Advances made in communications ,science ,medicine

Answers

Answer 1

Top 10 new medical technologies of 2019

Virtual reality. Precision medicine.  Health wearables.  Artificial organs. 3-D printing.  Wireless brain sensors.  Robotic surgery.  Smart inhalers. Inhalers are the main treatment option for asthma and if taken correctly, will be effective for 90% of patients.

Related Questions

a vassal under the feudal system owed his lord

Answers

Answer:

Under the feudal contract, the lord had the duty to provide the fief for his vassal, to protect him, and to do him justice in his court. In return, the lord had the right to demand the services attached to the fief (military, judicial, administrative) and a right to various “incomes” known as feudal incidents.

Explanation:

The U.S. goal of stopping the spread of Communism contributed to all of the following, except the: a. March on Washington. b. Bay of Pigs Invasion. c. creation of the Peace Corps. d. formation of the House Un-American Activities Committee.

Answers

Answer:

A. March on Washington

Explanation:

A. March on Washington ---> for civil rights NOT to stop communism

B. Bay of Pigs Invasion ---> to stop fidel castro and his communist government

C. Creation of the Peace Corps ---> originally President JFK thought it could be established to stop communism

D. formation of the House Un-American Activities Committee ---> investigating any suspected activities of communism in the us

Jesus sent John forth as an Apostle immediately.

True
False

Answers

Answer:

The answer is False.

Explanation:

This question is false

War of 1812, Democratic Party, suffrage, and Jacksonian Democracy. Your article should minimally answer the following questions:Describe Jackson's personal background: childhood, personality, career and militaryexperience. What role did Jackson play in The Battle of New Orleans?What role did he play in the acquisition of Florida? What happened during the 1824 election that led to Jackson's loss?What happened after Jackson's loss in 1824 that led to his win in the election 1828?Who (class/race/party) supported Jackson and why?

Answers

Andrew Jackson was born on March 15, 1767, in the Waxhaws region of South Carolina. He was the third son of Elizabeth and Andrew Jackson Sr. and the only one to survive infancy.

What is infancy?

Infancy is the period of time from birth to 18 months old. It is the earliest stage of childhood where babies begin to learn and develop their physical, social and emotional skills. During this time, infants learn to recognize and respond to the people around them, as well as learn basic motor skills such as crawling, rolling over and sitting up. They also begin to understand language, make eye contact and show emotions. During infancy, babies are learning and exploring their world through play, physical contact and other experiences. They are also developing the skills that will help them become independent as they grow.

To learn more about infancy

https://brainly.com/question/890436

#SPJ1

Which of the following does the constitution not do
A provide clear succession in case The president is unfit to serve
B acknowledge the right of Americans to drink alcohol
C provides everyone who lives in the US the right to vote

Answers

The function that the constitution does not do is option B. acknowledge the right of Americans to drink alcohol

Even though, there are Fundamental Human Rights in the constitution, there is no place in the constitution that expressly states that Americans have right to drink alcohol.

What constitutes the U.S.A Constitution?

The Constitution states the principal or major law of the U.S. federal government, establishing the three fundamental branches of the federal government and stating their jurisdictions. The Constitution has turned into the major legal document of the Western world, and is the oldest written national constitution currently in effect.

Therefore, the correct answer is as given above.

learn more about the U.S. constitution: https://brainly.com/question/453546

#SPJ1

Which of following is not an example of human geography​

Answers

Answer:

Human geography is the process where patterns and processes that builds up human interaction with the environment. This study is done by the geographers. it includes team of geographers examining the interactions between populations.

Explanation:

an example is like a geographer measuring the height of a mountain

hope this helps! :)

Which of the following was a Tax placed on the Colonists from 1763-17767
A. Capital Gains Tax
B. Excise Tax
C. Stamp Act Tax
D. Estate Tax ​

Answers

Answer: Stamp Act Tax

Explanation: It was passed in March 1765 and to be enacted on November 1

05.02 A Native Dilemma

Answers

Answer:

Number 1: Sir, please tell us what is happening here and why.

Explanation:

Response from this soldier: We were forcing the Native Americans to Indian territory and away from their old home. The main reason why we were doing this was that we wanted to mine in the territory for gold.

Answer:

is that the answer?

Explanation:

What led scientists during the Scientific Revolution to question the view of Ptolemy that the Earth is the center of the universe ?

The telescope provided proof that the Earth moves.

Christopher Columbus discovered that Earth is round.

The Church launched an Inquisition to attack heresies, or scientific falsehood.

Common sense based on human vision suggests that the Earth orbits the sun.

Answers

Christopher Columbus discovered that Earth is round led scientists during the Scientific Revolution to question the view of Ptolemy that the Earth is the center of the universe.

Who was Christopher Columbus?

Christopher Columbus was an Italian navigator and explorer who conducted four expeditions from across Atlantic Ocean, laying the stage for extensive European explorations of the Americas.

His journeys were the first European contacts with the Caribbean, Central America, and South America.

Thus, option B is correct.

For more information about Christopher Columbus, click here:

https://brainly.com/question/14408192

#SPJ1



How does the way in which the Mosuo people delegate power and trace their lineage

affect their residential patterns and practices?

Answers

The Mosuo people's practice of matrilineal inheritance and delegation of power to women leads to a household structure where women are the heads of households and men have limited involvement in domestic affairs.

The Mosuo people live in households headed by women, who are responsible for the family's economic and social well-being. Men contribute to the household by working outside the home and providing resources, but they have no decision-making power within the household.

This arrangement leads to a unique residential pattern where households are often comprised of several generations of women and their children.

Additionally, the Mosuo practice of walking marriage, where romantic partners live separately and come together for intimacy, further reinforces the independence of Mosuo women in their domestic lives.

For more questions like Mosuo click the link below:

https://brainly.com/question/20344872

#SPJ11

How does George Dewey relate to the Age of Imperialism?

Answers

Answer:

It relates to the age of imperialism because of his age was equal to it the age of both were 79 years

Explanation:

plz mark brainliest


This document was preferred by the Anti-Federalists to form the structure for the American government?
The Bill of Rights
The Constitution
The Articles of Conſjederation
The Anti-Federalist Papers

Answers

I believe the correct answer is, “The Articles of Confederation.”

Compare and contrast the depiction of interment camps by Ansel Adams, Dorothea Lange, and Toyo Miyatake.

Answers

Ansel Adams and Dorothea Lange both used their photography to document the lives of Japanese Americans living in internment camps during World War II. Adams' photographs focus on the landscape of the camps, the barrenness of the desert, and the conditions of the people living in the camps. Lange, on the other hand, focused more on the human aspect of the internment camp experience. Her photographs capture the despair and hopelessness of the people living in the camps, and her images reflect the emotional toll of living in such conditions.

In contrast, Toyo Miyatake was the only Japanese American photographer allowed to document the internment camps. His photographs focused on the humanity of the situation, rather than simply the physical conditions. He captured the everyday moments of life in the camps, showing people going about their daily routines and attempting to create a semblance of normalcy in a time of turmoil. Additionally, his photographs show the resilience of the people, as well as their determination to continue on in the face of adversity.

Amenemhet I's elevation of the minor god Amun to prominence:
Select one: a. contributed to greater unification of the kingdom and power for the pharaoh.
b. raised the standing of the merchant class, who had adopted Amun as their patron.
c. was criticized after several poor rainy seasons led to drought conditions.
d. angered the priestly class and caused a civil war that destroyed the Twelfth Dynasty.

Answers

Amenemhet I's elevation of the minor god Amun to prominence contributed to greater unification of the kingdom and power for the pharaoh. The correct option is A.

Amenemhet I was the first pharaoh of the Twelfth Dynasty. His reign was marked by a range of changes, including economic, political, and religious, among others. One of his key accomplishments was the elevation of the god Amun to a higher status.

Amenemhet I believed that by strengthening Amun's presence in the Egyptian pantheon, he could increase his own authority and power over the kingdom. The deification of Amun, which began during the Old Kingdom, was further bolstered during the Twelfth Dynasty, as pharaohs like Amenemhet I emphasized the god's role as the ruler of the universe.

To this end, they constructed temples and shrines devoted to Amun throughout the kingdom, and placed many of their key officials and advisers in charge of these institutions. By doing so, the pharaohs were able to create a tight-knit network of administrators and bureaucrats who were loyal to the royal court, and who could help enforce the pharaoh's edicts and policies throughout the kingdom.

Moreover, the prominence of Amun helped to unify the kingdom's religious traditions, making it easier for the pharaoh to rule over a diverse population with different beliefs and practices. the elevation of Amun was an important factor in the consolidation of pharaonic power during the Twelfth Dynasty.

For more such questions on pharaoh, click on:

https://brainly.com/question/28771700

#SPJ8

How did the British justify raising import taxes?
A- The British said the money was needed to repair bridges and roads in Great Britain
B- The British argued that they needed the money to fund more wars
C- The British argued it was to pay for the French and Indian War and for protecting the colonists
D- The British said the money would go towards infrastructure in the colonies

Answers

Answer:

C

Explanation:

They needed money to continue funding there army after the war to control America.

1. Before King George III was king, how
were laws decided in the colonies?

Answers

Answer: While the reigns of George I and II had been marked by a royal detachment from the administration of American colonies, King George III asserted his claim on the colonies strenuously. The king saw the relationship of Britain and America as that of a parent to a child. A disobedient child, of course, must be punished.

Imagine that you are a historian focused on imperialism. Your job is to submit a short article to a history magazine. You will address how imperialism affected a certain society. Select one society from the following list:
Burma
Kenya
Libya
Philippines
Vietnam


Research the society you chose. You may use books, articles, and websites. Use the following questions to guide your research:
Which imperial power colonized the region?
How did this colonization affect the society?
How did the colonization end or change?
Take notes that will help you write your article. Be sure to cite your sources of information. Include detailed information about each source, including title, author, and the URL address of any website.

Organize your notes from your research.
Write your short article. Your article should answer the following focus question in three paragraphs: “How did imperialism affect the society I chose?” Use information from your research to back up your explanation.

PLEASEEEEE

Answers

Imperial Power: Britain.

In Kenya, the imperialism resulted in the marginalization and dispossession of many indigenous communities.

How Did Imperialism Affect the Society of Kenya?

Colonialism in Kenya had a profound and lasting impact on the society as its reshaped its political, economic and social structures. Under British rule, which lasted from the late 19th century until Kenya gained independence in 1963, the society underwent significant changes.

Kenya's colonization brought about political transformations that led to the establishment of a centralized colonial administration. The British implemented a policy of indirect rule, relying on local African chiefs as intermediaries between the colonial government and the people. This system allowed the British to maintain control while also preserving elements of the existing social hierarchy.

Sources:

Branch, Daniel. "Defeating Mau Mau, Creating Kenya: Counterinsurgency, Civil War, and Decolonization." Cambridge University Press, 2009. [Link: https://www.cambridge.org/9780521897173].

Read more about imperialism

brainly.com/question/377688

#SPJ1

what are the challenges and issues facing south asia after its liberation from british in the contemporary era​

Answers

Answer:

South Asia, almost coterminous with historical India, continues to have many unhappy distinctions: mass poverty with its attendant evils of ignorance, ill health and technological backwardness, territorial disputes among the major states of India and Pakistan

Explanation:

Between what years did the Gross National Product (GNP) double in the United States?

- between 1940 and 1960

- between 1945 and 1960

- between 1956 and 1974

- between 1960 and 1980

Answers

Answer:

Between 1945 and 1960

Explanation:

edg

Between what years did the Gross National Product (GNP) double in the United States? - between 1940 and

Between 1945 and 1960, the Gross National Product (GNP) double in the United States. The correct option is 2.

Between 1945 and 1960, the United States' Gross National Product (GNP) doubled. This time is known as the post-World War II economic boom or the "Golden Age of Capitalism."

The conclusion of World War II saw a huge shift in the economy of the United States, as businesses dedicated towards war production switched to peacetime output.

This, combined with government policies and investments, technical improvements, and increasing consumer spending, spurred economic expansion and resulted in the GNP tripling over this time period.

Thus, the correct option is 2.

For more details regarding GNP, visit:

https://brainly.com/question/33097651

#SPJ5

Your question seems incomplete, the probable complete question is:

Between what years did the Gross National Product (GNP) double in the United States?

- between 1940 and 1960- between 1945 and 1960- between 1956 and 1974- between 1960 and 1980

The radius of ⊙ C ⊙C is 16 units long. Find the length of an arc that has a measure of 270. Round to the nearest hundredth.

Answers

The length of the arc is L = 75.36 units.

How to find the arc?

For a circle of radius R, the length of the arc defined by the angle θ is given by:

L = (θ/360°)*2pi*R

where pi = 3.14

Here we know that θ = 270° and the radius is equal to 16 units, replacing that in the length equation we will get:

L = (270°/360°)*2*3.14*(16 units) = 75.36 units.

If you want to learn more about circles, you can read:

https://brainly.com/question/25306774

During what decades did cinco de mayo celebrations became popular in the us?

Answers

Cinco de Mayo celebrations became popular in the US during the 1960s and 1970s.

During these decades, the Civil Rights Movement and the Chicano Movement were gaining momentum, and the holiday became a symbol of Mexican heritage and cultural pride for Mexican Americans. A popular misconception is that Cinco de Mayo is Mexico's Independence Day, but it is actually a holiday that commemorates the Mexican army's victory over the French at the Battle of Puebla on May 5, 1862.

While the holiday is not widely celebrated in Mexico, it has become a significant cultural event in the United States, particularly in areas with large Mexican American populations. Today, Cinco de Mayo celebrations in the US typically involve parades, music, dancing, and traditional foods such as tacos and margaritas.

For more about celebrations:

https://brainly.com/question/32044614

#SPJ11

In comparing Alexander Graham Bell to Robert Weitbrecht, we can see- A-how perceptions of the Deaf community have changed over time B-how scientific inventions have impacted the Deaf community C-the challenges faced by the Deaf community in recent years D-the support that scientists have given to the Deaf community

Answers

Answer:

D-the support that scientists have given to the Deaf community

Explanation:

While Alexander Graham Bell's invention of the telephone favors the non-deaf people around the world, however, according to Bell, the invention of the telephone came out from the need to make the deaf see what they couldn't hear. Thus, the telephone by Bell was originally in design intended for the deaf.

On the other hand, Robert Weitbrecht's invention of the Teletypewriter was also an invention designed purposely for the deaf, in order to let the deaf communicate messages over a long distance through telephone lines.

Hence, In comparing Alexander Graham Bell to Robert Weitbrecht, we can see "the support that scientists have given to the Deaf community."

Answer:

A. how perceptions of the Deaf community have changed over time

Explanation:

Took the test and answered it correctly.

during the Cold War , how were the policy of containment and the domino theory related

Answers

The Unites States felt that if communism can’t be contained then countries near communistic countries would fall for communism like dominoes. To combat this the US used economic and militaristic measures to prevent the spread of communism.

Answer: The United States thought that if Communism could not be contained, then countries would fall to Communism like dominoes.

Explanation:

During Reconstruction, the passage of the Thirteenth Amendment

Answers

The Thirteenth Amendment—passed by the Senate on April 8, 1864; by the House on January 31, 1865; and ratified by the states on December 6, 1865—abolished slavery “within the United States, or any place subject to their jurisdiction.” Congress required former Confederate states to ratify the Thirteenth Amendment

Someone plz help me :(

Someone plz help me :(

Answers

Answer:

Farming and cultivating the land.

Other then land, what other resources did the United States

Answers

Apart from land, the United States possesses resources like water, minerals, forests, fossil fuels, and agricultural produce.

In addition to its vast land area, the United States is rich in various natural resources. Water resources are abundant, including rivers, lakes, and groundwater sources, which are crucial for agriculture, industry, and daily life.

The country also boasts extensive mineral deposits, such as coal, iron ore, copper, and rare earth elements, which contribute to industrial development.

Forests cover a significant portion of the US, providing timber and supporting biodiversity. Fossil fuels, like oil and natural gas, are essential for energy production. Furthermore, fertile soil and favorable climate conditions enable diverse agricultural production across the nation.

For more such questions on agricultural, click on:

https://brainly.com/question/29782570

#SPJ11

what music was popular from 1897 to 1918

Answers

During the late 19th and early 20th century, music experienced a significant shift in style and popularity. The most popular music genres during this period included ragtime, early jazz, and classical music.

Ragtime, which was characterized by its syncopated rhythms and lively melodies, gained popularity in the late 1890s and continued to be popular until the early 1910s.

Around the turn of the century, jazz began to emerge as a distinct musical genre, blending elements of ragtime, blues, and African-American folk music. The earliest forms of jazz were played in New Orleans and other Southern cities, eventually spreading throughout the United States and Europe.

Jazz became a significant force in popular music, influencing other genres and spawning sub-genres such as swing and bebop.

Classical music continued to be popular during this time period, with many famous composers and performers achieving great success. Operas, symphonies, and other large-scale works were popular among the upper classes, while more accessible music such as waltzes and polkas were enjoyed by the masses.

In conclusion, from 1897 to 1918, ragtime, jazz, and classical music were the most popular genres of music. These styles continue to influence and shape modern music to this day.

For more such questions on music genres visit:

https://brainly.com/question/29685769

#SPJ11

Why did many immigrants leave their countries and move to the United States in the mid-1800s?

a.They faced poverty and oppression in their old country.

b.They feared Napoleon's armies would conquer their country.

c.Factory jobs were less profitable in the U.S.

d.Americans welcomed all people regardless of where they were from.

Answers

Answer:

they faced poverty and oppression in their old country

How is a period different from an era?

Answers

Answer: A period is a large interval of time with a definite characteristic while an era is a long period of time marking the start and end of an important event

Explanation:

for most americans, the new immigrants of the late nineteenth century ________.

Answers

For most americans, the new immigrants of the late nineteenth century, were seen as threats to the future of society.

This has caused sweeping changes in all segments of the American society. A bunch of people from rural America also migrated to the cities between 1880 and 1890, almost 40 percent of the townships in the migrated in the form of trolleys, cable cars, and subways.

Noise, traffic jams, slums, air pollution, and sanitation and health problems became common place. For all the problems, and there were many cities that promoted a special bond between people and laid the foundation for the multi-ethnic, multi-cultural society that is cherished even today.

Read more about Americans in nineteenth century,

https://brainly.com/question/21530675

For most Americans, the new immigrants of the late nineteenth century were seen as a threat to their way of life.

Many of these immigrants came from Southern and Eastern Europe, and were perceived as different from previous waves of immigrants who had come primarily from Western and Northern Europe. This led to a rise in nativism, with many Americans fearing that these newcomers would take their jobs, strain social services, and spread disease. Anti-immigrant sentiment was fueled by politicians and the media, who painted a negative picture of these new arrivals. However, despite facing discrimination and prejudice, many of these immigrants went on to make significant contributions to American society.

To know more about immigrants visit:

https://brainly.com/question/13688875

#SPJ11

Other Questions
In libraries, do they put the bible in the fiction or non-fiction section? Find the current in an LRC series circuit at t = 0.01s when L = 0.2H, R = 80, C = 12.5 x 10-F, E(t) = 100sin10tV, q(0) = 5C, and i(0) = 0A. Q.2 Verify that u = sinkctcoskx satisfies a2u/at2=c2 a2u/ax2 6 - Tu familia Open ended Activity LATE DUE May 3rd 11:59 PM Instructions Imagine that these people are your relatives. Choose one and write several sentences about that person. First, say where the person is located in the photo. Include this information: name, relationship to you, profession, age, and place of origin. Describe the person and his or her activities using the adjectives and verbs you have learned. How to create boxplots based on two factor data in R. one evening as tara is walking home from her yoga class, she notices a group of 20 people standing and staring up at the sky. curious, she joins the group and sees a person on the roof of a 30-story building seemingly preparing to jump. suddenly, someone in the crowd starts chanting "jump." soon the other people start chanting as well, including tara. this is not something tara would normally do. taras behavior is most likely the result of . (b) What combination of independent variables led to the highest predation level in enclosures with dark-colored soil? Which of the following is not part of the cell theory? (4 points) a Every living thing is composed of cells. b Cells come from pre-existing cells. c Cells are the basic unit and structure of all living things. d Every cell has a nucleus that contains genetic material. 10 points4. Which equation represents the correct unit rate (slope) for thefollowing: Hint..get y by itself in the following equation.*Cost of blueberries:2y = 5.76xWhere y=cost andx=poundsOy=2.75xOy=2.88xOy=2.92%Oy-2.41x Affirmative- entenderentiendeentiendes entiendaentiendas Some people say that city squirrels are more aggressive than squirrels in the countryside. In the city, squirrels come right up to people to take food from their hands, for example. In the country, squirrels are more likely to run away from people. How could you evaluate the claim that squirrels level of aggressiveness is:(1) different in the city from the country, and (2) inherited, not learned. help me guysssssss help plsss Pleural Sacs:What's the relationship/function of the pleural sacs andrespiration? Or the relationship between the lungs themselves andthe pleural sacs? I've been looking online but what I'm findin help and not just guess i need someone who actually knowz If decomposers usually grow faster and decompose material more quickly in warmer ecosystems, why is decomposition in hot deserts so slow? A population of N = 6 scores has X = 12 and X2 = 54. What is the value of SS for this population? Select one: a. 54 b. 5 c. 30 d. 9 1. Given the double-stranded stretch of DNA below, determine the base sequence ofmessenger RNA strand produced using this gene as the template. *Hint: Only one of thetwo strands is used as the template.5'ATGCCATTGCTTAAGCGGGCATTATATCCAAGA 3'3' TACGGTAACG AATTCGCCCGTAAT ATGGTACT 5AUGCCAUUGCUU AAG-CGG-GCAULAUAU CCA UGAHow many amino acids will this protein contain? Which expression is equivalent to one fifth times the quantity 3 times x plus 10 end quantity minus 11 over 15 times x? negative two fifteenths times x minus two two fifteenths times x minus two negative two over fifteen times x plus two one and one third times x plus two How many countries are in NAFTA 2022? How many assets are included within each of the two main categories of the developmental asset framework? Mary is 50 years old and has entered menopause. During a checkup, a bone scan reveals the beginnings of osteoporosis. Her physician suggests hormone therapy. What hormone might she prescribe for mary?.