Are you what you eat? Yes or no and why?

Answers

Answer 1
You are not what you eat because if you ate a burger, you’re not a burger right?
Answer 2

Answer:

I am sorry but I didn't understand your question clearly...

Explanation:


Related Questions

I need help with this practice problem Fill in the blanks

I need help with this practice problem Fill in the blanks

Answers

Solid fossil fuel are formed over millions of years by decay of land vegatation or plant remains. When the layers are settled and heated, coal is produced as deposits. Fossil fuels are burned to produce energy. Power plants burn coal or oil to build heat that is consequently used to make steam to drive turbines which generate electricity.

Answer - Solid fosiil fuel formed from decay of land vegetation or plant remains. Produces energy when burned.

please help me with this it’s 6th grade word and is due today

please help me with this its 6th grade word and is due today

Answers

Answer:

B

Explanation:

brainlest please oh please

white blood cells have been trained to recognize body cells, called , and distinguish them from foreign material that is called .

Answers

White blood cells have been trained to recognize body cells called lymphocytes and distinguish them from foreign material that is called antigens.

What are white blood cells?

White blood cells are also called leucocytes and they are types of blood cell that is involved with an immune response, or part of the immune system.

The white blood cells of the immune system are involved in protecting the body against both infectious disease and foreign invaders.

Antigens are substances that induces an immune response and are usually foreign invaders. The white blood cells helps the identify this antigens and separate them from lymphocytes.

Learn more about white blood cells at: https://brainly.com/question/19202269

#SPJ1

Which organ system is responsible for making sure blood flows to the whole body?.

Answers

The organ system responsible for ensuring the flow of blood throughout the body is the circulatory system.

What is the circulatory system?

The circulatory system (cardiovascular system) pumps blood from the heart to the lungs to get oxygen. The heart then sends oxygenated blood through the arteries throughout the body. Veins carry oxygen-poor blood back to the heart to start the circulation process.

The heart is a vital organ of the circulatory system. The function of the heart in the circulation process is to pump blood throughout the body. The heart cooperates with the blood vessels in the circulation process. Blood vessels have the role of circulating blood to and from the heart.

Learn more about the circulatory system here https://brainly.com/question/473969

#SPJ4

32 POINTS!!

help a sister out plz

Phosphorus (P) is the element with the atomic number 15. Which of the
following correctly compares 31 and 32p, which are two isotopes of
phosphorus?

A. Both isotopes contain 15 protons.
B. 31P has 30 protons, whereas 32P has 31 protons.
c. 31P has 31 neutrons, whereas 32p has 32 neutrons.
D. Both isotopes contain 17 neutrons.

32 POINTS!! help a sister out plz Phosphorus (P) is the element with the atomic number 15. Which of thefollowing

Answers

Answer: A both isotopes contain 15 protons.

Explanation:

In the hot summer, a reptile can burrow into a cool, damp surface so that it can lose heat through ___
since its skin is touching those surfaces.
A) conduction B) convention C) radiation

Answers

Answer:

A-Conduction

Explanation:  

.The part of the nephron whose epithelial cells are most responsible for resorption and secretion is the
A) glomerular capsule (podocytes).
B) proximal tubule.
C) thin segment.
D) distal tubule.

Answers

Answer:

Explanation:

All of the following are parts of the nephron except the glomerular capsule and is denoted as option A.

What is a Nephron?

This is defined as the functional unit of the kidney and comprises of various parts such as the collecting duct etc.

The nephron however doesn't have a glomerular capsule as this is found at the beginning of the tubular component of a nephron.

Which of the following is a human activity that can cause a freshwater resource to become hypoxic?

Use of fertilizers on farms and yards
Increased death of aquatic organisms
Decrease in algae and microorganisms
Using more plastics and paper products

Answers

Use of fertilisers on farms and yards

Fertilisers are made up on Nitrogen, Phosphorus and Potassium

There are essential for plant growth
However having too much of these nutrients is called eutrophication and can result in algae bloom.

The algae growth then reduces the oxygen in the water , causing hypoxia.

I really need help in biology. Please help. It’s enzymes.

I really need help in biology. Please help. Its enzymes.

Answers

The way that the enzyme acts is shown in the image attached.

How does enzyme break down hydrogen peroxide?

We know that the way that the enzyme works is that the enzyme acts in a lock and key model. We have to note that the enzymes are know to be specific in the way that they carry out there action meaning that one enzyme can only catalyze on reaction.

We are talking about the break down of hydrogen peroxide by an enzyme in the question and the image that have been attached shows the mode of action of the enzyme.

Learn more about enzyme:https://brainly.com/question/14953274

#SPJ1

I really need help in biology. Please help. Its enzymes.

MA (b) The figure above is highly magnified. The scale bar in the figure above represents 0.1 mm. Use a ruler to measure the length of the scale bar and then calculate the magnification of the figure above.

Magnification =​

MA (b) The figure above is highly magnified. The scale bar in the figure above represents 0.1 mm. Use

Answers

Answer: the scall is 25 feet tall so your answer is 456

Explanation:

results from the use of neuroimaging techniques suggest a link between capgras syndrome and abnormalities in each of the following brain regions except the

Answers

Results from neuroimaging studies have consistently suggested a link between Capgras syndrome and abnormalities in brain regions associated with facial recognition, emotion, and familiarity.

The frontal cortex, limbic system (including the amygdala), temporoparietal junction, and fusiform face area have been commonly implicated in the disorder.

These regions play important roles in processing facial information, detecting emotions, and assigning familiarity to individuals. However, it is important to note that Capgras syndrome is a complex condition with diverse underlying causes, and individual variations in brain abnormalities may exist.

Therefore, there is no specific brain region that has been consistently found to be unaffected in individuals with Capgras syndrome based on neuroimaging studies.

Learn more about Limbic System

https://brainly.com/question/4433445

#SPJ11

explain the difference between arteries veins arterioles and venules

Answers

Arteries are blood vessels that carry oxygen-rich blood away from the heart to the body's tissues. They are typically thick and muscular, allowing them to withstand the high pressure of the blood being pumped from the heart. Arterioles are smaller, thinner arteries that branch off from the main arteries and lead to the capillaries. Veins, on the other hand, carry oxygen-poor blood from the body's tissues back to the heart.


Veins are thinner and less muscular than arteries, as the blood is under much less pressure. Venules are smaller, thinner veins that lead to the larger veins and eventually back to the heart.the main differences between arteries and veins are their direction of blood flow and the amount of pressure they operate under. Arteries carry oxygen-rich blood away from the heart at high pressure, while veins carry oxygen-poor blood back to the heart at low pressure. Arterioles and venules are smaller branches of these main vessels that help distribute blood throughout the body's tissues.

To know more about Arteries and Veins Visit:

https://brainly.com/question/30791331

#SPJ11

What systems can you think of? List one or two examples of things that you think might be systems

Answers

Systems can be found in various domains, such as biology, ecology, society, information, and the physical world. Examples include the nervous system, ecosystems, economic systems, computer networks, and the solar system. Systems consist of interconnected elements working together to fulfill a common purpose.

Systems are structures or sets of interconnected elements that work together to achieve a common purpose. There are various types of systems found in different domains. Here are a few examples:

1. Biological Systems:

  - The nervous system: It includes the brain, spinal cord, and nerves, which work together to transmit signals and coordinate bodily functions.

  - The cardiovascular system: It consists of the heart, blood vessels, and blood, responsible for circulating oxygen, nutrients, and hormones throughout the body.

2. Ecological Systems:

  - Ecosystems: A complex system comprising living organisms (plants, animals, microorganisms) interacting with their physical environment (soil, water, climate) in a specific geographical area.

  - Food webs: Systems that depict the interconnectedness of various organisms in an ecosystem through their feeding relationships.

3. Social Systems:

  - Economic system: A network of individuals, organizations, and institutions involved in the production, distribution, and consumption of goods and services within a society.

  - Political system: Structures and processes through which a society governs itself, including institutions, laws, and decision-making mechanisms.

4. Information Systems:

  - Computer networks: Interconnected devices and communication protocols that enable the exchange of data and information between computers.

  - Database systems: Organized collections of data and software designed to efficiently store, retrieve, and manage large amounts of information.

5. Physical Systems:

  - Solar system: A system consisting of the sun, planets, and other celestial bodies held together by gravitational forces.

  - Climate system: The interactions between the atmosphere, hydrosphere, biosphere, and geosphere that influence long-term weather patterns and climate conditions.

For more such information on: the physical world

https://brainly.com/question/1542986

#SPJ8

Identify the vascular tissues.
a. ___________
b. ___________

Identify the vascular tissues.a. ___________b. ___________

Answers

Answer:  

The right answer to that is

a. phloem

b. xylem

Explanation:

In this vascular tissue, the vascular bundle is a ring, with the larger xylem cells in the center and the smaller phloem cells to the outside.

I had a hard time knowing the answers for this question, but I finally understand.

So, hope you believe, cause I read this in my school books.

Have a good day!!!

The person who answered on top had the write answers, but not on the right letters.

The vascular tissues identify as:

a. phloem

b. xylem

What are Vascular tissues?

Vascular tissues in plants are specialised tissues which transport nutrients and water through the plant. They are made up of two distinct kinds of tissues: xylem and phloem.

Xylem is in charge of carrying water and minerals that are dissolved from the plant's roots to its leaves. It is made up of many cell types, such as tracheids, vessel components, and fibres. Tracheids and vessel elements are long, hollow structures that create lengthy tubes when stacked end to end.

Sugars and other organic compounds are transported from the leaves to the remainder of the plant by phloem. There are two sorts of cells in it: sieve tube elements and cell companions. Sieve tube components are long, narrow cells that run end to end.

Therefore, the vascular tissues identify as:

a. phloem

b. xylem

Learn more about Vascular tissues, here:

https://brainly.com/question/14989922

#SPJ2

a disorder of sexual development is a condition that involves the unusual development of one's ?

Answers

A disorder of s exual development is a condition that involves the unusual development of one's s ex organs, reproductive system, or s ex chromosomes.

It is a condition that can occur in both males and females. In this condition, an individual's s ex development is different from the typical development of male or female anatomy.

In DSD, the person's chromosomes or anatomy may not be clear cut male or female. This can lead to a range of different outcomes, such as having a mix of male and female characteristics, having a set of characteristics that do not align with either male or female, or having an underdeveloped set of male or female characteristics.In some cases, the individual's DSD is apparent at birth or during childhood.

In other cases, it may not be apparent until puberty or later in life. Some of the different types of DSD include Turner syndrome, Klinefelter syndrome, and androgen insensitivity syndrome. Treatment for DSD varies depending on the individual and the specific condition. In some cases, surgery may be necessary to correct anatomical differences, while in others hormone therapy may be used to adjust hormone levels and promote se xual development.

learn more about Turner syndrome here

https://brainly.com/question/30513251

#SPJ11

Plz help lol. Identify and describe 2 things that could explain why glucose and complex carbohydates are not disappearing in M’Kenna’s digestive system.

Answers

Answer:

Explanation:

Plz help lol. Identify and describe 2 things that could explain why glucose and complex carbohydates are not disappearing in M’Kenna’s digestive...

A very hot wildfire burns up an acre of prairie. Organisms above and below ground get wiped out, and even the abundance of soil nutrients suffers. What will happen first in the area's recovery?
A. Organisms will return to the soil
B. Weeds will return.
C. Humans will plant saplings
D. Rain will bring nutrients ​

Answers

B!!!!!!!!!!!!!!!!!!!!!!

Ben measures the height of two bottles. One is 12 centimeters and the other is 15 centimeters. In millimeters what is the difference of the two heights

Answers

The difference in height between the two bottles is 30 millimeters.

To calculate the difference in height between the two bottles in millimeters, we need to convert the heights from centimeters to millimeters and then subtract one from the other.

First, we convert the height of the first bottle from centimeters to millimeters. Since there are 10 millimeters in a centimeter, we can multiply the height of 12 centimeters by 10 to get the height in millimeters:

12 centimeters * 10 millimeters/centimeter = 120 millimeters.

Next, we convert the height of the second bottle from centimeters to millimeters using the same conversion factor. We multiply the height of 15 centimeters by 10:

15 centimeters * 10 millimeters/centimeter = 150 millimeters.

Now that we have both heights in millimeters, we can calculate the difference. We subtract the height of the first bottle from the height of the second bottle:

150 millimeters - 120 millimeters = 30 millimeters.

Therefore, the difference in height between the two bottles is 30 millimeters.

know more about height here:

https://brainly.com/question/31556472

#SPJ8

Which of the following is not true of heterochromatin oecurs emains in a highly condensed state throughout the cell eyele cription up most chromosomal material and is where most t b. Makes utromeres t c. Exists at the centromeres and telomeres d. Occurs inactivated Occurs along one ent when this X becomes along one entire X chromosome in female mamma y the absence of crossing over and replication late

Answers

Statement b is the one that is not true. Heterochromatin is associated with transcriptional repression rather than being the site of active transcription.

Heterochromatin refers to a tightly condensed form of chromatin, which is the complex of DNA, histones, and other proteins that make up chromosomes. It differs from euchromatin, which is a less condensed and more transcriptionally active form of chromatin.

Let's address each statement regarding heterochromatin:

a. "Heterochromatin remains in a highly condensed state throughout the cell cycle" - This statement is generally true. Heterochromatin is typically more condensed and less transcriptionally active than euchromatin. It maintains its condensed state during most phases of the cell cycle.

b. "Heterochromatin makes up most chromosomal material and is where most transcription occurs" - This statement is not true. Heterochromatin is highly condensed and transcriptionally inactive, meaning that it contains genes that are usually not expressed. Euchromatin, on the other hand, is the region where most transcription occurs as it is less condensed and allows access to the transcriptional machinery.

c. "Heterochromatin exists at the centromeres and telomeres" - This statement is true. Heterochromatin is commonly found at the centromeres, which are the specialized regions of chromosomes involved in chromosome segregation during cell division, and the telomeres, which are the protective caps at the ends of chromosomes.

d. "Heterochromatin occurs inactivated along one entire X chromosome in female mammals in the absence of crossing over and replication" - This statement is true. In female mammals, one of the two X chromosomes is randomly inactivated to achieve dosage compensation. The inactivated X chromosome forms a condensed heterochromatin structure known as a Barr body.

Overall, statement b is the one that is not true. Heterochromatin is associated with transcriptional repression rather than being the site of active transcription.

To know more about Heterochromatin follow the link:

https://brainly.com/question/30394937

#SPJ4

According to this theory, how did mitochondria evolve?

Answers

Answer: Mitochondria evolved from endosymbiotic prokaryotes that were able to use oxygen to generate energy rich ATP. To prokaryotes then evolved into mitochondria that now power the cells of all multicellular organisms.

Explanation:

Answer:

According to this theory mitochondria evolved from bacteria and somehow became incorporated into the cytoplasm.

Explanation:

i don't know which theory ur talking about but this theory is the endosymbiotic theory

what structure in the nephron has the primary function of allowing water to diffuse into the tissue fluid surrounding the nephron?

Answers

Loop of Henle structure in the nephron has the primary function of allowing water to diffuse into the tissue fluid surrounding the nephron.

The  circle of Henle is a long U-shaped section of the tubule that transports urine within each nephron of the  order of reptiles,  catcalls, and mammals. The primary function of the Henle  circle is to recover water and sodium chloride from urine. This function enables for the creation of urine that's significantly more concentrated than blood, reducing the  volume of water  needed for living.

Several organisms that dwell in dry conditions,  similar as  comeuppance, have  veritably effective Henle  circles. The  circle of Henle is separated into three main  parts anatomically the thin descending  branch, the thin  thrusting  branch, and the thick  thrusting  branch(  occasionally also called the  lacing member). The liquid entering the Henle  circle is a  result of  swab, urea, and water.

Learn more about nephron at

https://brainly.com/question/28083402

#SPJ4

7. After the rumor spread that Henrietta’s cells took over many other cell cultures in research labs what did researchers want to do and why?
I WILL GIVE BRAINLIEST!

Answers

They wanted to find information on them because they were essential to developing the polo vaccine

Researchers wanted to do research because they thought normal cells spontaneously became cancerous cells.

What are Henrietta's cells?

The first immortal human cells to be generated in culture were from Henrietta Lacks. They are also known as Henrietta's cells. They were crucial in the creation of the polio vaccine. In the early space flights, they went up to investigate what would happen to cells in weightlessness.

Her cells have since been employed in numerous significant scientific breakthroughs, such as cloning, gene mapping, and in vitro fertilization.

After the rumor spread that Henrietta's cells took over many other cell cultures in research labs scientists wanted to do research, because they thought that normal cells are converting into cancerous cells.

Learn more about Henrietta's cells, here:

https://brainly.com/question/29241629

#SPJ2

Illustrated below is a model summarizing Cas9/sgRNA-DNA interactions. Shown below it is the start of a coding region within the first exon of a gene. The bracketed codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene. You wish to use CRISPR/Cas9 to make a double-stranded DNA break within the open reading frame (ORF) of this gene.

Suppose you use 5' AGG as the PAM sequence, which sequence could you use for your sgRNA?

...CTGAGATCTCATGTACTAGTCCGTCATTACTGTACTTCTCTTGACAGGCTGTGTCGTGGAATATCTAAGAGCT-3'
...GACTCTAGAGTACATGATCAGGCAGTAATGACATGAAGAGAACTGTCCGACACAGCACCTTATAGATTCTCGA-5'

a) 5' CTGTGTCGTGGAATATCTAA 3'
b) 3' GACACAGCACCTTATAGATT 5'
c) 5' ATTACTGTACTTCTCTTGAC 3'
d) 3' TAATGACATGAAGAGAACTG 5'

Answers

Correct sgRNA sequence for making a double-stranded DNA break within the ORF of this gene using CRISPR/Cas9 is 3' GACACAGCACCTTATAGATT 5'.

The correct option is B .

To design the sgRNA sequence for targeting the open reading frame (ORF) of the gene using CRISPR/Cas9, we need to identify the appropriate sequence that complements the PAM sequence (5' AGG) and is located adjacent to the target site.

In this case, we want to find the sequence that pairs with the PAM sequence (5' AGG) in the lower strand of the gene. The sgRNA sequence should be complementary to the target DNA sequence adjacent to the PAM sequence.

Comparing the given options with the lower strand of the gene sequence, we can see that option (b) 3' GACACAGCACCTTATAGATT 5' is the correct sgRNA sequence. This sequence pairs with the PAM sequence (5' AGG) and is located adjacent to the target site within the open reading frame (ORF) of the gene.

Hence , B is the correct option

To learn more about  CRISPR/Cas9,  here

brainly.com/question/32177722

#SPJ4

Which of the following statements about marijuana is false?a. Peoplewho have used marijuana may experience psychoactive effectsfor several days after use.b. Marijuana has shown someeffectiveness in treating chemotherapy-related nausea.c. Unlikelong-term use of alcohol, regular use of marijuana does not haveany long-lasting health consequences.d. Depending on the amount of marijuana used, its effects can range from a mild sense ofeuphoria to extreme panic.

Answers

The false statement about marijuana is Unlike long-term use of alcohol, regular use of marijuana does not have any long-lasting health consequences.

The correct option is C .

Regular use of marijuana can indeed have long-lasting health consequences. Chronic and heavy marijuana use has been associated with several potential health risks, including respiratory problems, cognitive impairments, mental health issues, and addiction. While the severity and extent of these consequences can vary among individuals, it is incorrect to claim that regular marijuana use does not have any long-lasting health consequences.

Frequent marijuana smoking can lead to respiratory issues such as chronic bronchitis, coughing, and increased risk of lung infections. Long-term marijuana use, especially when initiated during adolescence, has been linked to negative effects on memory, attention, and cognitive function. Marijuana use has been associated with an increased risk of developing mental health disorders such as anxiety, depression, and psychosis. It can also exacerbate symptoms in individuals already susceptible to these conditions.

Hence , C is the correct option

To learn more about Marijuana , here

brainly.com/question/31030620

#SPJ4

When you eat a hamburger, some of the energy in the food is converted to ATP that your cells can use to do all kinds of work, some of the energy is stored for later use, and some of the energy is dissipated as heat. In other words, you can only make use of a portion of the energy available in the hamburger because some is always lost to entropy. true or false

Answers

The given statement "When you eat a hamburger, some of the energy in the food is converted to ATP that your cells can use to do all kinds of work, some of the energy is stored for later use, and some of the energy is dissipated as heat. In other words, you can only make use of a portion of the energy available in the hamburger because some is always lost to entropy" is True.

In physics, entropy is the measure of the number of possible ways in which a system can be arranged, often taken to be a measure of the degree of disorder or randomness in the system. The second law of thermodynamics, which specifies that entropy always increases or remains constant, governs the flow of energy in a closed system.

Food is a source of energy. When food is consumed, the body's cells convert it into ATP that can be used to fuel cellular processes and perform work. Some of the energy is stored for later use, and some is dissipated as heat. Energy can be lost to entropy in various ways, but it can never be created or destroyed. Thus, when you eat a hamburger, some of the energy in the food is converted to ATP that your cells can use to do all kinds of work, some of the energy is stored for later use, and some of the energy is dissipated as heat. In other words, you can only make use of a portion of the energy available in the hamburger because some is always lost to entropy.

Know more about entropy here,

https://brainly.com/question/32167470

#SPJ11

The function of root cap is.....
A.
Absorb water

B.
Enlarge the absorption of water

C.
Growth of root

D.
Protects apical meristem​

Answers

i’m pretty sure it’s c

given the macro definition and global declarations below, provide answers to the questions (below the code):

Answers

A. After the statement quiz2 xVar, yVar executes in main, xVar contains 9 (decimal).

B. The statement quiz2 2, 6 will produce an error when the macro is invoked. (False)

C. Upon completion, EDX will contain 90 (decimal).

A. The quiz2 macro multiplies the value of pVar with itself using the MUL instruction and performs the multiplication for the number of times specified by qvar using the LOOP instruction. In this case, xVar is initially set to 3, so when it is passed as the pVar argument to quiz2 along with yVar (also 3) as the qvar argument, the macro will execute the multiplication loop 3 times. Therefore, xVar will be multiplied by itself three times, resulting in 9.

B. The quiz2 macro accepts two arguments, pVar and qvar, and does not impose any restrictions on the values that can be passed to these arguments. As long as the arguments are valid DWORD values, the macro will execute without producing an error. Therefore, the statement quiz2 2, 6 will not produce an error when the macro is invoked.

C. In the given code snippet, the value 10 is assigned to EBX, and the value 3 is assigned to EDX. Then the quiz2 macro is invoked with EBX as pVar and EDX as qvar. The macro multiplies EBX (10) with itself three times, resulting in 1000. Since EDX is not modified within the macro, it retains its initial value of 3. Therefore, upon completion, EDX will contain 3 (decimal).

To learn more about global declarations, here

https://brainly.com/question/30637797

#SPJ4

Finding Food chain To be aware Despite
Radically Bare Bank Fixed
Use the above words and respond to each statement.
1. Not covered by grass. ___________________
2. Without being prevented by __________________
3. Not movable or changeable __________________
4. To know _________________________
5. Plants and animals that are connected because some eat others
____________________
6. Discovery ____________________
7. A lot and in an important way ________________________
8 Land on the side of a river (or lake) _____________________

Answers

Answer:

1 bare 2 despite 3 fixed 4 to be aware 5 food chain 6 finding 7 radically 8 bank

Deforestation is when an entire forest is knocked down. Why do you think
this is a bad thing?

Deforestation is when an entire forest is knocked down. Why do you thinkthis is a bad thing?

Answers

Answer: Deforestation is a problem because it eradicates all the oxygen that we inhale that is created by a vast amount of  trees that can only produce a fraction of oxygen for a person to breath several times

the following are thought to be two key adaptations for running in humans: a. four chambered heart and pulmonary circuit b. binocular vision and opposable thumbs c. loose shoulders and big butts d. knees and elbows e. tetrapod body design and vertebrae

Answers

The following are thought to be two key adaptations for running in humans: c. loose shoulders and big buttocks.

Loose shoulders allow for a greater range of motion and rotational movement, which is crucial for maintaining balance while running. The swinging motion of the arms counterbalances the rotation generated by the legs, enhancing stability and preventing energy loss. Additionally, the presence of larger buttock muscles, specifically the gluteus maximus, plays a significant role in running efficiency. These muscles help stabilize the trunk and provide powerful propulsion during each stride, increasing overall running speed and endurance.

While other mentioned adaptations, such as a four-chambered heart, binocular vision, and tetrapod body design, do play essential roles in human evolution and various functions, they are not considered as key adaptations specifically for running. Knees and elbows do contribute to locomotion but are not unique adaptations for running. Hence, the most relevant adaptations for human running ability are loose shoulders and larger buttocks muscles. Hence

Learn more about adaptations here: https://brainly.com/question/30133905

#SPJ11

Other Questions
why are small, isolated populations at a particular risk of extinction? select all accurate reasons. Whitney starts the engine on her small private airplane. The engine drives a propeller with a radius of 6.5 feet and its centerline 10.5 feet above the ground. At idle, the propeller rotates at a constant speed of approximately 850 revolutions per minute. The height of one propeller tip as a function of time is given by h = 10.5 + 6.5 sin(850t), where h is the height in feet and t is the time in minutes. Find h when t = 2 minutes.a.4.1 ftb.9.4 ftc.16.9 ftd.11.6 ft Q2) Vibrations of an ammonia molecule are described by the so called rigid rotator Hamiltonia H=2+L 21, 21, 21, Where the moments of inertia I, I, I, and I = 13. a) Show that H and Lz commute. Determine if the inhibitor used is a competitive, uncompetitive, or non-competitive inhibitor and explain. Propose a mechanism under which the type of inhibitor determined could interact with the enzyme. How are you convinced? Which is a possible long-term effect of steroid use?A. increased likelihood of liver cancerB. increased risk of obesityC. development of osteoporosis in later lifeWhich is a possible long-term effect of steroid use? It might seem like a lot to do, but, you will get a lot of points!!!!! I need you to help me figure out, the theme is developed for the story "if" (which is below) and it will need to have specific evidence from the poem. And then can you explain how they are developed in "cant" (which is also below) And then can you summarize how the two poems and similar and/or different. Thank You! :3Cantby Edgar GuestCant is the worst word thats written or spoken;Doing more harm here than slander and lies;On it is many a strong spirit broken,And with it many a good purpose dies.It springs from the lips of the thoughtless each morningAnd robs us of courage we need through the day:It rings in our ears like a timely sent warningAnd laughs when we falter and fall by the way.Cant is the father of feeble endeavor,The parent of terror and halfhearted work;It weakens the efforts of artisans clever,And makes of the toiler an indolent shirk.It poisons the soul of the man with a vision,It stifles in infancy many a plan;It greets honest toiling with open derisionAnd mocks at the hopes and the dreams of a man.Cant is a word none should speak without blushing;To utter it should be a symbol of shame;Ambition and courage it daily is crushing;It blights a mans purpose and shortens his aim.Despise it with all of your hatred of error;Refuse it the lodgment it seeks in your brain;Arm against it as a creature of terror,And all that you dream of you someday shall gain.Cant is the word that is foe to ambitionAn enemy ambushed to shatter your will;Its prey is forever the man with a missionAnd bows but to courage and patience and skill.Hate it, with hatred thats deep and undying,For once it is welcomed twill break any man;Whatever the goal you are seeking, keep tryingAnd answer this demon by saying: I can. EndIfIf you can keep your head when all about youAre losing theirs and blaming it on you;If you can trust yourself when all men doubt you,But make allowance for their doubting too;If you can wait and not be tired by waiting,Or, being lied about, dont deal in lies,Or, being hated, dont give way to hating,And yet dont look too good, nor talk too wise;If you can dreamand not make dreams your master;If you can thinkand not make thoughts your aim;If you can meet with triumph and disasterAnd treat those two impostors just the same;If you can bear to hear the truth youve spokenTwisted by knaves to make a trap for fools,Or watch the things you gave your life to broken,And stoop and build em up with worn-out tools;If you can make one heap of all your winningsAnd risk it on one turn of pitch-and-toss,And lose, and start again at your beginningsAnd never breathe a word about your loss;If you can force your heart and nerve and sinewTo serve your turn long after they are gone,And so hold on when there is nothing in youExcept the Will which says to them: Hold on!If you can talk with crowds and keep your virtue,Or walk with kingsnor lose the common touch;If neither foes nor loving friends can hurt you;If all men count with you, but none too much;If you can fill the unforgiving minuteWith sixty seconds worth of distance runYours is the Earth and everything thats in it,Andwhich is moreyoull be a Man, my son! End when a malicious attacker coordinates a denial of service (dos) attack against your organization, which security objective is most impacted in a negative way? well-developed permeability channels that form when diffuse-flow aquifers are transformed in conduit-flow aquifers are called: Qu est haciendo? (Reflexive Verb)La Chica (picture of a girl doing her makeup) (blank)Fill in the blank with just the verbs using a present progressive 5. What is the value of f(-5) if f(x) = -x - 4?A - 9f(-577-166B. 1C. 1D. 9 according to chalmers, knowing why and how brain activity is associated with consciousness is the: A metal, M, forms an oxide having the formula MO2 containing 59.93% metal by mass. Determine the atomic weight in g/mole of the metal (M). Please provide your answer in 2 decimal places.a. How many moles of oxygen atoms are found in 4.00 g of O2?b. How many atoms of hydrogen are found in 0.400 mol of H2S?c. How many hydrogen atomsare present in 0.235 g of NH3? Write an equation that models the following situation: wong's beginning weight was 180. but he stuck to his diet and lost weight at a rate of 4% a month. a.) y= 180(0.04)xy= 180(0.04)x b.) y= 180(1.04)xy= 180(1.04)x c.) y= 180(1.4)xy= 180(1.4)x d,) y= 180(0.86)x In your opinion, is it important to have a strong leader? why or why not Caden Carpenter is a college student applying for a student loan to complete the final year of his degree program. During the application process, Caden decided that he will pay off the student loan in 5 years. A private loan company approves Caden for a $15,000 student loan that has an interest rate of 3.5% compounded monthly over 5 years. Find the total amount Caden will pay over the course of the loan. Round to the nearest cent as needed. Oxygen is a substance that dissolves in water. Fish absorb oxygen from the water. When dissolved oxygen levels are low, it can be hard for organisms to survive Question 7Which of the following about the risk of arbitrage is correct?I: In theory, arbitrage is riskless because it is a long-short hedged position.II: in theory, it is riskless because eventually price has to go back to fundamentals. There is no uncertainty on this outcome.III: In reality, even if eventually price will go to fundamentals, arbitrageurs maybe forced out of the market because of the risk of margin call.IV: In reality, if lenders do not dare to lend enough capital to arbitrageurs, then arbitrageurs may not have enough capital to push price back to fundamentals. Price could always be wrong, thus making the arbitrage position not riskless. should there be more stages of ultra instinct than mastered ultra instinctif not what new forms should he have. Antivirus programs protect your computer system from viruses or malicious programs. This is an example of which type of software when the natural process limits are greater than the specification range, which of the following courses of action involves the customer?