This is called an ion. :)
What are 2 similarities chromosomes you get from parents
The two similarities between chromosomes that you get from your parents are Genetic Material and Number of Chromosomes.
What more should you know about genetic materials and number of chromosomes you get from parents?In terms of Number of chromosomes: Every Humans have 23 pairs of chromosomes, for a total of 46 chromosomes. Each parent contributes 23 chromosomes to their child, for a total of 46.
in tems of Genetic material: The chromosomes that you get from your parents contain the same genetic material. This is why you look like your parents and why you have inherited some of their traits.
Find more exercises on chromosomes;
https://brainly.com/question/1596925
#SPJ1
Identify structures found in fungi. Check all that
apply.?
O produce spores
O contain pseudopods
O contain hyphae
O contain a fruiting body.
The answer is 1, 3, and 4
The correct answers are A. produces spores, C. contain hyphae, and D. contain a fruiting body. (:
Explanation:
A produces spores
C contains hyphae
D contains a fruiting body
Which of the following takes the least amount of energy and uses the fewest natural
resources? (Select the best answer.)
Reducing
Downcycling
Reusing
Recycling
Which of the following describes a reason to use phosphorus on plants?
O to help plants grow strong root structures and large flowers
O to weaken a weed plant and make it vulnerable to pests and disease
O to help roots absorb nitrogen and potassium
O to act as a multivitamin, boosting plant health
The reason to use phosphorus on plants is: to help plants grow strong root structures and large flowers.
Phosphorus is an essential nutrient for plant growth and is important for the development of strong root systems, which in turn support the growth of large and healthy plants. It is also essential for the development of flowers, fruits, and seeds. While nitrogen and potassium are also important nutrients for plants, phosphorus plays a unique role in promoting root development and reproductive growth. Therefore, using phosphorus fertilizer can be beneficial for promoting healthy plant growth.
Ben wants to be on the basketball team, but he's worried he won't make it to the team. He spent weeks working out as hard as possible, preparing for try outs. At try outs, he amazes the coaches with his skills as good player. They ask him to be their starting player that year and give him a jersey. Ben leaves the court happily!
II. Match the events in column A with the correct element of a plot in column B.
COLUMN A
14. He spends weeks working out as hard as possible, preparing for try outs.
15. Ben wants to be on the basketball team but he's worried he won't make the team.
16. At try out, he amazes the coaches with his skill as a player
17. Ben was given a jersey.
18. Ben leaves the court happily!
COLUMN B:
A. Exposition
B. Rising Action
C. Climax
D. Falling Action
E. Resolution
PLEASE ANSWER IT I REALLY NEED THE ANSWER
NONSENSE REPORT
phenolic compounds are effective against . multiple choice question. all enveloped viruses most vegetative bacterial cells bacterial endospores
Phenolic compounds are effective against Most vegetative bacterial cells.
Found in detergents, Lysol, work in the presence of organic material, and mycobacterium species.
An aromatic ring holding one or more hydroxyl groups is a characteristic of phenolic chemicals, which are characterized as plant-based substances. They are the most prevalent secondary metabolites of plants and are also the ones that are distributed the widest throughout the plant kingdom.
Simple compounds like arbutin, eugenol, hydroquinone, khellin, and myristicin are among them, as are more complicated ones like griseofulvin, podophyllotoxin, procyanidin, rotenone, tetrahydrocannabinol, and usnic acid.
In general, these substances help shield vegetables, fruits, and plants from oxidative damage. The widespread presence of phenolic compounds in plant foods and drinks and their contribution to the overall organoleptic qualities of plant foods explain why they are present in these products.
To know more about phenolic compound click here:
https://brainly.com/question/17616521
#SPJ4
Which part of the cytoskeleton anchors the plasma
membrane to the cytoplasm?
actin
secretory vesicles
O tubulin
microtubules
Answer:
Microtubules
Explanation:
Microtubules can potentially form a physical link between the plasma membrane.
Hello friens is a banana a vegetable
Answer:
I don't even know
Probably not because when you search up if it is a fruit or vegetable it shows up fruit
i would say no banana is not a vegetable
because it has seeds
How is a delta formed?
A. When the river deposits the load at the sour of the river
B. When the river deposits the load at the mouth of the river
C. When the river breaks through the walls of the river
D. When the water in the river stops moving
what is intersectionality?
Answer:
the interconnected nature of social categorizations such as race, class, and gender as they apply to a given individual or group, regarded as creating overlapping and interdependent systems of discrimination or disadvantage.
Explanation:
farmers use selective breeding to produce bean plants that have the best yields, eliminating breeds that are less profitable. which of the following could be a long-term effect of this selective breeding?
Farmers use selective breeding to produce bean plants that have the best yields, eliminating breeds that are less profitable.
Pick parents from a mixed population who exhibit these traits. They have interbred. Select the best progeny with the necessary traits to create the following generation. Continue doing this for several generations until all of your progeny posses the desired traits. Plant breeders can utilise self-pollination as a form of inbreeding to generate plants that are increasingly genetically similar and that, after many generations, produce identical offspring. Answer. Crop selection breeding has been used in agriculture for a very long time. Crops that yield more, stand better, or fight pests and disease more successfully may all be produced by simply breeding plants to combine desirable features.
To learn more about Farmers click the link below:
brainly.com/question/18390861
#SPJ4
HELP!!!
Which of the following statements is not true with regards to the Calvin Cycle?
a. Ribulose bisphosphate is regenerated by the end of one cycle.
b. Carbon fixation occurs when carbon dioxide is added into the ribulose bisphosphate molecule.
c. The reduction phase of the Calvin Cycle culminates with the production of glucose or sucrose.
d. NADPH and ATP produced by the light reactions are only used during the reduction and regeneration
phases of the Calvin Cycle.
All of the given statements are true about Calvin cycle:
Ribulose bisphosphate is regenerated by the end of one cycle.Carbon fixation occurs when carbon dioxide is added into the ribulose bisphosphate molecule.The reduction phase of the Calvin Cycle culminates with the production of glucose or sucrose.NADPH and ATP produced by the light reactions are only used during the reduction and regeneration phases of the Calvin Cycle.Calvin cycle is the first process of light-independent reactions where the inorganic carbon dioxide is trapped from environment to convert it into a stable organic molecule. There are three steps of Calvin cycle: carbon fixation, reduction and regeneration.
Reduction phase of the Calvin cycle is where the first stable organic product of the Calvin cycle undergoes reduction to form glyceraldehyde-3-phosphate (G3P).
To know more about Calvin cycle, here
brainly.com/question/3199721
#SPJ1
A loud alarm attached to a metal fence begins to ring. Student X has her ear against a pole of the fence while student Y stands away from the fence, as shown below. Both students are the same distance from the alarm. Which of the following statements explains what happens in this situation?
A. Student Y hears the alarm at a higher pitch because gases are denser than solids.
B. Student X hears the alarm at a higher pitch because solids are denser than gases.
C. Student Y hears the alarm first because sound travels faster in gases than in solids.
D. Student X hears the alarm first because sound travels faster in solids than in gases.
Student X hears the alarm first because sound travels faster in solids than in gases.
Speed of soundSound is a wave, as such, sound waves are able to travel across long distances. The speed of sound is greatest in solids since the gases have a high density owing to the fact that the molecules are closely packed.
Now, we can infer from this that student X hears the alarm first because sound travels faster in solids than in gases.
Learn more about speed of sound: https://brainly.com/question/15381147
what is the relationship between matter and atoms
Answer and Explanation:
Matter is defined as anything that has mass and volume. Atoms are the smallest unit of matter. This means that atoms are the building blocks of all other substances on Earth- both organic and inorganic.
what are osteoblasts and osteoclasts? Describe how these cells work together in a healthy person. What can occur if these processes are unbalanced?
Answer:
Osteoblast and osteoclast are the two main cells participating in those progresses (Matsuo and Irie, 2008). Osteoclasts are responsible for aged bone resorption and osteoblasts are responsible for new bone formation (Matsuoka et al., 2014). The resorption and formation is in stable at physiological conditions.Answer:
Osteoclasts are cells that dissolve bone and osteoblasts are cells that form new bones.The building up and breaking down of the bone tissue aids in strengthening bones. If bone destruction by osteoclasts happens faster than new bone tissue is built by osteoblasts, this can cause problems for a person.
When the product is odd, can either factor be even? How do you know?
Answer:
No.
Explanation:
Any number times an even number is even by definition.
Let's call the even factor 2n, and the other factor (odd or even) x. 2n × x = 2nx. Because it is multiplied by 2, it must still be even. The factors of an odd number are all odd.
Which of the following is MOST directly involved in the motility and intercellular signaling in T-cells: W) filamentous actin X) 200-nanometer myosin fibrils Y) cathepsin-myosin complexes Z) microvilli
Answer:
W) filamentous actin
Explanation:
T cells are a type of white blood cells (leukocytes) that play a fundamental role in the immune system by determining the specificity of the immune response to specific antigens. In T cells, the remodeling of the actin cytoskeleton is critical for the movement of these cells through different tissue environments and for adjusting their behavior during the scanning of antigen-presenting cells. The actin cytoskeleton acts as a physical platform for intracellular signaling events that occur at the immunological synapse formed between a T cell and an antigen-presenting cell, thereby contributing to T cell activation.
Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence “ccgg”. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA
In Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).
What are restriction enzymes?Restriction enzymes are specific enzymes that cut nucleotide strands in particular sites (in this case, CCGG).
These enzymes (restriction enzymes) can be used to digest a DNA sample and then identify different species by electrophoresis.
In conclusion, in Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).
Learn more about restriction enzymes here:
https://brainly.com/question/15278286
#SPJ1
The scientific name for the domestic cat is Felis catis. What part of this name is the Genus name? O Felis O catus O Canis O familiaris
How many Hydrogen atoms are in the chemical equation 3H20
a. 3 Hydrogen atoms
b. 2 Hydrogen atoms
c. 7 Hydrogen atoms
d. 6 Hydrogen atoms
Answer:
A. 3 Hydrogen atoms
Explanation:
Summarize the findings of other scientists in Germany and Boston that support the work of Calderon-Garciduenas
Calderón-Garcidueñas has conducted research on the impact of air pollution on the brain and cognitive function. Other scientists in Germany and Boston have also conducted studies that support her work and findings.
In Germany, a group of researchers conducted a study to investigate the effects of air pollution on brain structure and cognitive function in a large population of older adults. The study utilized neuroimaging techniques to assess brain volumes and cognitive tests to evaluate cognitive performance. The findings revealed a significant association between long-term exposure to air pollution and reduced brain volume in regions related to memory and learning. The study also found that higher levels of air pollution were associated with poorer cognitive performance in various domains.
In Boston, researchers focused on the impact of air pollution on children's brain development. They conducted a study involving a cohort of children and assessed their cognitive abilities using standardized tests. The study found that children exposed to higher levels of air pollution exhibited lower cognitive scores, particularly in areas related to attention, memory, and language skills. The researchers also observed structural changes in the brain, specifically in regions involved in cognitive control, in relation to air pollution exposure.
These studies from Germany and Boston provide additional evidence supporting Calderón-Garcidueñas' findings regarding the detrimental effects of air pollution on the brain and cognitive function. They reinforce the notion that long-term exposure to air pollution can lead to structural changes in the brain and have a negative impact on cognitive abilities. The collective findings highlight the importance of addressing air pollution as a public health concern and implementing measures to reduce pollution levels to safeguard brain health and cognitive development, particularly in vulnerable populations such as children and older adults.
for more questions on cognitive function
https://brainly.com/question/28541749
#SPJ8
Calculate the population density of 900 sheep in a plot of land that is 3.00 km by 2.00km
The population density of the 900 sheep in the given plot of land is 150 sheep per square kilometer.
The population density of 900 sheep in a plot of land that is 3.00 km by 2.00 km can be calculated by dividing the total number of sheep by the area of the land.
First, we need to calculate the area of the land. The area can be found by multiplying the length and width of the plot of land:
Area = length × width = 3.00 km × 2.00 km = 6.00 km²
Next, we divide the total number of sheep by the area to calculate the population density:
Population Density = Total number of sheep / Area = 900 sheep / 6.00 km²
Performing the calculation, we find:
Population Density = 150 sheep/km²
Therefore, the population density of the 900 sheep in the given plot of land is 150 sheep per square kilometer.
Population density is a measure of the number of individuals (in this case, sheep) per unit area. By dividing the total number of sheep by the area of the land, we obtain the population density in terms of sheep per square kilometer. In this case, the population density is 150 sheep/km², indicating that there are, on average, 150 sheep within each square kilometer of the land.
For more such answers on Population
https://brainly.com/question/29885712
#SPJ8
Question 2 (1 point) ✔ Saved
What is the best definition of the word "organism"?
something that has organs
someone who plays the organ
something that has multiple parts
something that is alive, having many parts that function as a whole
Question 3 (1 point
The phrase "organism" is best defined as something that is living and has numerous elements that work together as a whole.
What exactly constitutes a live organism?When an organism exhibits the many life processes in one form or another, it is regarded as living. The presence of life processes allows us to distinguish between living things and non-living things.
What does the term "organism" mean in terms of human anatomy?An organism is a living thing made up of cells that can carry out all necessary physiological functions on their own. The cooperation of the body's cells, tissues, organs, and organ systems helps multicellular creatures like humans maintain their life and health.
To know more about organism visit:-
https://brainly.com/question/13278945
#SPJ1
Can someone help me explain on how to do this
______ occurs because the nervous systems send messages to the muscles in the muscular system.
(I need someone to fill in this blank with the best possible answer, I’ll reward points + brainalist)
Answer:
action potentials
Explanation:
other possible answers:
electrical impulses
muscular contractions
action potentials is likely your best bet though
Explanation:
Neurons carry messages from the brain via the spinal cord. These messages are carried to the muscles which tell the muscle fibre to contract, which makes the muscles move.
what is the resting phase of the cell cycle called?
A. Prometaphase
B. Mitosis
C. Interphase
The resting phase of the cell cycle is called interphase.
Interphase is a critical stage in the cell cycle during which the cell prepares for division by going through different activities such as growth, DNA replication, and protein and organelle production. It is the longest phase of the cell cycle and is separated into three subphases: G1 (Gap 1), S (Synthesis), and G2 (Gap 2).
The cell develops in size, synthesises RNA and proteins, and performs its regular duties during the G1 phase. The cell enters the S phase after passing through the G1 checkpoint. The DNA of the cell is reproduced during the S phase, resulting in the production of two identical copies of each chromosome.
This ensures that during cell division, each daughter cell receives a complete set of genetic material. The cell enters the G2 phase after DNA replication, where it continues to expand and prepares for mitosis.
Interphase is not a real resting phase because the cell is actively engaged in multiple cellular functions. However, because the cell is not visibly dividing at this period, it is commonly referred to as the resting phase.
For more questions on interphase
https://brainly.com/question/30622117
#SPJ8
internal factors include
Which is not a function of the cell wall?
Answer:
I need answer choices so if you give me the options then I can answer
In what ways can biotechnology prevent and treat diseases?
Proteins are made in organelles called
A ribosome B Golgi bodies C DNA D Chloroplast
Answer:
A) Ribosomes
Explanation:
Proteins are made in the organelles called... RIBOSOMES.
Hope that helps
Answer:
A
Explanation: