods must be tiny enough for your small intestine's cells to absorb them in order for you to be able to extract nutrients from them. Your food's particle size is decreased during digestion so that absorption may take place. However, some of the macronutrients in your diet, such carbohydrates and amino acids, are already tiny enough to not need to be digested. Other nutrients, such as vitamins and minerals, are present in food as tiny molecules that can be taken in whole.Learn more about the nutrient with the help of the given link:
https://brainly.com/question/13380395
#SPJ4
How is ADP converted to ATP?
by the addition of one adenosine molecule
Answer:
Two processes convert ADP into ATP: 1) substrate-level phosphorylation; and 2) chemiosmosis. Substrate-level phosphorylation occurs in the cytoplasm when an enzyme attaches a third phosphate to the ADP (both ADP and the phosphates are the substrates on which the enzyme acts).
for microbial biodiversity studies, it is common to identify the rather than the as a measure of biodiversity.
For microbial biodiversity studies, it is common to identify the genes rather than the organisms as a measure of biodiversity.
Biodiversity is the presence of different types of species in any region. Greater is the number of species of plants and animals in a certain area, more rich is the biodiversity of that region considered. These species are necessary to maintain the balance of ecosystem in the earth.
Genes are the basic factor of inheritance. These are transferred from the parent to their offspring. The genes carry the information for particular trait or character in them. These trait are responsible for the physical appearance as well as anatomy of a child.
To know more about biodiversity, here
brainly.com/question/23101752
#SPJ4
questions in the attached img. someone help me pls
Answer:
A. Medicine — Plasmids are used as an anti-stress medicine to cope with stress-related conditions. It is also used replicate proteins. It is also used in gene therapy.
B. Agriculture — It is used for metal resistances. It is also used for antibiotic resistances. It provide bacteria with genetic advantages.
1. Of the following people, Rosalind Franklin, James Watson, Francis Crick, and Maurice Wilkins, who may or may not have been given credit for discovering the shape of DNA initially?
All planets rotate counterclockwise except one. Which planet rotates clockwise?
Mars
Venus
Earth
Mercury
Answer:
venus is the only planet that relates opposite to the direction of all other planets
The image below represents two waves, X and Y, traveling through the same medium at the same speed. How are the two waves different? A. Wave Y has a greater wavelength than wave X. B. Wave Y has greater energy than wave X. C. Wave Y has a greater period than wave X. D. Wave Y has a greater frequency than wave X.
Answer:
The answer is B
Explanation:
the hollow bones of birds which keep birds light weight for flying is an example of what?
The hollow bones of birds which keep birds light weight for flying is an example of adaptation. These hollow bones are also called pneumatized bones which mean they're filled with space for air.
Hope this helps!
Explain enzyme-substrate specificity.
\(\purple{\tt{\huge{Answer}}}\)
substrate specificity. The active site of an enzyme is very specific to its substrates as it has a very precise shape. This results in enzymes being able to catalyze only certain reactions as only a small number of substrates fit in the active site. This is called enzyme-substrate specificity.
Answer:substrate specificity. The active site of an enzyme is very specific to its substrates as it has a very precise shape. This results in enzymes being able to catalyze only certain reactions as only a small number of substrates fit in the active site. This is called enzyme-substrate specificity.
Explanation:Enzymes and substrates share specificity in that an enzyme will only react with a specific substrate • This is because the active site is complementary in both shape and charge to a given substrate • The model by which this is known is ‘lock and key’ as the substrate is a precise structural fit for the enzyme, much like a lock and key • When the enzyme and substrate bind, they form an enzyme-substrate complex, before the substrate is catalytically converted into a product
The cytochrome c protein is sometimes used to describe the evolutionary relationship between species. This is because
the closer the DNA sequences are between species, the closer they are related on an evolutionary scale.
the closer the DNA sequences are between species, the futher apart they are related on an evolutionary scale.
the more differences in the DNA sequences are between species, the closer they are related on an evolutionary scale.
The closer the DNA sequences are between species, the closer they are related on an evolutionary scale.
The cytochrome c protein is a mitochondrial protein that is involved in cellular respiration and is present in almost all living organisms. The DNA sequence that encodes for this protein is highly conserved among different species, meaning that it has undergone very few changes throughout evolutionary history. The more similar the DNA sequences are between two species for this protein, the more closely related they are thought to be on an evolutionary scale. This has led to the use of cytochrome c protein as a molecular clock to estimate the divergence times between different species.
The cytochrome c protein is sometimes used to describe the evolutionary relationship between species because the closer the DNA sequences are between species, the closer they are related on an evolutionary scale. Cytochrome c is a highly conserved protein, meaning that its DNA sequence has remained relatively unchanged throughout evolution. By comparing the DNA sequences of cytochrome c between different species, scientists can determine how closely related these species are on an evolutionary scale. The fewer differences in the DNA sequences between species, the closer their evolutionary relationship.
To know more about DNA visit
https://brainly.com/question/264225
#SPJ11
Someone please answer I really need help!
Answer: ash is one of them
Explanation:
Which scientific claim can be made? Songbird numbers will increase due to the effects of climate change increasing global temperatures. Songbirds appear more often in April and May. With an increase in construction, songbirds will move from one neighborhood to another. A study by Dr. Birde showed that the number of songbirds in her yard increased due to a modified food source.
The scientific claim that can be made is "A study by Dr. Birde showed that the number of songbirds in her yard increased due to a modified food source."
In Dr. Birde's study, it was observed that the presence of a modified food source resulted in an increase in the number of songbirds in her yard. This suggests a positive correlation between the availability of the modified food source and the population of songbirds. By analyzing the data collected in the study, Dr. Birde was able to draw a conclusion that the modified food source had a significant impact on attracting songbirds to her yard.
The modification of the food source may have included factors such as specific types of feed, feeding stations, or other environmental conditions that were favorable for songbird attraction. This finding indicates that altering the food source can potentially influence the presence and abundance of songbirds in a given area. Further research and replication of this study could provide valuable insights into songbird conservation and habitat management strategies.
To know more about positive correlation
brainly.com/question/31588111
#SPJ11
In a Dihybrid cross, two heterozygous parents, AaBb x AaBb have an offspring. What is the ratio of the offspring??
Four important functions of soil in the ecosystem
Answer: regulator of water supplies, recycler of raw materials, habitat for soil organisms, and. landscaping and engineering medium.
Explanation:
Can y’all please help?
Blood leaves the heart to go to the rest of
the body through the
Answer:
arteries
Explanation:
goes back through veins
Answer:
blood leaves the heart to go to the rest of the body through the aorta which is the main Artery carrying oxygenated blood
27. In a study researchers looked at the effects of nutrition on reading ability. In Group A, children
ate at least three ounces of dark green vegetables every day for one month. In Group B, children
were fed their regular diet. At the end of the month, the children took a reading comprehension
test. Those who ate the green vegetables every day for one month (Group A) did not vary in their
test scores when compared to Group B.
What is the Experimental Group:
What is the Control Group:
What is the Dependent variable?
What is the Independent variable?
In a study researchers looked at the effects of nutrition on reading ability. In Group A, children ate at least three ounces of dark green vegetables every day for one month. In Group B, children were fed their regular diet. At the end of the month, the children took a reading comprehension test. Those who ate the green vegetables every day for one month (Group A) did not vary in their test scores when compared to Group B.
Experimental group- Students group A & B
Control Group- Diet
Independent variable- Diet
Dependent variable- Reading comprehension
Experimental group is the people on whom the experiment is done in the following case will the children in Group A and Group B.
Control Group in this case will be the diet the children were provided i.e. for Group A having ,diet of dark vegetables and Group B having regular diet.
Independent variable is the variable that we manipulate and control in experiment. in this case will be the diet of the children that has been manipulated for both the groups that is manipulated for measurement.
Dependent variable is the variable that is dependent on independent variable and changes with its manipulation. It will be the ability of reading the comprehension by the students of both the groups.
To learn more about Experimental group here
https://brainly.com/question/23389356
#SPJ1
How do viruses reproduce during the lysogenic cycle?
3. Sulfur dioxide emitted from power plants eventually causes acid rain in the atmosphere. Which term best describes acid rain?
A. Secondary pollutant
B. Primary and secondary pollutant
C. Primary pollutant
D. Greenhouse gas
Sulfur dioxide emitted from power plants eventually causes acid rain in the atmosphere best describes acid rain is a secondary pollutant.
Sulfur dioxide emitted from power plants eventually causes acid rain in the atmosphere, Primary pollutant is the term best describes acid rain.
What is meant by Primary pollutant?
An air pollutant released directly from a source is referred to as a primary pollutant.
Examples of primary pollutants are particulate matter, carbon monoxide (CO), nitrogen oxides (NOX), sulfur dioxide (SO2), and carbon dioxide (CO) (PM).
Pollutants can be divided into three categories from an ecological standpoint: degradable, slowly degradable, and non-degradable.
The term "primary pollutant" best describes acid rain, which is eventually brought on by sulfur dioxide emissions from power plants.
To learn more about Primary pollutants refer: brainly.com/question/12428306
#SPJ9
Compost is made by filling a pit with dry leaves and other vegetable wastes. This is covered up with soil and kept
damp. It is frequently mixed to speed up the process. Which of the following processes occurring in nature is the MOST similar to composting, and enhances the fertility of the soil?
The process of composting, where organic matter is broken down to create nutrient-rich soil, is most similar to the A. breakdown of dead material in the forest floor.
In forests, the forest floor accumulates dead leaves, branches, and other organic materials. These materials undergo a process called litter decomposition, where microorganisms such as bacteria and fungi break them down into simpler compounds. This decomposition releases nutrients back into the soil, enriching it and enhancing its fertility. This natural process is similar to composting because it involves the breakdown of organic matter and the creation of nutrient-rich soil.
Composting mimics this natural process by providing an optimized environment for the decomposition of organic matter. By filling a pit with dry leaves and vegetable wastes, covering it with soil, and maintaining proper moisture and aeration, composting accelerates the breakdown of organic materials. The frequent mixing or turning of the compost pile helps speed up the process by providing oxygen and distributing the decomposers more evenly.
Both composting and the breakdown of dead material in the forest floor involve the activity of microorganisms that break down organic matter, releasing nutrients and enhancing the fertility of the soil. They are essential processes for nutrient recycling in nature and contribute to sustainable agriculture and gardening practices. Therefore, Option A is correct.
The question is incomplete. find the full content below:
Compost is made by filling a pit with dry leaves and other vegetable wastes. This is covered up with soil and kept damp. It is frequently mixed to speed up the process. Which of the following processes occurring in nature is the MOST similar to composting, and enhances the fertility of the soil?
A. breakdown of dead material in the forest floor
B. formation of petroleum reserves under the ground
C. incorporation of nitrogen compounds in soil by lightning
D. absorption of soil nutrients by the root hairs of trees
Know more about decomposition here:
https://brainly.com/question/14608831
#SPJ8
40 points HELP!! I will mark brainliest and give 5 stars! :) Click the attached link to see the work I need to be done
Answer:
can't open the pdf
Explanation:
try resending it again
Answer:
Hola , soy Dora , can you download another one , It wont work , Glacias !!!
Explanation:
________ is/are one of the main causes of evolution.
Mutations
Darwin
Niches
An acquired trait
Answer:
mutations
hope this helps
Which statement is true for some photosynthesizing animals?
A.
Some carry out photosynthesis through the chloroplasts they incorporate into their cells.
B.
They conduct light-dependent reactions and the Calvin cycle in the mitochondria.
C.
They’re true autotrophs because they can photosynthesize on their own.
D.
They’re single-celled organisms that move like animals, but they contain chloroplasts.
Answer:
EDMENTUM
Explanation:
A snake catches and eats a small field mouse. Later that day, a hawk catches the snake and eats it. Which three terms describe the snake? consumer, predator, prey parasite, predator, producer predator, producer, consumer prey, parasite, producer
Answer:
Consumer, predator, and prey.
Explanation:
The snake is a consumer and a predator because it eats or consumes another organism (the mouse), but it is also prey because it is consumed or preyed upon by another predator (the hawk).
The three terms that best describe the snake are consumer, predator, and prey. Thus, the correct option for this question is A.
What is Predator?A predator may be characterized as a type of animal that significantly obtains food by killing and consuming other organisms in the form of food and taking energy for the metabolic processes. These animals hunt and kill other organisms for food. The organisms that are consumed by the predators are known as the prey.
According to the context of this question, when a snake eats a mouse, it is called a consumer and predator because it actually drives energy from the mouse in order to facilitate its metabolic processes. When a hawk when catches a snake and eats it, it is often known as prey, and the hawk is known as a predator in this case.
Therefore, the three terms that best describe the snake are consumer, predator, and prey. Thus, the correct option for this question is A.
To learn more about Predator and prey, refer to the link:
https://brainly.com/question/24537210
#SPJ2
a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
A pairs with T
G pairs with C
vise versa
Create a speech bubble in #18 and #19 to represent what is occurring. Be creative! Each speech bubble must include the correct use of at least 3 different bolded words found in the questions from the previous page. You pick which bolded words to use, but please underline them in your speech bubbles
Speech Bubble #18: "Wow, this is such an exciting opportunity to showcase our company's cutting-edge technology!" said the enthusiastic CEO.
"We have put in countless hours of hard work to ensure that our innovative products will impress the investors and set us apart from the competition."
Speech Bubble #19:
"I couldn't agree more," replied the Chief Marketing Officer. "Our team has done an amazing job at promoting our brand and creating a buzz in the industry. We're finally ready to take the next step and expand our reach to a global audience."
The CMO continued, "By leveraging our unique capabilities and demonstrating our commitment to sustainability, we'll demonstrate the value of our company and secure a successful future."
To learn more about Speech Bubble
https://brainly.com/question/29792539
#SPJ4
which would be a property of lipids found in the cell membrane?a.they would be saponifiable in base and hydrolyzed in acid.b.they would be composed of five-carbon units.c.they would have polar heads and non-polar tails.d.they would be joined to each other through covalent bonds.
Property of lipids found in the cell membrane c.) they would have polar heads and non-polar tails.
The heads forming the outer and inner linings are hydrophilic that means water loving. And the tails that face the interior of the cell membrane are hydrophobic that means water fearing. The most abundant membrane lipids are the phospholipids having a polar head group and two hydrophobic hydrocarbon tails.
Phospholipids, cholesterol, and glycolipids are three types of membrane lipid molecules. The lipid compositions on the inner and outer layers are different depending on the different functions of the two faces of a cell membrane.
Lipids works as an essential structural component of membranes, as a signaling molecules, chemical identifiers of specific membranes and as energy storage molecules.
To know more about lipids, refer
https://brainly.com/question/17352723
#SPJ4
"As a healthier alternative to French fries, some fast food outlets offer pre-sliced, bagged apples as a side option. The ingredients list often reads, "Apples and Ascorbic Acid." Ascorbic acid is another name for vitamin C. What role does the ascorbic acid play in the product?"
Answer:
Answer in explanation
Explanation:
Absorbic Acid is used as an antioxidant and it helps the product stay fresh and look good in color. It will also add a citrus flavor and it prevents microbial growth which will not let it spoil easily
The body needs it to aid in wound healing, improve iron absorption from plant-based meals, and boost the immune system. It functions as an antioxidant to shield your cells from free radicals, which may contribute to cancer, heart disease, and other illnesses.
What role does the ascorbic acid play in the product?Fruit development and postharvest storage are significantly regulated by ascorbic acid, which also impacts fruit ripening and stress tolerance. It has been extensively investigated how plants use ascorbic acid in their metabolism.
Some people may experience negative side effects from vitamin C, including headaches, nausea, heartburn, and stomach cramps. With bigger doses comes a greater likelihood of experiencing these adverse effects.
Therefore, utilized as an antioxidant, absorbic acid keeps products fresh and attractively colored. Additionally, it will give it a citrus flavor and stop microbial growth, which will keep it from spoiling quickly.
Learn more about ascorbic acid here:
https://brainly.com/question/23844517
#SPJ2
after collecting empirical evidence from peer-reviewed scientific sources, it has been determined that the current plan to manage the alaska crab fish
The current plan to manage the Alaska crab fishery has been evaluated based on empirical evidence from peer-reviewed scientific sources.
After conducting a thorough evaluation of the current plan to manage the Alaska crab fishery, empirical evidence from peer-reviewed scientific sources has been collected and analyzed. This evidence includes studies and research conducted by experts in the field, which provide insights into the effectiveness and sustainability of the management plan. By relying on peer-reviewed scientific sources, the evaluation aims to ensure that the assessment is based on rigorous and reliable scientific information. This approach helps to inform decision-making and potential improvements in the management strategies for the Alaska crab fishery, taking into account ecological, economic, and social factors.
Learn more about Alaska crab here:
https://brainly.com/question/31676185
#SPJ11
Define Phenotype and Genotype in simple term
Answer:
phenotyp : is the outward appearance of the organis
genotype: is the genetic make up of organism
What is the opportunity cost of increasing toilet paper production from 11 to 15? Opportunity Cost =