At an annual teacher’s conference everyone is served tea with their dinner. Let H be the event that a randomly selected participant puts honey in their tea. Let S be the event that a randomly selected participant puts sugar in their tea. Suppose that afteryears of collecting data, the staff of this conference have estimated the following probabilities.P(H) = 0.14 P(S) = 0.65 P(H or S) = 0.73Estimate P(H and S) and interpret this value in the context of the problem.A.P(H and S) = 0.06, The probability that a randomly selected participant puts sugar and honey in their tea is 0.06.B.P(H and S) = 0.06, The probability that a randomly selected participant puts sugar or honey in their tea is 0.06.C.P(H and S) = 0.79, The probability that a randomly selected participant puts sugar and honey in their tea is 0.79.D.P(H and S) = 0.79, The probability that a randomly selected participant puts sugar or honey in their tea is 0.79

Answers

Answer 1

Answer:

im looking for the same one :(

Step-by-step explanation:


Related Questions

help- Find the volume of a right rectangular prism with fractional edge lengths by packing it with unit cubes of the appropriate unit fraction:

help- Find the volume of a right rectangular prism with fractional edge lengths by packing it with unit

Answers

Answer:

2340.

Step-by-step explanation:

Using decimal equivalents of the fractions:

Volume of the Shipping box = 3.25 * 3*3,75 = 36.5625 f^3.

Volume of 1 box of fish food = (0.25)^3 = 0.015625

So the answer is 36.5625/ 0.015625

= 2340.

Use logarithmic differentiation to find the derivative of the function y=x^2x

Answers

The derivative of the function y = x^2x using logarithmic differentiation is dy/dx = x^2x(2 + 2ln(x)).

To find the derivative of the function y = x^2x using logarithmic differentiation, we follow these steps:

Take the natural logarithm of both sides of the equation:ln(y) = ln(x^2x)Apply the logarithmic property to simplify the equation:ln(y) = (2x)ln(x)Differentiate both sides of the equation implicitly:(1/y) * dy/dx = (2x)(1/x) + ln(x)(d/dx)(2x)Simplify the equation:(1/y) * dy/dx = 2 + 2ln(x)Multiply both sides of the equation by y:dy/dx = y(2 + 2ln(x))Substitute the original function back into the equation:dy/dx = x^2x(2 + 2ln(x))Learn more:

About logarithmic differentiation here:

https://brainly.com/question/32030515

#SPJ11

To find the derivative of the function y = x^(2x) using logarithmic differentiation, we take the natural logarithm of both sides, apply logarithmic properties, and then differentiate implicitly.

Start by taking the natural logarithm of both sides of the equation:

ln(y) = ln(x^(2x))

Apply the power rule of logarithms to simplify the expression:

ln(y) = 2x * ln(x)

Now, differentiate both sides of the equation implicitly with respect to x:

(1/y) * dy/dx = 2 * ln(x) + 2x * (1/x)

Simplify the expression:

(1/y) * dy/dx = 2 * ln(x) + 2

Multiply both sides by y to isolate dy/dx:

dy/dx = y * (2 * ln(x) + 2)

Substitute the original value of y = x^(2x) back into the equation:

dy/dx = x^(2x) * (2 * ln(x) + 2)

The derivative of the function y = x^(2x) using logarithmic differentiation is dy/dx = x^(2x) * (2 * ln(x) + 2). Logarithmic differentiation is a useful technique for differentiating functions that involve exponentials or complicated algebraic expressions, as it allows us to simplify the calculation by taking the logarithm of both sides and then differentiating implicitly.

To know more about function visit:

https://brainly.com/question/11624077

#SPJ11

What are the coordinates of the point on the directed line segment from (-6, -10)
to (6, 8) that partitions the segment into a ratio of 2 a to 1?

Answers

The coordinates of line segment are (2,2)

What is section formula?

The section formula is the method used to get the coordinates of a point on a line segment that divides it into two segments.Lets’s imagine that the line segment marked with the coordinates A (\(x_{1}\),\(y_{1}\)) and B has a point P(x,y) that splits it (\(x_{2}\),\(y_{2}\)). To find the coordinates, we use the section formula, which is described mathematically as.

P(x, y) =(\(\frac{m.x_{2}+n.x_{1} }{m+n}\),\(\frac{m.y_{2}.n.y_{1} }{m+n}\))

Given that : the point on the directed line segment from (-6,-10) to (6,8) that partitions the segment into a ratio of 2 to 1

Consider two points P(\(x_{1} ,y_{1}\)) and Q(\(x_{2},y_{2}\)).Finding the coordinates of the point R that divides PQ in the ratio m: n is necessary because \(\frac{PR}{RQ}\) = \(\frac{m}{n}\).

Here , p = (-6, -10)

Q= (6, 8)

m :n = (2,1)

x = \(\frac{m.x{2} +n.x_{1} }{m+n}\)

y = \(\frac{m.y_{2}+n.y_{1} }{m+n}\)

by putting value we get,

x= 2 , y= 2

To learn more about section formula visit:

brainly.com/question/26752464

#SPJ9

Find an equation of the plane with the given characteristics. The plane passes through the points (5, 3, 1) and (5. 1.-7) and is perpendicular to the plane 8x + 7y + 4z = 17.

Answers

An equation of the plane with the given characteristics is:

15x - 8y - 14z = 37.

We can use the cross product to find a vector that is perpendicular to both the plane we're given (8x+7y+4z=17) and the plane we're trying to find.

First, we find the direction vector of the line that passes through the two given points:

<5, 1, -7> - <5, 3, 1> = <0, -2, -8>

Now, let's find the normal vector of the plane we're given, which is the coefficients of x, y, and z in the equation 8x+7y+4z=17:

<8, 7, 4>

To find a vector perpendicular to both of these, we take the cross product:

<0, -2, -8> x <8, 7, 4> = <-60, 32, 56>

This vector is perpendicular to both lines, so it is a normal vector to the plane we're looking for.

Now, we need to find the constant term in the equation of the plane. We can use either of the two given points to do this. Let's use (5, 3, 1):

-60(x - 5) + 32(y - 3) + 56(z - 1) = 0

Simplifying, we get:

-60x + 300 + 32y - 96 + 56z - 56 = 0

-60x + 32y + 56z = -148

Dividing through by -4, we get:

15x - 8y - 14z = 37

To learn more about Equation :

https://brainly.com/question/17145398

#SPJ11

In the Northwest Bank waiting line system, assume that the service times for drive-up teller follow an exponential probability distribution with a mean of 100 customers per hour. Use the exponential probability distribution to answer the following questions:
a. What is the probability that the service time is one minute or less?
b. What is the probability that the service time is two minutes or less?
c. What is the probability that the service time is more than two minutes?
d. What is the probability that the service time is between three and seven minutes?

Answers

Calculating this expression, we find that the probability of the service time being one minute or less is approximately 0.6321.

Calculating this expression, we find the probability of the service time being between three and seven minutes is approximately 0.1849.

To answer the questions, we will use the exponential probability distribution formula:

f(x) = λ * e^(-λx)

Where λ is the rate parameter (mean service rate) and x is the service time.

a. To find the probability that the service time is one minute or less, we substitute x = 1 and λ = 100/60 (since there are 60 minutes in an hour and the mean service rate is given per hour):

P(X ≤ 1) = λ * e^(-λx)

P(X ≤ 1) = (100/60) * e^(-(100/60) * 1)

b. To find the probability that the service time is two minutes or less, we substitute x = 2 and λ = 100/60:

P(X ≤ 2) = λ * e^(-λx)

P(X ≤ 2) = (100/60) * e^(-(100/60) * 2)

Calculating this expression, we find that the probability of the service time being two minutes or less is approximately 0.8647.

c. To find the probability that the service time is more than two minutes, we subtract the probability of the service time being two minutes or less from 1:

P(X > 2) = 1 - P(X ≤ 2)

Calculating this expression, we find that the probability of the service time being more than two minutes is approximately 0.1353.

d. To find the probability that the service time is between three and seven minutes, we subtract the probability of the service time being less than three minutes from the probability of the service time being less than seven minutes:

P(3 ≤ X ≤ 7) = P(X ≤ 7) - P(X < 3)

P(3 ≤ X ≤ 7) = (100/60) * e^(-(100/60) * 7) - (100/60) * e^(-(100/60) * 3)

Know more about probability here:

https://brainly.com/question/32004014

#SPJ11

On a recent test, Jan answered 34 out of 40 questions correctly. What was Jans percentage of correct questions on the test? Round your answer to the tenths place if necessary.

Answers

ANSWER:

85%

STEP-BY-STEP EXPLANATION:

In this case, to calculate the percentage of correct questions, we must calculate the quotient of the questions answered correctly and the total, and then multiply by 100, just like this:

\(\frac{34}{40}\cdot100=85\text{\%}\)

Can anyone solve this please, tommorow is my exam ​

Can anyone solve this please, tommorow is my exam

Answers

Answer:

x=172°

Step-by-step explanation:

5x-11=3x-5

2x-11=5

2x=16

x=8

180-8=172

How do you solve 10 - x = 25?

Answers

Answer:

Work the problem backward

Step-by-step explanation:

instead of 10-x=25 do 25-10 = x So yeah that should give you the variable X

Answer:

-15

Step-by-step explanation:

10-x=25

take away 10 from both sides of the equation.

-x = 15

divide by - (-1) to get x

x = -15

Can someone please help with these two questions . Thank you

Can someone please help with these two questions . Thank you

Answers

Answer:

D for the first question

A for the second one

Step-by-step explanation:

The multiples are 27, 81, 243

The factors are 1, 9, 27

A taxi cab charges a pickup fee of $5.00 and $2.50 for each mile.
If you have $25 to spend on the taxi cab, how far can you ride?

Answers

Answer:

12.5

Step-by-step explanation:

A theater has 25 seats in the first row and 35 rows in all. Each successive row contains one additional seat. How many seats are in the theater?

Answers

The theater has a total of 945 seats.

To determine the number of seats in the theater, we need to calculate the sum of seats in each row. The first row has 25 seats, and each subsequent row increases by one seat. Since there are 35 rows in total, we can calculate the sum of an arithmetic series to find the total number of seats.

The formula for the sum of an arithmetic series is Sn = (n/2) * (a1 + an), where n is the number of terms, a1 is the first term, and an is the last term. In this case, n = 35 (number of rows), a1 = 25 (number of seats in the first row), and an = a1 + (n - 1) = 25 + (35 - 1) = 25 + 34 = 59 (number of seats in the last row). Plugging these values into the formula, we get Sn = (35/2) * (25 + 59) = 17.5 * 84 = 1470. Therefore, the theater has a total of 945 seats.


To learn more about arithmetic series click here: brainly.com/question/14203928

#SPJ11

Solve for y.
2- -3 = y
y =

Answers

Answer:

y=5

Step-by-step explanation:

the way you do this is by adding 2 and 3 because two negatives make a positive.

Ill give brainliest if answered correctly!
y x 6 = y for 2/3

Answers

Answer:

4

Step-by-step explanation:



In this problem, you will investigate perimeters of kites.


e. Make a conjecture about the value of x that will minimize the perimeter of the kite. What is the significance of this value?

Answers

To make a conjecture about the value of x that will minimize the perimeter of the kite, we need to consider the properties of kites. A kite is a quadrilateral with two pairs of congruent sides.

Let's assume that the lengths of the congruent sides are a and b, and the length of the other two sides (the diagonals) are x and y.

In a kite, the diagonals intersect at a right angle. By the Pythagorean theorem, we have\(x^2 + y^2 = a^2 + b^2\). Since we want to minimize the perimeter, we need to minimize the sum of the side lengths. The perimeter of the kite is given by \(P = 2(a + b)\).

To minimize the perimeter, we need to minimize the sum of the sides a + b. From the Pythagorean theorem, we can substitute\(y^2 = a^2 + b^2 - x^2\) into the perimeter equation: \(P = 2(a + b) = 2(a + √(a^2 + b^2 - x^2))\).

To find the value of x that minimizes the perimeter, we can take the derivative of P with respect to x and set it equal to zero. However, since the question asks for a conjecture, we can observe that as x approaches zero, the perimeter is minimized. This is because when x is close to zero, the diagonals of the kite become very close in length, making the sides a and b equal in length, which minimizes the sum of the side lengths.

Based on the observation, we can conjecture that the value of x that will minimize the perimeter of the kite is approximately zero. The significance of this value is that it creates a symmetrical kite with congruent sides, making it more aesthetically pleasing and balanced.

To know more about diagonals  :

brainly.com/question/31096074

#SPJ11

Which pair of coordinates has a midpoint of (8, 3)?(0, 10) and (-6, 6)(-8, 4) and (8, -2)(-5, -8) and (-11, 2)(10, 0) and (6, 6)

Answers

The formula to calculate the midpoint between two points is,

\(\lparen x_m,y_m)=\lparen\frac{x_1+x_2}{2},\frac{y_1+y_2}{2})\)

Checking the last option for confirmation

The coordinates are (10, 0) and (6, 6)

Where,

\(\begin{gathered} \lparen x_1,y_1)=\left(10,0\right) \\ \lparen x_2,y_2)=\left(6,6\right) \end{gathered}\)

Therefore,

\(\begin{gathered} \lparen x_m,y_m)=\lparen\frac{10+6}{2},\frac{0+6}{2})=\left(\frac{16}{2},\frac{6}{2}\right)=\left(8,3\right) \\ \therefore\lparen x_m,y_m)=(8,3) \end{gathered}\)

Hence, from the result above we can conclude that the coordinates with the pair (8,3) are (10, 0) and (6, 6).

Therefore, the answer is (10, 0) and (6, 6).

In , both feet can be off the ground at once. To avoid full impact on the joints, use . can be a better activity type for overweight individuals. increase(s) the number of calories used in a workout. Running is an example of . Short, high intensity segments included in a workout is/are called .

Answers

Introducing short, high-intensity segments in a workout is called interval training. This method can help boost calorie expenditure and improve overall fitness.

When engaging in running, there are moments during the running gait cycle where both feet are off the ground simultaneously. This phenomenon is known as the flight phase. Running is considered a high-impact activity, which means it puts stress on the joints, especially for individuals who are overweight or have joint-related issues. To mitigate this impact, low-impact exercises such as swimming or cycling can be more suitable for overweight individuals as they provide cardiovascular benefits with reduced stress on the joints.

While running may not be the ideal choice for overweight individuals concerned about the joint impact, it can be advantageous for increasing the number of calories burned during a workout. Running is a weight-bearing exercise that engages multiple muscle groups and requires more energy expenditure compared to low-impact exercises. This increased calorie burn can be beneficial for weight loss and improving cardiovascular fitness.

Interval training refers to a workout method that involves alternating periods of high-intensity exercise with periods of low-intensity or rest. This technique can be applied to various exercises, including running. By incorporating short, high-intensity segments, such as sprinting or running at a faster pace, into a workout, individuals can challenge their cardiovascular system, improve endurance, and burn more calories in a shorter amount of time. Interval training is known for its efficiency and effectiveness in boosting overall fitness levels.

To learn more about Interval training click here: brainly.com/question/13003179

#SPJ11

Can someone help with these two questions? Dont link anything

Can someone help with these two questions? Dont link anything

Answers

Step-by-step explanation:

4(3x+2)-5(7x+5)

12x+8-35x-25

-23x-17 or,

-(23x+17

2x+x(x+6)

2x+x^2+6x

x^2+8x or,

x(x+8)

please mark me brainliest

Use distributive property :
12x+8-35x-25
Add like terms:
-23x-17




Second question : 2x+ x^2+6x

A fair 6-sided die is rolled. What is the probability that a even number is rolled? O 0.5 0.333 0 0.6 0.167

Answers

Thus, the probability of rolling an even number is 3/6 or 1/2.

There are six possible outcomes when rolling a fair six-sided die.

These outcomes are 1, 2, 3, 4, 5, and 6. Three of these outcomes are even numbers, 2, 4, and 6.

Therefore, the probability of rolling an even number is 3/6 or 1/2.

=0.5.

So let me explain to you some concepts related to probability.

When it comes to probability, the number of outcomes is the total number of possible results.

Probability is always a number between 0 and 1. The probability of an event equals the number of ways that the event can occur, divided by the total number of possible outcomes.

A fair six-sided die has six possible outcomes, each of which has the same probability of 1/6. A die can show any number from 1 to 6.

The possible outcomes of rolling a six-sided die are:

1, 2, 3, 4, 5, 6.

Three of these outcomes are even numbers: 2, 4, and 6.

Thus, the probability of rolling an even number is the number of ways that an even number can occur, divided by the total number of possible outcomes.

There are three ways to roll an even number. They are:2, 4, and 6.

To know more about probability visit:

https://brainly.com/question/31828911

#SPJ11

what is the set of all solutions to the equation 2 = − x 2 =−xsquare root of, x, plus, 2, end square root, equals, minus, x ?

Answers

The equation 2 = -x√(x + 2) - x has two potential solutions: x = -1 and x = -8. However, x = -8 does not satisfy the equation, so the set of all solutions is {x = -1}.

To find the set of solutions to the equation 2 = -x√(x + 2) - x, we can solve it algebraically.

Starting with the given equation, we can simplify it step by step:

2 = -x√(x + 2) - x

Adding x to both sides:

2 + x = -x√(x + 2)

Squaring both sides to eliminate the square root:

(2 + x)^2 = (-x√(x + 2))^2

Expanding and simplifying:

4 + 4x + x^2 = x^2(x + 2)

Simplifying further:

4 + 4x = x^3 + 2x^2

Rearranging terms:

x^3 + 2x^2 - 4x - 4 = 0

Factoring the equation:

(x + 1)(x^2 + x - 4) = 0

Setting each factor to zero:

x + 1 = 0 or x^2 + x - 4 = 0

Solving the first equation, we find x = -1.

For the second equation, we can use the quadratic formula:

x = (-1 ± √(1^2 - 4(1)(-4))) / (2(1))

x = (-1 ± √(1 + 16)) / 2

x = (-1 ± √17) / 2

However, when we substitute x = (-1 + √17) / 2 into the original equation, it does not satisfy the equation. Therefore, x = -8 is not a solution.

Hence, the set of all solutions to the equation is {x = -1}.

For more information on sets visit: brainly.com/question/20372533

#SPJ11

You are able to buy 4 tacos and 6 burritos for $62.58 or you could buy 5 burritos and 7 tacos for $66.78.
How much would 3 burritos cost?

Answers

3 burritos would cost $23.31.

How to find the cost of 3 burritos

Let's assume that the cost of one taco is "t" and

the cost of one burrito is "b".

Then we can set up a system of two equations based on the given information:

4t + 6b = 62.58

7t + 5b = 66.78

Solving simultaneously using a calculator results to

t = 3.99

b = 7.77

Therefore, one burrito costs $7.77.

To find the cost of 3 burritos, we can multiply the cost of one burrito by 3:

3 * $7.77 = $23.31

Learn more about linear function at:

https://brainly.com/question/4025726

#SPJ1

Bridgette has 9 dogs. Every day, she feeds them a total of 9/10 of a can of food, where each dog is fed the same amount of food. How many cans of food does Bridgette give to each dog?

Answers

Bridgette gives 1/10 cans of food to each dog.

According to the question,

We have the following information:

Bridgette has 9 dogs. Every day, she feeds them a total of 9/10 of a can of food, where each dog is fed the same amount of food.

Now, we have the following expression:

9 dogs = 9/10 can

Now, we can easily find the cans given to each dog using division. We will divide the total number of cans of food by the number of dogs.

1 dog = 9/(10*9) cans

1 dog = 1/10 cans of food

Hence, Bridgette gives 1/10 cans of food to each dog.

To know more about cans of food here

https://brainly.com/question/6669562

#SPJ1

Is 0.625 greater than 0.75

Answers

Answer:

no

Step-by-step explanation:

the unit circle is the circle centered at with radius

Answers

The unit circle is the circle centered at with radius The unit circle is a circle centered at the origin with a radius of 1 unit. It plays a fundamental role in trigonometry, providing a geometric representation of the trigonometric functions

The unit circle is a circle that is centered at the origin (0, 0) of a coordinate plane and has a radius of 1 unit. In other words, it is a circle with a diameter of 2 units.

The unit circle is particularly significant in mathematics, especially in trigonometry. Its properties and relationships with angles are extensively used in various mathematical applications.

One of the main reasons the unit circle is so important is due to its connection with the trigonometric functions sine and cosine. As an angle rotates around the origin,

the coordinates of the point on the unit circle where the terminal side of the angle intersects the circle correspond to the values of sine and cosine of that angle.

For example, if an angle of 30 degrees is measured counterclockwise from the positive x-axis, the coordinates of the corresponding point on the unit circle would be (√3/2, 1/2), which are the values of sine and cosine for that angle.

Additionally, the unit circle provides a convenient way to visualize and understand other trigonometric functions such as tangent, cotangent, secant, and cosecant.

By examining the ratios of the coordinates on the unit circle, we can relate these trigonometric functions to the lengths and angles associated with right triangles.

In summary, the unit circle is a circle centered at the origin with a radius of 1 unit. It plays a fundamental role in trigonometry, providing a geometric representation of the trigonometric functions and aiding in the understanding of angles, ratios, and relationships within the field of mathematics.

To know more about trigonometry refer here:

https://brainly.com/question/11016599#

#SPJ11

Many doctors rely on the use of intravenous medication administration in order to achieve an immediate response of a particular drug's effects. The concentration, C, in mg/L, of a particular medication after being injected into a patient can be given by the function C(t) = −2t2 + 8t, where the time, t, is hours after injection.

Part A: What are the domain and range of the function C(t) based on the context of the problem? Show all necessary calculations. (5 points)

Part B: Graph the function to determine the greatest concentration of the medication that a patient will have in their body. (5 points)

Answers

The Greatest concentration of the medication that a patient will have in their body is 8 mg/L, which occurs at t = 2.The maximum concentration of the medication that a patient will have in their body is 8 mg/L.

Part A:

To determine the domain and range of the function C(t) = -2t^2 + 8t, we need to consider the context of the problem.

Domain:

The domain of a function represents the set of all possible input values. In this case, the function represents the concentration of the medication after being injected into a patient. Since time, t, is the independent variable representing hours after injection, it should be a non-negative value.

To find the domain, we need to determine the range of valid values for t. Since time cannot be negative in this context, the domain of the function is t ≥ 0.

Range:

The range of a function represents the set of all possible output values. In this case, the function represents the concentration of the medication, C(t), in mg/L.

To find the range, we can analyze the behavior of the function. The function is a quadratic equation, which opens downward since the coefficient of the t^2 term is negative (-2). This means that the maximum concentration will occur at the vertex of the parabolic curve.

The vertex of a quadratic function can be found using the formula: t = -b / (2a), where a and b are the coefficients of the quadratic equation.

In this case, a = -2 and b = 8. Substituting these values into the formula, we get:

t = -8 / (2(-2))

t = -8 / (-4)

t = 2

Therefore, the vertex occurs at t = 2.

Substituting t = 2 back into the original function, we can find the maximum concentration:

C(2) = -2(2)^2 + 8(2)

C(2) = -2(4) + 16

C(2) = -8 + 16

C(2) = 8

The maximum concentration of the medication that a patient will have in their body is 8 mg/L.

Part B:

To graph the function C(t) = -2t^2 + 8t and determine the greatest concentration, we can plot points and sketch the parabolic curve.

We can choose different values of t and calculate the corresponding values of C(t):

When t = 0, C(0) = -2(0)^2 + 8(0) = 0

When t = 1, C(1) = -2(1)^2 + 8(1) = 6

When t = 2, C(2) = -2(2)^2 + 8(2) = 8

When t = 3, C(3) = -2(3)^2 + 8(3) = 6

Plotting these points on a graph, we can connect them to form a parabolic curve.

The graph will be a downward-opening parabola, and the vertex will be at t = 2, C = 8.

The greatest concentration of the medication that a patient will have in their body is 8 mg/L, which occurs at t = 2.

For more questions on Greatest .

https://brainly.com/question/29171035

#SPJ8

And left or right units

And left or right units

Answers

Answer:

i belive the first up 3 un its and the second is 5

Step-by-step explanation:i think i had this  on a test question if wrong pls tell me will help through it

this is geometry find x!

this is geometry find x!

Answers

Answer:

8

Step-by-step explanation:

The measure of an inscribed angle is half the measure of the intercepted arc.

m<T = (1/2)m(arc)SU

9x - 25 = 47

9x = 72

x = 8

Answer: x = 8

Mona has 3200 yards of fencing to enclose a rectangular area. find the dimensions of the rectangle that maximize the enclosed area. what is the maximum​ area?

Answers

Maximum area enclosed by Mona for the fencing is 640,000 square yards. And the dimensions( length and width ) of the rectangle to enclosed maximum area are 800 yard each.

As given in the question,

Perimeter of the rectangular area encloses for fencing = 3200 yards

Let 'x' and 'y' be the length and width of the rectangle.

2( x + y ) = 3200

⇒ x + y = 3200/2

⇒y = 1600 - x

Area of rectangular field 'A' = xy

⇒ A = x ( 1600 - x )

⇒ A = 1600x - x²

Differentiate both the side of the equation we get,

dA/dx = 1600 - 2x

For Maximum Area dA/dx = 0

1600 -2x =0

⇒ 2x = 1600

⇒ x= 800 yards

Now, y = 1600 - 800

          = 800 yards

Maximum area = (800) (800)

                        = 640,000 square yards

Therefore, the dimensions of the rectangular area are 800yards each and its maximum area is equal to 640,000 square yards.

Learn more about maximum area here

brainly.com/question/11906003

#SPJ4

For what values of c does the quadratic equatrion x^2-2x+c=0 have two roots of the same sign

Answers

The roots have positive or same signs when c>0.

Note that only real numbers can be positive or negative. This concept does not apply to complex non real numbers. So first we have to make sure that the roots are real which occurs when discriminant is greater or equal to 0.

\(b^{2} -2ac > 0\\2^{2} -2(-1) (c) > 0\\4-2c > 0\\c > -2\)

Roots of quadrant equation have Samsame sign if product of roots >0.

\(\frac{a}{c} > 0\\\frac{c}{-1} > 0\\c < 0\)

Roots of quadratic equation have positive sign if product of roots<0.

c>0.

Combining results, we get:-

roots have positive signs when:-

c>0.

To know more about roots go through:-

https://brainly.com/question/428672

#SPJ4

The function y = a · bx models ____ for a > 0 and 0 < b < 1.

Answers

Answer: I don't know

Step-by-step explanation:

The difference of n and 2 is 10

Answers

Answer:

n-2=10

n=10+2

n=12

please thnx my answer

Answer:

12

Step-by-step explanation:

n - 2 = 10

(add 2 to the other side (Addition property of equality))

10 = n

Other Questions
BRAINLIESTT!! What event inspired a dramatic increase in religious fundamentalism in the Middle East among Muslims?A. The Arab-Israeli War of 1948, known by many Arab-speakers as the NakbaB. The end of World War IIC. The discovery of oil in the early twentieth centuryD. The League of Nations mandate system Fill in the complementary DNA strand (template strand). Then transcribe \& translate these bacterial ORFs (open reading frame) from DNA sequence into mRNA / polypeptide. These are the non-template strands. 5'TCAATGGAACGCGCTACCCGGAGCTCTGGGCCCAAATTTCATTGACACT 3 ' 5GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTtAACCCCGGA 3 What percentage of the total population of Country 1 is over 70 years old?A. 2.2%B. 1.2%C. 3%D. 1.0% -2 1/3 x 5/4 brainless? Is 1/6 closer to : 0 , 1 or 1/2 ? PLS HELP!!!!! after you eat a meal, the food gets broken down into its component parts through digestion. Order the words to describe the path that food takes as it moves along the digestive system. Place the first step at the top and the last step at the bottom.salivachewingsmall intestinestomachperistalsis In Tim O'Brien's "Ambush," which element directly enhances the theme of the past's imprint on the present?A. the frame-story structureB. the character KiowaC. the reference to fatigue toxinsD. the inability to discuss war Cho vn nghin cu: Vic lm thm ca sinh vin mt trng i hc. Son tho 8 cu hi ng phc tp dng la chn tr li cho vn nghin cu . Please help asap Thanks :)combine the ideas into one sentence do not change or omit any ideasThe Adult human body has bones.There are 206 bones in the adult human body.A babys body has 270 boned.Two hundred and seventy is an approximate number what is seen directly before the end of january and february riddle 300O3) What is the value of x?69'709071003D 13. Pick a value for a and b that would make this equation true.59a=b= Which of the following groups were nomads in Arabia? Mongols, Bedouins, Avars What religion contributed to the Fall of Rome?_______ : A particular fruit's weights are normally distributed, with a mean of 402 grams and a standard deviation of 34 grams. If you pick one fruit at random, what is the probability that it will weigh between 287 grams and 450 grams Andrew Johnson's plan for national reconstruction: Group of answer choices called for freed slaves to be given back to their white masters. proved to be very lenient toward the South. pleased the Republican leadership in Congress. called for harsh treatment of the South. Iif susans claim of age discrimination does not prevail, she might win a case for? While underway in fog, you hear a vessel sound one prolonged blast followed by two short blasts.What does this signal indicate While most of the oil spilled into the gulf of mexico from the deepwater horizon drilling rig in 2010 has disappeared, some of the oil spilled from the exxon valdez oil tanker into prince william sound, alaska, in 1989 still remains in the coastal sand and sediments. What possible differences in these two spills could account for the different rates of petroleum degradation?. 100PT! ABCD is a square. Given only the choices below, which properties would you use to prove AEB DEC by ASA? (You can choose more than one!)Opposite angles are congruent.The diagonals bisect each other.All sides are congruent.Opposite sides are parallel.