According to the text, the domestic environment is all of the uncontrollable forces originating in the home country that surround and influence the firm's life and development. T/F

Answers

Answer 1

True.The domestic environment refers to the uncontrollable forces that originate within the home country and have an impact on a firm's operations and growth.

These forces can include economic conditions, political and legal factors, cultural norms, technological advancements, and competitive landscape, among others. The domestic environment is characterized by factors that are beyond the firm's control but significantly influence its strategies and performance. By understanding and adapting to the domestic environment, firms can better navigate the challenges and leverage the opportunities presented by their home country.

Learn more about the domestic environment  here:

https://brainly.com/question/28428112

#SPJ11


Related Questions

Bert's company is about to release a new electronics product. the electronics product is estimated to have a short life cycle before it is replaced by an upgraded one. the company would like to recover the capital spent to produce the product. it therefore decides to charge the highest possible price for the product upon release. bert's firm recognizes this might provide an advantage to competitors who may release the product at a lower price, but it believes customers will feel that the higher price signals higher quality.
what type of pricing objective has bert's firm adopted?cash flow

Answers

The type of pricing objective has Bert's firm adopted cash flow.

Which of the following is a reason for a corporation to increase the price of a product?

Companies occasionally increase their prices to reflect rising costs. To cover any further cost increases, they may generally raise the prices by a larger amount than the cost increases. A seller may raise the price of their goods if there is a greater demand than there is for that thing.

Which of the following pricing techniques is most likely to cause a retailer to lose money on the item?

In an effort to boost sales of other goods, it is offered at a discount to cost. Pricing for special events and price leaders.

What appeals to cellars about a high-low pricing strategy?

Because it draws buyers from two different market segments—those who are not price sensitive and are prepared to pay the "high" price and those who are more sensitive to price and wait for the "low" sale price—a high/low strategy is appealing.

To Know more about cash flow.

https://brainly.com/question/29768594

#SPJ4

consider service processes. they usually have a) output that can be inventoried.b) physical, durable output.c) shorter response times.d) low levels of customer contact.

Answers

In the context of service processes, the statement "they usually have" suggests that we are discussing general characteristics or trends rather than absolute rules. Option B is the correct answer.

Output that can be inventoried: Service processes typically do not have inventoryable outputs. Unlike manufacturing processes that produce physical goods, services are intangible and typically consumed at the same time they are produced. For example, a haircut, a consultation, or a software installation are services that cannot be stored or inventoried.

Physical, durable output: Service processes generally do not produce physical, durable outputs. Services are often based on interactions, experiences, or knowledge transfer between the service provider and the customer. The output of a service process is often intangible and non-physical, such as advice, expertise, or assistance. Option B is the correct answer.

For such more question on service:

https://brainly.com/question/31628374

#SPJ8

WILL GIVE BRAINLY!!!!!!!!

A shift in demand may occur within a community in all of the following cases, except a change in __________.

A. birthrate
B. immigration
C. political leadership
D. age demographic

Answers

Answer:

C. political leadership

Explanation:

A shift in the demand curve occurs in many cases except for a change in political leadership.

What do you mean by demand?

Demand refers to the ability, or willingness to buy a product, goods, or services.

A change in birthrate, immigration, and age demographic are the reasons for shifting in demand but a change in political leadership does not affect the demand.

Therefore, C is the correct option.

Learn more about Demand here:

https://brainly.com/question/13334895

A stylist charges $20.00 per haircut. The total cost for running her home-based business is $4,000.00 per month, which includes her salary of $3,000.00 per month. To cover all these expenses and her salary, she must do a minimum of 200 haircuts per month.

Because the cost of living has gone up, she wants to increase her salary to $3,500, making her total monthly expenses $4,500.00

What is the minimum price she must charge for each of the 200 haircuts so she can cover this increased salary?

Do not forget to type the $ symbol when you enter your answer as shown below:

Example: $15.77

Hint: Your answer will have decimal point.

Answers

Answer:$22.50

Explanation: I took the quiz and got it right

An exception occurred while processing your request. additionally, another exception occurred while executing the custom error page for the first exception. the request has been terminated.

Answers

After the necessary troubleshoot of adding the web-config transformation file, they can also proceed to publish options to have debugging enabled or disable.

What is the problem about?

In web design, the problem is often occurring when the webmaster is trying to publish an website as an web-role.

However, after the necessary troubleshoot of adding the web-config transformation file, they can also proceed to publish options to have debugging enabled or disable.

Read more about custom error page

brainly.com/question/25613341

#SPJ1

Write donw the types of savings accounts.

Answers

There are several types of savings accounts available, including traditional savings accounts, money market accounts, certificates of deposit (CDs), high-yield savings accounts, and health savings accounts (HSAs).

Savings accounts are a great way to save money securely and reliably. They not only provide you with high-interest rates on your deposits but also allow you to withdraw your money whenever you want without any penalties.

Some of the types of savings accounts are:

1. Regular Savings Account: This type of savings account is offered by most banks and financial institutions. It usually has lower interest rates than other types of savings accounts, but has no minimum balance requirement and allows you to withdraw your money anytime without any penalty.

2. Certificate of Deposit (CD) Account: A CD account is a type of savings account that requires you to deposit your money for a specific period. It generally offers higher interest rates than regular savings accounts.

3. Health Savings Account (HSA): An HSA is a type of savings account that is designed to help you save for medical expenses. They offer tax benefits and may offer higher interest rates than regular savings accounts.

Learn more about savings accounts at https://brainly.com/question/30101466

#SPJ11

"Suppose that the video game company Ultravision releases a new game called "Call of Obligation: Modern Combat 3." This can be analyzed using tools from both microeconomics and macroeconomics. Classify the items according to whether they are an application in microeconomics or macroeconomics."

Answers

Answer:

Microeconomics

How much will Ultravision charge for "Call of Obligation?"

Is Ultravision able to sell all of the "Call of Obligation" games it produces or do they need to produce more?

How does Ultravision choose to market "Call of Obligation?"

How much will Ultravision pay the developers of the game?

Macroeconomics

Has the country's unemployment rate changed as Ultravision  hired a huge team of workers to develop the game?

Have the millions of dollars that people have spent on video games worldwide affected the Gross Domestic Product (GDP) in their respective countries?

How much less economic output occurs countywide because workers call in sick to stay home and play either "Call of Obligation" or another video game?

Explanation:

Microeconomics refers to the study of the events resulting from responses of individuals to changes in motivation, prices, measures to produce and methods of production.

Macroeconomics

Macroeconomics is the subdivision of economics that is concerned with the functioning and organizational structure, characteristics, behavior and the selection processes and making decision with regards to the entire economy.

Suzie Smith is a real estate sales associate. She is a top producer and likes to maintain her independence. She sets up her office in her home, independent of the broker. She maintains her own telephone, secretary, administrative assistant and cell phone. She communicates with her broker once a week or he comes to see her at her office. Is this a workable situation?

Answers

Answer:

No

Explanation:

Suzie's situation isn't workable because she is meant to be under the direct supervision of her broker no matter what her personal preference for independence.  

This is because should anything go wrong in any of her dealings, the brokers's license will be revoked. This means that the broker is directly responsible and accountable for her actions and as such must ensure that she is present at the office at all times.

Cheers.

Elasticity is the measure of how producers and consumers react to changes in
A supply is
A supply is
when the quantity of a good supplied does not change as the price changes.
when the quantity of a good supplied increases or decreases as the price changes.

Answers

Price
Inelastic
Elastic

The main requirement for a trademark is distinctiveness. True False. it is actually TRUE. ignore what other people tell you.I got it wrong and the people saying false is wrong.​

Answers

Answer:

Yes, it is True but what exactly is the question? I will edit this once you comment and tell me. If you don't have a question, feel free to delete this.

Explanation:

Answer:

True

Explanation:

The main requirement for a trademark is distinctiveness. True False. it is actually TRUE. ignore what

ENGLISH

Read the passage given below

The choices we make on a daily basis-wearing a seatbelt, lifting heavy objects correctly or purposely staying out of any dangerous situation can either ensure our safety or bring about potentially harmful
circumstances. You and I need to make a decision that we are going to get our lives in order Exercising self-control, self-discipline and establishing boundaries and borders in our lives are some
of the most important things we can do. A life without discipline is one that's filled with carelessness.
We can think it's kind of exciting to live life on the edge. We like the image of "Yeah! That's me! Living on the edge! Woo-hoo!" It's become a popular way to look at life. But if you see, even highways have lines, which provide margins for our safety while we're driving. If we go over one side, we'll go into the ditch. If we cross over the line in the middle, we could get killed. And we like those lines because they help to keep us safe. Sometimes we don't even realize how lines help to keep us safe.
I'm not proud of this, but for the first 20 years of my life at work, I ignored my limits. I felt horrible, physically, most of the time. I used to tell myself "I know I have limits and that I've reached them, but I'm going to ignore them and see if or how long I can get by with it." I ran to doctors, trying to make myself feel better through pills, vitamins, natural stuff and anything I could get my hands on. Some of the doctors would tell me, "It's just stress." That just made me mad. I thought stress meant you don't like what you do or can't handle life, and I love what I do. But I kept pushing myself, travelling, doing speaking engagements and so on-simply exhausting myself. Finally, I understood I was living an unsustainable life and needed to make some changes in my outlook and lifestyle. You and I don't have to be like everyone else or keep up with anyone else.
Each of us needs to be exactly the way we are, and we don't have to apologize for it. We're not all alike and we need to find a comfort zone in which we can enjoy our lives instead of making ourselves sick with an overload of stress and pressure.

i. The reason why living on the edge has become popular, is because of the
a) constant need for something different.
b) population being much younger.
c) exhausting effort to make changes.
d) strong tendency to stay within our limits

ii. Choose the option that best captures the central idea of the passage from the given quotes.
a) It is all about quality of life and finding a happy balance between work and friends.
b) to go beyond is as wrong as to fall short
c) life is like riding a bicycle. To keep your balance you must keep moving.
d) balance is not something you find, it is something you create.

iii. Which of the characteristics are apt about the writer in the following context: "I know I have
limits and that I've reached them, but I'm going to ignore them and see if or how long I can get by
with it."?
1) negligent 2) indecisive
3) spontaneous
4) reckless 5) purposeless 6) patient
a) 2 and 5
c) 1 and 4
b) 3 and 6
d) 2 and 3

iv. Which of the following will be the most appropriate title for the passage?
a) Much too soon
b) Enough is enough
c) How much is too much? d) Have enough to do?

v. The phrase "potentially harmful circumstances” refers to circumstances that can
a) certainly be dangerous. b) be fairly dangerous.
c) be possibly dangerous. d) seldom be dangerous

vi. Select the option that makes the correct use of “unsustainable", as used in the passage, to fill in
the blank space.
a) In the long run, the_______officials followed emergency procedures.
b) Emergency procedures were _______ by the officials.
c) Officials reported a set of _______ events during the emergency.
d) Officials admit that the emergency system is __________ in the longer run.

vii. The author attempts to the readers through this write-up.
a) rebuke
b) question c) offer aid to d) offer advice to

viii. The author uses colloquial words such as "yeah" and "Woohoo!". Which of the following is
NOT a colloquial word?
a) hooked
b) guy
c) stuff
d) stress

ix. What does the author mean when he says, "to get our lives in order"?
a) To resume our lives.
b) To organize our lives.
c) To rebuild our lives.
d) To control our lives.

x. Choose the option that correctly states the two meanings of 'outlook', as used in
the passage.
a) A person's evaluation of life
b) A person's experiences in life
c) A person's point of view towards life d) A person's regrets in life
e) A person's general attitude to life

xi. The author explains the importance of discipline and boundaries in our lives
using the example of
a) road accidents.
b) traffic rules.
c) lines on the highway.
d) safe driving.

xii. What is the message conveyed in the last paragraph of the passage?
a) Love what you do.
b) Love yourself to love others.
c) Be the best version of yourself. d) Be yourself.​

Answers

Answer:

mother trucker u suppose to put one answer

Answer:

if ur gonna put 90234982304 questions and a passage maybe give more than 5pts lol

Explanation:


Why is it important for a human resource manager to carefully maintain
employee records?

Answers

Answer:

Certain records require employee privacy to be protected. Not maintaining and following best practices for employee record keeping leaves you vulnerable to defending yourself against lawsuits, labor investigations or audits.

Explanation:

Owners of florida homesteads can deduct $50,000 of the assessed value for properties valued at more than __________.

Answers

Explanation:

Yeuwjee728228282jsjnsnsns

BTW

Use this with "kind."
True
False

Answers

That makes no since ..

Answer:

??? what do you mean? please be more elaborate

mike started a calendar-year business on september 1st of this year by paying 12 months of rent on his shop at $700 per month. what is the maximum amount of rent that mike can deduct this year under each type of accounting method?

Answers

The maximum amount of rent that Mike can deduct this year depends on the accounting method he is using. That is $ 2800 under the cash method and $ 8400 under the accrual method.

If Mike is using the cash method of accounting, he can deduct the rent payments that he actually paid during the tax year. Since he started the business on September 1st, he would have paid rent for the months of September, October, November, and December, a total of 4 months. Therefore, the maximum amount of rent that he can deduct this year is $700 x 4 = $2800.

If Mike is using the accrual method of accounting, he can deduct rent payments for the period that he is entitled to the use of the property, regardless of when he paid the rent. Since he started the business on September 1st and paid 12 months of rent in advance, he is entitled to use the property for the entire year. Therefore, the maximum amount of rent that he can deduct this year is $700 x 12 = $8400.

It's important to note that if Mike elected to use the cash method of accounting, he must stick with it for at least the first year of business and for future years unless he receives the IRS approval to change it.

To know more about accounting methods visit:

https://brainly.com/question/13610125

#SPJ4

Explain the difference between a job interview and a interview

Answers

Answer:

An interview is a procedure designed to obtain information from a person through oral responses to oral inquiries. An interview is the way of face to face conversation between the interviewer and the interviewee, where the interviewer seeks replies from the interviewee for choosing a potential human resource.

Explanation:

Commercial hotels are usually in downtown or _____________ districts.

Answers

The answer is Business Districts

Answer:

buisness

Explanation:

what is the approximate interest paid in year 2 for this loan information, $328,000 for 15 years at 5ased on annual information?

Answers

To calculate the approximate interest paid in year 2 for a loan of $\(328,000\) for 15 years at \(5\)% annual interest rate. The approximate interest paid in year 2 for this loan information is $\(15,603.19.\) We can use the formula:

Interest payment = Beginning balance x Annual Interest rate; where the beginning balance is the outstanding principal amount at the beginning of the year.

In year 1, the beginning balance will be $\(328,000\), and the interest payment will be: Interest payment in year 1 = $\(328,000\)x \(0.05\) = $\(16,400\)

To calculate the interest payment in year 2, we need to first calculate the ending balance of year 1, which is the beginning balance minus the principal payment made during the year. Assuming the loan is paid in equal monthly installments, the principal payment in year 1 can be calculated as:

Principal payment in year 1 = Total annual payment - Interest payment in year 1

The total annual payment can be calculated using the formula for a level payment loan, which is:

Total annual payment = \(P x (r / (1 - (1 + r)^(-n)))\)

where P is the loan amount, r is the annual interest rate, and n is the number of years.

Plugging in the values, we get:

Total annual payment = $\(328,000\)x \((0.05 / (1 - (1 + 0.05)^(-15)))\)

Total annual payment = $\(32,336.13\)

Therefore, the principal payment in year 1 will be:

Principal payment in year 1 = $\(32,336.13\) - $\(16,400\) = $\(15,936.13\)

The ending balance of year 1 will be:

Ending balance of year 1 = Beginning balance - Principal payment in year 1

Ending balance of year 1 = $\(328,000\) - $\(15,936.13\) = $\(312,063.87.\) Now we can calculate the interest payment in year 2:

Interest payment in year 2 = $\(312,063.87\) x \(0.05\)= $\(15,603.19\)

To learn more about annual interest rate, visit here

https://brainly.com/question/30573341

#SPJ4

craig would like to participate in a tender offer for mno inc. and currently holds a net short position in mno shares. craig

Answers

Participating in a tender offer involves submitting shares to the offering party, typically at a specified price, in exchange for a cash payment or other consideration.

Given Craig's net short position, he has a financial interest in the price of MNO Inc. shares decreasing.

Participating in a tender offer could potentially result in a significant loss for Craig if the offer price is higher than the current market price, as he would be obligated to buy shares at the tender offer price and cover his short position.

To assess the potential impact on Craig's position, he needs to consider the tender offer price and compare it to the current market price of MNO Inc. shares.

If the tender offer price is lower than the current market price, it could be advantageous for Craig to participate in the tender offer and close his short position at a lower cost.

In conclusion, Craig should carefully evaluate the tender offer price and the market conditions before deciding whether to participate. It is essential for him to consider the potential financial implications and the impact on his net short position in MNO Inc. shares.

To learn more about shares, visit    

https://brainly.com/question/30350839

#SPJ11

To file your federal and state taxes you ____________?
a)must prepare different forms for each type of government (if your state requires it)
b)can use tax preparation software for federal taxes, but can't for state taxes
c)must prepare the same tax forms for both
d)can use tax preparation software for state taxes, but can't for federal taxes

Answers

Answer:

a)must prepare different forms for each type of government (if your state requires it)

Explanation:

Federal is the same for everyone, state is dependent for which state you live and work in. B and C are wrong because you can use tax preparation software for both Federal and state.

To file your federal and state taxes you should: a. prepare different forms for each type of government (if your state requires it)

Recall:

Preparing of tax returns for federal and states is done using different forms as it applies to your state.There are tax preparation software that can be used whether federal or state tax. Examples of tax preparation software are Credit Karma Tax, Jackson Hewitt, TaxSlayer, among others.

Therefore, to file your federal and state taxes you should: a. prepare different forms for each type of government (if your state requires it)

Learn more about federal and state taxes on:

https://brainly.com/question/1304076

If deferred tax assets are expected to not be reversed, it should be treated as:________

Answers

If deferred tax assets are expected to not be reversed, they should be treated as Equity.

What is Equity?

Equity in the context of finance refers to ownership of assets with potential obligations such as debts.

For accounting purposes, equity is calculated by deducting liabilities from the value of the assets.

The difference of $14,000, for instance, is equity if a person owns a car worth $24,000 and owes $10,000 on the loan used to purchase the vehicle.

A single asset, like a car or house, or an entire company may be covered by equity. A company that needs to launch or grow its operations can sell equity to raise money that doesn't need to be repaid on a predetermined timeline.

To learn more about Equity, refer to:

https://brainly.com/question/13278063

#SPJ4

When does the finance charge begin to accrue on the credit card from the local department store

Answers

The finance charge on a credit card from a local department store will typically begin to accrue on the day that the balance is incurred. This means that if you make a purchase on your credit card, the finance charge will begin accruing on that day, regardless of when the bill is due.

Please note that some credit card companies may have different policies regarding when loan fees start. For example, some credit card companies may offer a grace period, which is a period of no loan fees, usually beginning on the billing date, as long as the balance is paid in full by the due date. Therefore, it is important to check your credit card's terms and conditions or contact customer service for the exact conditions under which a particular credit card will accrue financing fees.

Learn more about finance charge herehttps://brainly.com/question/22717601

#SPJ4

How do you feel about the pandemic? Vaccinations? Masks?

Answers

Answer: Pandemic: awful. Vaccine: useful; get it. Masks: not really required, your still breathing your air, just through tiny gaps in fabric.

Explanation:

just my opinion.

1. pandemic-it’s annoying 2. Vaccines- very helpful for the pandemic 3. Masks- just a little annoying but I’m used to it

Which will help you when you file a claim for home insurance?
A home loan
B.
home budget
c.
home inventory

Answers

Answer:

home inventory

Explanation:

C home inventory jjjjjjjj

Analyse, one way a country is likely to
benefit from the expansion of its
business
enterprises.

Answers

Answer:

earning of foreign and upliftment of the host country.

Explanation:

as a bussiness expands into other countries the profits it makes if it becomes successful are retained back to the host country as retained profits and this changes the economy as government earns part pf the revunue due to the tax earnings

Two Cournot duopolists compete in a market with inverse demand given by p = 190.00 – 2Q. where p is the per-unit price, q, is the output for firmi (either form 1 or firm 2), and Q = q1 +q2. Firm 1 has a cost function of c1(q1) = 2q^2 and firm 2 has a cost function of c2(q2) = 3q2. Assume no fixed costs. What is the optimal output for firm 1? What is the optimal output for firm 2?

Answers

10 units is the ideal production for firm 1, and 6.667 units is the ideal output for firm 2.

What is the company's ideal output?

According to the firm's optimal output rule, a firm's profit is maximised by generating as much output as possible at a price where the last unit's marginal cost is equal to the market price.

What is the recipe for the best possible profit?

According to the formula profit = Total revenue - Total expense, profit is determined. When the first order, MR = MC, and the second order are dependent on the first order, a corporation maximises profit. Regarding the time frame for making a profit and the objectives of the company, this idea contrasts from wealth maximisation.

To know more about production  visit:-

https://brainly.com/question/22852400

#SPJ1

what is the factored form of x^2-11x+24=0

Answers

Answer:

(x - 8)(x - 3) = 0

Explanation:

Use the AC method, multiplying the a by c, or the coefficient of x (which is 1) and the last term, 24.

1 x 24 = 24

Now list factors of 24:

1 x 24

-1 x -24
2 x 12
-2 x -12
3 x 8
-3 x -8
4 x 6
-4 x -6

Which of these factor's sums would equal -11 (the middle term)?

-3 + (-8) = -11

So replace -11x with -3 and -8:
x^2 - 3x - 8x + 24 = 0

Now factor by separating into two groups:
x^2 -3x and -8x + 24

GCF between x^2 and -3x is x. So factor x out.
x(x - 3)

GCF between -8x and 24 is 8. So factor 8 out.
-8(x - 3)

Now we have x(x - 3) - 8(x - 3)

(x - 8)(x - 3)

Create a job application including a cover letter and a resume. Make certain you have included your work and volunteer experience, education, and "selling points." Compare your resume to the job descriptions and respond to each of the questions asked. This should be a one- to two-page response thoroughly examining each question—this will prepare you for when you do apply for a job (if you have not already).

After reviewing the functions of human resource management identified early in the lesson, answer the following questions:

Identify the person from human resources whom you might engage. If it’s a small business, who do you think would be your contact?
Assume you were hired. What would human resources do for you as an employee? Discuss what benefits HR would offer and how, you believe, this would happen if you were to be employed in this position.

Answers

In a cover letter, you introduce yourself to potential employers and request that they consider your application. The letter is brief, often 3 to 5 paragraphs long.

What is Management?

Management is the art of getting things done through and with the people in formally organized groups.

An efficient resume summary uses the following structure: Professional title (if applicable) with significant work history, plus top accomplishments (preferably measurable results) + Top Knowledge, Experience, and Values (relevant to the job and industry)

Reduce the length of cover letters to three to four paragraphs, not exceeding one page. Use an active voice while maintaining a confident, commercial enterprise-like tone. Don't start too many phrases with "I." Check for repetition and errors by reading your cover letter out loud.

Therefore, This is how you can create a job application including a cover letter and a resume.

Learn more about Management, here;

https://brainly.com/question/14523862

#SPJ1

Uno dos one two e r
Chicken nuggets.

Answers

Answer:

i swim in points

Explanation:

bonqueque

Answer:

Explanation:

Uno dos one two e rChicken nuggets.

QUESTION 2 of 10: Your company offers continuous online training. If each online lesson is 20 minutes long, and there are 90 lessons, how
many hours will each employee complete to finish all the lessons?
a) 33
b) 1.5
c) 30
d) 90
Submit
Pricing & Sales

Answers

Answer:

c) 30

Explanation:

One online lesson takes 20 mins.

There are 90 lessons.

The total time required to complete the 90 lessons will be

=20Mins x 90 lessons

=1800 mins

In hours = 1800/60

=30 hrs

Other Questions
Triangle PQR has vertices P(3, 5), Q(-2, 6) and R(8, -1). Give the translation rule (x, y) (x + 4, y 5). What will Q (__, __) be a) The relationship between demand x and price p for an item is given by x(p) = 13500.5p^2. For which price is the price elasticity of demand equal to -1?b) The inverse function of x (p), then Which of the following nucleic acid complexes would undergo correction by the DNA mismatch repair system? UAGUCUUACAUUCCAUAUGG 3' (6%) Antisense 3' _ ATCAGAATGTAAGGTATACC-5' B. GTGCCCACGATTCAGTGGGC 3' (2%) Antisense 3' CACGGGTGCTAAGTCACCCG-5' GCGCCACGATTTAACGTGGC (62%) Anlisense 3' CGCGGTGCTAAGTTGCACCG-5' GGGCCCACGCUACGACGUUC 3' (28%) Anlisonse 3' CCCGAGTGCGATGCTGCAAG X Surge or inertia brake systems may be used on trailers and semitrailers with gross weight of ___ or less Give me an example of a repeating decimal turned into a fraction researchers believe that brain functioning may improve in middle childhood partly because of what? 1. describe your personal experience with cliques. do you think that cliques, those exclusive peer groups that are part of most schools, have enhanced or detracted from your high school career? explain your answer. 2. the article mentions a number of cliques found in many high school environments around the united states. are these groups present in your school? can you add any other cliques to this list? cruel schools 3. sociologists peter and patti adler believe that clique members purposely reject and hurt outsiders in order to gain status within the group. do you agree with this statement? explain your answer. 4. some schools have attempted to control cliques by requiring school uniforms or implementing other programs that encourage acceptance. in your opinion, are these policies useful in curbing the negative aspects of cliques? should schools attempt to control or limit exclusive peer groups? the fire cast dancing shadows across the room. transitive or intransitive A national charity contacted 100 i need help the question says in your bible, find examples for each of the four types of figurative language. A. simileB. metaphor C. hyperboleD. personifiction Help help helpHelp help Help math helpHelp help help with Which author's purpose is suggested by the text?A. to describe to readers the features of different mapsB. to explain to readers how to navigate a city with a map why did absolute monarchy come to an end? What is the current US national security strategy?. popular vegan turkey substitute tofurky is manufactured in which us state? almost every industry must consider how energy is obtained for doing business, whether it is simply to reduce the utility bill or to reduce pollution. describe one job related to renewable energy technologies that most interests you. what skills would make you a good fit for this job? Please help me solve this with all possible steps X+14/13 = 12/13x A(n) is defined as those direct competitors that sell similar products or services within a specified geographic radius that customers are willing to travel. B is the midpoint of line AC as shown below. There are some statements given below. Rearrange the statements in the correct order to prove x=7. Kendall is using the formula shown to find the surface area of the prism:ph+2B.Assuming the base is the shaded surface , use t for variables P, h and B I her formula.