B. 6. The diagram below shows a student's experiment with elodea, a common aquatic plant. What change in the experiment is most likely to increase the volume of accumulation of oxygen gas at the top of the tube? A. Use fewer plants. B. Replace the beaker with a larger container. C. Move the light source closer to the beaker. D. Reduce the amount of water. Light from lamp (1.5 metres) Oxygen gas Oxygen bubbles Water and sodium bicarbonate Plants​

Answers

Answer 1

Move the light source closer to the beaker.

Moving the light source will increase light intensity for the plant and this will increase the rate of photosynthesis assuming there are no other limiting factors (eg, carbon dioxide).Increased rate of photosynthesis will produce more oxygen/


Related Questions

all of the following are polysaccharides except group of answer choices cellulose in certain cell walls. agar used to make solid culture media. glycogen in liver and muscle. prostaglandins in inflammation. a cell's glycocalyx.

Answers

Cellulose in certain cell walls Prostaglandins in inflammation. The correct option is Prostaglandins .

Here's a brief explanation of the other options:

1. Cellulose in certain cell walls: Cellulose is a polysaccharide that is a major component of plant cell walls. It is composed of glucose monomers and provides structural support to plants.

2. Agar used to make solid culture media: Agar is a polysaccharide derived from red algae. It is used as a solidifying agent in microbiological culture media due to its gel-like properties.

3. Glycogen in liver and muscle: Glycogen is a polysaccharide that serves as an energy storage molecule in animals. It is primarily found in the liver and muscles and is composed of glucose monomers.

4. A cell's glycocalyx: The glycocalyx is a carbohydrate-rich layer on the cell surface, consisting of glycoproteins and glycolipids. It may contain polysaccharides, which can be involved in various cellular functions, such as cell adhesion and communication.

In contrast, prostaglandins are not polysaccharides. They are a group of lipid compounds derived from fatty acids, and they play essential roles in inflammation and other physiological processes.

To know more about cellulose  visit:

https://brainly.com/question/13111289

#SPJ11

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

Which of the following lacks a cell wall?
A) Clostridium
B) Mycobacterium
C) Nocardia
D) Borrelia
E) Mycoplasma

Answers

The organism that lacks a cell wall is:

E) Mycoplasma.

Among the given options, Mycoplasma is the only organism that lacks a cell wall. Mycoplasma is a genus of bacteria that belongs to the class Mollicutes. Unlike other bacteria, Mycoplasma does not possess a rigid cell wall made of peptidoglycan. Instead, it has a flexible cell membrane that surrounds its cytoplasm.

The rest of the options (A) Clostridium, (B) Mycobacterium, (C) Nocardia, and (D) Borrelia, are all bacterial genera that have cell walls. These cell walls are typically composed of peptidoglycan, a complex molecule that provides structural support and protection to bacterial cells.

It is important to note that the absence of a cell wall in Mycoplasma allows for its unique characteristics, such as its ability to adopt varied shapes and its resistance to certain antibiotics that target cell wall synthesis.

Learn more about Mycoplasma from the given link:

https://brainly.com/question/18070439

#SPJ11.

which type of tissue covers the body surface and lines organs and cavities?

Answers

Answer:

The type of tissue that covers the body surface, lines organs and cavities is called epithelial tissue or epithelium. It forms the covering on all internal and external surfaces of your body, lines body cavities and hollow organs, and is the major tissue in glands.

Using what you know about the of the structures of side chains and the mechanisms presented in chapter, choose an amino acid side chain to play the following roles in an enzymatic mechanism: (a) participate in proton transfer, (b) act as a nucleophile.

Answers

Amino acid side chain that participates in proton transfer and acts as a nucleophile. Amino acid side chains are the part of an amino acid that extends from the alpha carbon and contributes to the protein's function.

The side chain of an amino acid can vary from just a single hydrogen atom to a complex ring structure. They are involved in catalytic activity, binding interactions, and structural stability of proteins.

(a) Participate in proton transfer: Histidine is the amino acid side chain that participates in proton transfer in an enzymatic mechanism. It is a basic amino acid that has a pKa of 6.0, which is near physiological pH. It has an imidazole side chain that can act as both an acid and a base. Histidine side chains can be protonated or unprotonated, which makes them ideal for facilitating proton transfer in enzymatic reactions.

(b) Act as a nucleophile: Serine is the amino acid side chain that acts as a nucleophile in an enzymatic mechanism. It has a hydroxyl group (-OH) on its side chain, which is highly reactive and can act as a nucleophile. This makes serine ideal for catalyzing reactions that involve nucleophilic substitution or hydrolysis. The hydroxyl group of the serine side chain can form covalent bonds with other molecules, which can then be further modified to produce the desired product.

To know more about Amino acid side chain

brainly.com/question/31239077

#SPJ11


why nitrogen needs to be cycled around
the environment?

Answers

Answer:

nitrogen is an essential nutrient for sustaining life on earth, without it, plants would die, then herbivores due to starvation, and so on

Explanation:

Please can someone help me out thank you sm if you can!!!

Please can someone help me out thank you sm if you can!!!

Answers

Answer:

A, B and C

Explanation:

The net equation for photosynthesis is. . .

carbon dioxide + water --> sugar + oxygen

Therefore, carbon dioxide is used and oxygen is produced/released.

The overall reaction for cellular respiration is. . .

oxygen + sugar --> carbon dioxide + water

Therefore, oxygen is used and carbon dioxide is produced/released.

Certain types of windows used in colder climates consist of two panes of glass separated by a gap of air. What is the advantage of this design?​

Answers

The air gap is filled with gas which increases the insulation between the glass pieces. Double glazed windows are highly efficient, reducing your heat loss or gain by up to 30% when compared to single-glazed windows.

Question 3 (True/False Worth 2 points)
(01.07 LC)
After acid mine drainage, the acidity of waterways is more suitable for aquatic plants,
O True
False

Answers

Answer: It's False

Explanation: I took the exam

After acid mine drainage, the acidity of waterways is more suitable for aquatic plants. The given statement is false.

What are plants?

Plants are the eukaryotes means they are multicellular organisms and they belong to the kingdom Plantae. So, the scientific name of plants are Plantae and its domain of plant is Eukaryota.

The plants are of many types such as shrubs, herbs, mosses, ferns, trees and they grow on a particular place by sucking inorganic substances and water from the soil with the help of roots.

Plant are also known as autotrophs as they prepares there own food in the presence of sunlight. Due to chlorophyll present in them the plants shows green colour. Plants are also known as producers because they produce food to feed others.

Therefore, after acid mine drainage, the acidity of waterways is more suitable for aquatic plants. The given statement is false.

Learn more about plants here:

https://brainly.com/question/22167412

#SPJ2

metabolic pathways that make available raw materials from which other molecules can be synthesized and that provide chemical energy required for many cell activities are known as .

Answers

Metabolic pathways that make available raw materials from which other molecules can be synthesized and that provide chemical energy required for many cell activities are known as Catabolism.

Catabolism may be defined as the process by which the energy gained by the individual is synthesized within the body of the individual. An individual eats food which provides energy to the body. The vitamins, proteins and minerals present in the food items are broken down into simpler molecules as they are in the form of complex molecules. This breaking involves the release of energy. This energy is released in the form of small energy packets known as Adenosine triphosphate or ATP. Proteins are broken down into Amino acids, Polysaccharides into Monosaccharides, Nucleic acids into nucleotides and then nucleosides and fatty acids into lipids.

Learn more about Catabolism at:

brainly.com/question/21285899

#SPJ4

To yield haploid cells, in meiosis II what separates?
a) Parent and daughter DNA
b) Male and female chromosomes
c) Homologous chromosomes
d) Sister chromatids

Answers

Answer:

answer is D) sister chromatids

To yield haploid cells, in meiosis II separates sister chromatids. The correct option is d.

What are sister chromatids?

A sister chromatid is a pair of exact replicas (chromatids) formed by chromosome DNA replication, with both copies joined together by a common centromere.

While meiosis, the sister chromatids separates to yield daughter cells with half of the chromosomes.

Thus, the correct option is d.

For more details regarding chromosomes, visit:

https://brainly.com/question/8240726

#SPJ2

The term used to describe a location with many different cultural groups is
A. culturally diverse
B. globalization
C. multiple perspectives
D. ethnicity

Answers

A
It’s the only answer that even makes sense if you really think about it.

Gluconeogenesis is essentially ___ providing a way of counteracting low levels of ____ There are 10 enzyme catalyzed steps in glycolysis and gluconeogenesis employs ____. _____ is a key enzyme in gluconeogenesis, serving to take pyruvate to ____.

Answers

Gluconeogenesis is essentially the reverse pathway of glycolysis providing a way of counteracting low levels of glucose. There are 10 enzyme catalyzed steps in glycolysis and gluconeogenesis employs 7 of the same enzymes in the reverse direction. Fructose-1,6-bisphosphatase is a key enzyme in gluconeogenesis, serving to take pyruvate to oxaloacetate.

Gluconeogenesis is the process of synthesizing glucose from non-carbohydrate precursors such as lactate, amino acids, and glycerol. It is essentially the reverse of the glycolysis pathway, but with three unique and irreversible reactions catalyzed by four enzymes. This pathway is vital in maintaining adequate glucose levels during fasting or prolonged exercise, when glucose is not readily available from the diet.

The process involves seven of the same enzymes as glycolysis, but these enzymes function in a different direction. The key regulatory enzyme in gluconeogenesis is fructose-1,6-bisphosphatase, which is responsible for converting fructose-1,6-bisphosphate to fructose-6-phosphate. This enzyme helps to prevent the futile cycling between glycolysis and gluconeogenesis.

To learn more about gluconeogenesis, here

https://brainly.com/question/14141937

#SPJ4

Gluconeogenesis is essentially the reverse pathway of glycolysis providing a way of counteracting low levels of glucose. There are 10 enzyme catalyzed steps in glycolysis and gluconeogenesis employs 7 of the same enzymes in the reverse direction. Fructose-1,6-bisphosphatase is a key enzyme in gluconeogenesis, serving to take pyruvate to oxaloacetate.

Gluconeogenesis is the process of synthesizing glucose from non-carbohydrate precursors such as lactate, amino acids, and glycerol. It is essentially the reverse of the glycolysis pathway, but with three unique and irreversible reactions catalyzed by four enzymes. This pathway is vital in maintaining adequate glucose levels during fasting or prolonged exercise, when glucose is not readily available from the diet.

The process involves seven of the same enzymes as glycolysis, but these enzymes function in a different direction. The key regulatory enzyme in gluconeogenesis is fructose-1,6-bisphosphatase, which is responsible for converting fructose-1,6-bisphosphate to fructose-6-phosphate. This enzyme helps to prevent the futile cycling between glycolysis and gluconeogenesis.

To learn more about gluconeogenesis, here

https://brainly.com/question/14141937

#SPJ4

what is the name of the joint at the anterior junction of the pubic bones

Answers

The name of the joint at the anterior junction of the pubic bones is the pubic symphysis.

The pubic symphysis is a secondary cartilaginous joint that connects the two pubic bones, which are part of the pelvic girdle. This joint allows for limited movement and is responsible for providing stability and support to the pelvic region.

The pubic symphysis is composed of fibrocartilage, which is a type of cartilage that provides a strong and flexible connection between bones. This fibrocartilage acts as a cushion and helps absorb shock during activities like walking, running, or jumping.

In women, the pubic symphysis plays a crucial role during childbirth. It can expand and widen slightly to allow for the passage of the baby through the birth canal. This widening is facilitated by the hormone relaxin, which is produced during pregnancy and causes the ligaments in the pelvic region to become more flexible.

In summary, the pubic symphysis is the joint at the anterior junction of the pubic bones. It is composed of fibrocartilage, which provides stability and support to the pelvic region. The pubic symphysis allows for limited movement and plays a critical role in the process of childbirth in women.

Learn more about pubic bones:

https://brainly.com/question/29451489

#SPJ11

aging can sometimes lead to an increase in the stiffness at the base of the basilar membrane. what affect would this have on a person's hearing?

Answers

The basilar membrane is a crucial part of the inner ear that helps with hearing. It contains hair cells that are responsible for converting sound vibrations into electrical signals that are then sent to the brain. As a person ages, the basilar membrane can become stiffer at its base, which can affect hearing in several ways.

Firstly, the stiffness can affect the ability of the hair cells to move in response to sound vibrations. This can lead to a reduction in the overall sensitivity of the ear, meaning that sounds may need to be louder in order to be detected. Additionally, the stiffness can affect the tuning properties of the basilar membrane, meaning that certain frequencies may be harder to hear than others.

Overall, an increase in the stiffness at the base of the basilar membrane can have a significant impact on a person's hearing ability, particularly in older age when hearing loss is already a common issue. It is important to monitor hearing regularly and seek treatment if any changes are noticed.

To know more about basilar membrane visit:

https://brainly.com/question/15405789

#SPJ11

If big molecules can’t get absorbed by the small intestine, why aren’t there other big molecules (like complex carbohydrates) in the poop of healthy people?

Answers


In healthy people, complex carbohydrates such as starches are broken down into simpler molecules before being absorbed by the small intestine. This process involves enzymes, like amylase, which break down the complex carbohydrates into smaller units, such as glucose.



Additionally, the large intestine (colon) plays a crucial role in the digestion and absorption of certain nutrients, including fiber. Fiber is a type of complex carbohydrate that cannot be digested by human enzymes, but can be broken down by bacteria in the large intestine. This process produces short-chain fatty acids, which can be absorbed by the body and used for energy.


Therefore, even though complex carbohydrates cannot be directly absorbed by the small intestine, they can still be broken down and utilized by the body. As a result, it is not uncommon for healthy individuals to have little to no undigested complex carbohydrates in their stool. However, if there is an issue with gut health or digestion, such as bacterial overgrowth or malabsorption disorders, it is possible to see undigested complex carbohydrates in the stool.

To know more about carbohydrates visit :-

https://brainly.com/question/29775112

#SPJ11

Phosphofructokinase is an allosteric enzyme that catalyzes an early step of glycolysis. In the presence of oxygen, an increase in the amount ATP in a cell would be expected to

Answers

Phosphofructokinase is an allosteric enzyme that catalyzes an early step of glycolysis. In the presence of oxygen, an increase in the amount ATP in a cell would be expected to inhibit the enzyme and slow the rates of glycolysis and the citric acid cycle. The correct answer to the given question is option a.

Phosphofructokinase is an allosteric enzyme that catalyzes an early step of glycolysis. It is responsible for the conversion of fructose-6-phosphate to fructose-1,6-bisphosphate. The rate of the enzyme is affected by various factors like the concentration of ATP, ADP, and AMP.

In the presence of oxygen, an increase in the amount of ATP in a cell would be expected to inhibit the enzyme and slow the rates of glycolysis and the citric acid cycle. This happens because, during cellular respiration, the ATP is synthesized by the metabolic pathways of glycolysis and the citric acid cycle. When there is an abundance of ATP in the cell, it acts as an inhibitor of the enzyme phosphofructokinase. This slows down the metabolic pathways of glycolysis and the citric acid cycle.

Therefore, correct option is a. inhibit the enzyme and slow the rates of glycolysis and the citric acid cycle.

To know more about Phosphofructokinase refer here :

https://brainly.com/question/14331342

#SPJ11

Phosphofructokinase is an allosteric enzyme that catalyzes an early step of glycolysis. In the presence of oxygen, an increase in the amount ATP in a cell would be expected to

a . inhibit the enzyme and slow the rates of glycolysis and the citric acid cycle.

b activate the enzyme and slow the rates of glycolysis and the citric acid cycle.

c. inhibit the enzyme and thus increase the rates of glycolysis and the citric acid cycle.

d. activate the enzyme and increase the rates of glycolysis and the citric acid cycle.

e. ATP would have no effect on the rates of glycolysis and the citric acid cycle.

Please help! which statement best distinguishes between the function of genes and alleles? responses genes provide variation in traits, while alleles express traits.

A genes provide variation in traits, while alleles express traits.

B. alleles are responsible for variation in traits, while genes are responsible for the expression of traits.

C. alleles provide duplicate copies in case of mutation, while genes express all mutations

D. alleles provide duplicate copies in case of mutation, while genes express all mutations.

Answers

The statement (A) is correct. Genes provide variation in traits, while alleles express traits.

What are alleles?

An allele is a variation of the same sequence of nucleotides at the same place on a long DNA molecule, as described in leading textbooks on genetics and evolution. "The chromosomal or genomic location of a gene or any other genetic element is called a locus and alternative DNA sequences at a locus are called alleles."

Moreover, an allele is one of two or more versions of DNA sequence (a single base or a segment of bases) at a given genomic location. An individual inherits two alleles, one from each parent, for any given genomic location where such variation exists.

Therefore, if the two alleles are the same, the individual is homozygous for that allele. The different versions of the genes are known as alleles. One is inherited from the father, and one from the mother.

Learn more about alleles:

https://brainly.com/question/7602134

#SPJ1

Answer:

The statement (A) is correct. Genes provide variation in traits, while alleles express traits.

True or False

Osmosis is the movement of water into and out of a cell.

Answers

Answer:

True

Explanation:

True

Osmosis is a special kind of diffusion that only involves water moving through a selectively permeable membrane.

What is the difference between the atp used for energy and the atp used as building blocks for dna

Answers

ATP can only hold the base adenine for its nitrogenous base, whereas a DNA nucleotide can have four distinct bases. The "triphosphate" in ATP tells that ATP still has three phosphate groups, whereas DNA only has one.

It's a piece of the equivalent nucleic corrosive gathering, all living things use ATP here and there or another, and it's made of comparative structure blocks tracked down in DNA and RNA — ATP is a structure block for RNA — however its motivation serves different capabilities outside the core.

Carbon, nitrogen, hydrogen, oxygen, and phosphorus are the ATP building blocks. ATP is readily hydrolyzed in reactions to release a significant amount of energy due to the presence of unstable, high-energy bonds.

To learn more about DNA nucleotides here

https://brainly.com/question/30299889

#SPJ4

How does your trc compare to the average for the class? the average for your sex? is there a difference between male and female trcs? what might account for the difference?

Answers

The trc score represents the rate at which tobacco retailers comply with laws and regulations related to the sale of tobacco products to minors. The average trc score for a class or group of people would depend on the specific group being evaluated and the area in which they reside.

Regarding the difference between male and female trcs, it is possible that there could be a difference if males and females are treated differently by tobacco retailers or if they have different rates of attempted tobacco purchases. However, it is important to note that trc scores are not related to individual biology or gender identity, but rather to compliance with laws and regulations related to tobacco sales.

Overall, it is important to prioritize tobacco control efforts and ensure that retailers are held accountable for selling tobacco products to minors, regardless of any potential differences between demographic groups.

To know more about female.  here

https://brainly.com/question/921862

#SPJ4

Which would be a good source to find weather information about your town from last month?


A old copies of local newspapers


B reference book about weather


C a magazine with weather articles

Answers

(option B) reference book about weather would be a good source to find weather information about your town from last month.

what is weather?

Weather refers to the state of the atmosphere and includes terms like how hot or cold, wet or dry, quiet or stormy, clear or foggy, etc.

what is information?

Information is a general term for everything with the capacity to inform. Information is most fundamentally concerned with the interpretation of what may be sensed. which can also be the condition of the atmosphere, including its temperature, pressure, wind, humidity, precipitation, and cloud cover, is referred to as the weather. It is distinct from climate, which is the average of all weather events for a certain place over around 30 years.

learn more about weather here

brainly.com/question/17922964

#SPJ1

Create the mRNA strand and the amino acid chain that would be produced during protein synthesis.



AAA-GCT-CCA-TCG-GCT-AGG (DNA)


Answers

To determine the mRNA strand and the resulting amino acid chain during protein synthesis, we need to transcribe the given DNA sequence into mRNA and then translate it into amino acids using the genetic code. These are fundamental steps that both occur during synthesis of protein.

Given the DNA sequence: AAA-GCT-CCA-TCG-GCT-AGG

1. Transcription:

During transcription, DNA is converted into mRNA. We create the complementary mRNA sequence by replacing each DNA base with its corresponding RNA base:

AAA-GCT-CCA-TCG-GCT-AGG (DNA)

UUU-CGA-GGU-AGC-CGA-UCC (mRNA)

2. Translation:

During translation, mRNA is decoded to produce an amino acid chain based on the genetic code. Each set of three mRNA bases, called a codon, corresponds to a specific amino acid. Here's how the mRNA sequence is translated into amino acids using the genetic code:

UUU | CGA | GGU | AGC | CGA | UCC (mRNA)

Phenylalanine-Arginine-Glycine-Serine-Arginine-Serine (we must look at a codon table to interpret what amino acids are corresponding)

Answer:

Therefore, the mRNA strand produced from the given DNA sequence is UUU-CGA-GGU-AGC-CGA-UCC, and the resulting amino acid chain during protein synthesis is Phenylalanine-Arginine-Glycine-Serine-Arginine-Serine.

IF SOMETHING IN THE ECOCOLUMN DIED IT WAS CONSUMED
BY?

Answers

If something in the ecocolumn died, it was likely consumed by decomposers.

Decomposers are organisms, such as bacteria, fungi, and detritivores, that break down dead organic material and recycle nutrients back into the ecosystem.

They play a crucial role in the decomposition process, breaking down organic matter into simpler compounds that can be used by other organisms.

Detritivores are larger organisms, such as earthworms, millipedes, and some insects, that feed on dead organic material. They physically break down the dead organism into smaller pieces, increasing the surface area available for decomposition by bacteria and fungi.

By feeding on the dead material, decomposers help to break it down and release nutrients, allowing them to be cycled back into the ecosystem and utilized by other living organisms.

for similar questions on decomposers.

https://brainly.com/question/16552495

#SPJ8

What is a good question to ask yourself when choosing a career path? ( A. What subjects do I like? ( B. What skills do I need to improve? O C. What do my friends want to do? O D. What do my parents want me to do?

Answers

Answer:

A

Explanation:

It doesn't really matter what your family and friends for you will the one doing the job,so by figuring the subjects you like it will set your path

1)list two functions of respiratory system
a) function 1:
b) function 2:​

Answers

1.) delivers oxygen to cells
2.) removes waste gasses when you exhale (like carbon dioxide)

What is a term that describes and organism that CAN make its own food?

Answers

Answer: An Autotroph

Explanation: Organisms that can produce their own food using light, water, carbon dioxide, or other chemicals are called Autotrophs.

Answer:

Autotrophs

Explanation:

An autotroph makes its own food using light, water, carbon dioxide, and other chemicals.

1.1.7.
What is the difference between eukaryotic and prokaryotic cells?
A. Eukaryotic cells are found in bacteria and prokaryotic cells are not.
B. Prokaryotic cells are found in plants and animals and eukaryotic cells
are not.
C. Eukaryotic cells contain organelles and DNA enclosed within a nucleus
and prokaryotic cells do not.
D. Prokaryotic cells contain no organelles except DNA enclosed within a
nucleus and eukaryotic cells do not.

Answers

Answer:

I think it's D, because prokaryotes have no organelles, yet their DNA can be enclosed in a small nucleus (nucleolus).

a woman is type a blood and she has a child with type o blood. what blood type(s) does the father have? draw as many punnett squares as necessary to answer this question

Answers

Answer:

c

Explanation:

What happens inside the heart to cause a heart attack?.

Answers

Answer: Blocked artery

Explanation:

An artery supplying your heart with blood and oxygen becomes blocked. Fatty deposits build up over time, forming plaques in your heart's arteries. If a plaque ruptures, a blood clot can form and block your arteries, causing a heart attack.

A heart attack occurs when an artery supplying your heart with blood and oxygen becomes blocked. Fatty deposits build up over time, forming plaques in your heart's arteries. If a plaque ruptures, a blood clot can form and block your arteries, causing a heart attack.
Other Questions
no additional partnership items exist for year 2. what is the total amount from the partnership that will be included in the partner's adjusted gross income on the partner's form 1040 for year 2? Find the length of a square with a perimeter of 80 yards suppose you need $10,000 in one year for the down payment on a new car. if you can earn 7% annually, how much do you need to invest today? a. The sum of three consecutive even numbers is 48. Find the three numbers Please help I need P factored completely P(x)=x^4+50x^2+625 FILL THE BLANK. _____ is a commonly used variety of fiber cable which provides connectivity over moderate distances, such as those in most data center environments, or among rooms within a single building. Rosa watched a moth close its wings and drop to the ground to try to escape a bat that wanted to eat it which of these is similar method of defense Why do China and Taiwan disagree today? What happened in the past for them to disagree? a perfect score in bowling is 300 points. you get a perfect score if you knock down 120 pins in 10 frames. what are the decimal value and percent of the number of pins knocked down in a relation to a perfect score? 4) Boeing 787- Dreamliner operates with two Trent 1000 jet engines that work on an ideal cycle. At 1.8km, ambient air flowing at 55 m/s will enter the 1.25m radius inlet of the jet engine. The pressure ratio is 44:1 and hot gasses leave the combustor at 1800K. Calculate :a) The mass flow rate of the air entering the jet engineb) Ts, vs and Ps in all processesc) Qin and Qout of the jet engine in MWd) Power of the turbine and compressor in MWe) TH of the jet engine in percentage are the concerns that washington had about the nation's foreign affairs still applicable today when a foreign currency is strong against the dollar, fewer units of the foreign currency are required to purchase one u.s. dollar. (True or False) For a 1.0106 m solution of hno3(aq) at 25 c, arrange the species by their relative molar amounts in solution. 0.3 is 10 times as great as what decimal? 0.003 is 1 half of what decimal? dolphin inc's preferred stock is currently priced at $40.00/share and just paid quarterly dividends of $0.50/share. what is the cost of dolphin's preferred stock? *When a computer programmer is finished writing or developing a program, what has to happen first before the computer can understand and utilize the code? A.a service pack needs to be applied to the newly created program B.the object code has to be translated into source code C.the source code has to be translated into object codeD.a device driver for the program has to be installed E.the programmer needs to obtain a software license lonization energy is themeasurement of the energy neededto take away an electron from anatom. Explain how you thinkionization energy would change inthe periodic table and draw anarrow on the table below. If an airplane with a mass of 4,536 kg has gravitational potential energy of 1000 kilojoules, what is its height? please help plsssssssssssssss A particular interaction force does work Wint inside a system. The potential energy of the interaction is U. Which equation relates U and Wint?U=-Wint