A student is researching the inheritance patterns of different traits in chickens. She hypothesizes that red feathers are dominant over black, and the trait for crests are dominant over non-crested. She performs a test cross to confirm her hypothesis. To produce the F1 generation, she crosses two parents-- a chicken that is homologous for traits showing red and crested and a chicken that is homologous for traits showing black and non-crested. Which ratio best represents the phenotype of the F2 generation


9:3:3:1


1:1:1:1


2:2:1:1


16:0

Answers

Answer 1

Answer:

9:3:3:1

Explanation:

Answer 2

In this inheritance pattern, the ratio that best represents the phenotype of the F2 generation is 9:3:3:1. Thus, the correct option for this question is A.

What is a Phenotype?

A phenotype may be defined as the mechanism of expressing genotypes in the form of traits. In more simple words, it is also characterized as the morphology or physiology which comes due to the combination of alleles.

If a trait of red feathers is denoted by R and the trait of black feathers is denoted by r, then R > r. Similarly, a trait of crests is denoted by C and the trait of non-crested is denoted by c, then, C > c.

Now, RRCC is crossed with rrcc, the F1 offspring have the genotype RrCc with the phenotype of red feathers with crests. Now, RrCc is selfed, it produces the ratio of 9:3:3:1. This is an example of a dihybrid cross.

Therefore, in this inheritance pattern, the ratio that best represents the phenotype of the F2 generation is 9:3:3:1. Thus, the correct option for this question is A.

To learn more about Dihybrid cross, refer to the link:

https://brainly.com/question/17192491

#SPJ2


Related Questions

Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]

Answers

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.

What occurs when the air temperature is equal to the dew point temperature? A:The relative humidity is 100%, so evaporation occurs. B:The relative humidity is 100%, so condensation occurs. C:The relative humidity is 0%, so condensation occurs. D:The relative humidity is 0%, so evaporation occurs. Is it B?

Answers

Answer:

B

Explanation:

When the air temperature is equal to the dew point temperature, the relative humidity would be 100% and condensation occurs.

The dew point temperature is a temperature at which the air is saturated with water vapor and some of it begins to condense as liquid water. As the air temperature cools further, more and more water condenses as liquid water and this is essentially what constitutes precipitation.

The correct option is B.

What is the function of hemoglobin in the body?

A) It binds with oxygen in red blood cells and it is carried to all parts of the body
B) It carries carbon dioxide around the body mainly
C) It causes stomach ulcers/stomach pain/gas
D) It is a protein marker determining our blood type

Answers

Answer:

A

Explanation:

What is the function of hemoglobin in the body?A) It binds with oxygen in red blood cells and it is carried

Answer:

A....it binds with oxygen in red blood cells and it is carried to all parts of the body

Explanation:

haemoglobin binds with oxygen to form oxy- haemoglobin..and transported to where it's needed for example cells for metabolism

n the circles, show the alleles in the gametes of the parent generation. Show how the alleles recombine in the F1 plants.

Answers

The first generation of parents to cross is referred to as the parenting generation.

What is Parent generation?

The offspring's genotype would be predicted based on the genotypes of the parents (F1 generation) Mendel's research on inheritance, or passing genetic traits from one generation to the next, began with the P generation.

In essence, it refers to characteristics or genes that are passed down from one generation of parents to their kids.

Parental generation is the first generation involving two individuals that are mated to foresee or analyze the genotypes of their offspring. Their probable set of offspring would constitute the so-called first filial generation (or F1 generation).

Therefore, The first generation of parents to cross is referred to as the parenting generation.

To learn more about parent generation, refer to the link:

https://brainly.com/question/13152525

#SPJ9

n the circles, show the alleles in the gametes of the parent generation. Show how the alleles recombine

Which of the following is the conclusion that Miller and Urey reached?

Answers

What did Miller and urey conclude from their experiment? simple organic molecules, including amino acids ( the building blocks of proteins), could have been made from gases in the earth's primitive atmosphere. This conclusion is called the chemical origin of life

Whether of not the cell is partitioned into compartments by internal membranes decides whether it is

Answers

Whether of not the cell is partitioned into compartments by internal membranes decides whether it is prokaryotic or eukaryotic.

Prokaryotic cells are cells that do not have internal membrane-bound compartments or organelles, meaning that the genetic material, ribosomes, and metabolic pathways are all freely floating in the cytoplasm. Prokaryotic cells are typically smaller and less complex than eukaryotic cells, and include bacteria and archaea.

Eukaryotic cells, on the other hand, have internal membrane-bound compartments or organelles that allow for compartmentalization of different cellular functions. The genetic material is contained within a nucleus, and other organelles such as mitochondria, endoplasmic reticulum, and Golgi apparatus are responsible for specific cellular functions.

To know more about prokaryotic here

https://brainly.com/question/8373942

#SPJ4

Why should we focus more on growing trees rather than
simply planting trees? Use at least three details from the
text in your answer.

Answers

We should focus more on growing trees rather than simply planting trees because mature trees provide a good source to the economy along with reducing the bills.

Why should we focus on planting trees?

Trees definitely deliver a significant contribution to their surroundings by giving oxygen, sustaining species, improving air quality, saving water, maintaining soil, and reducing climate change.

It provides more than it gets by concentrating on its principal job of photosynthesis. Trees always provide many resources, such as food, to a community. Trees mitigate the Urban Heat Island Effect and store and sequester carbon. They are important for habitat.

They also have a high rate of photosynthesis through which oxygen is liberated at a fast rate.

Therefore, we should ultimately focus more on growing trees rather than simply planting trees.

To learn more about Planting trees, refer to the link:

https://brainly.com/question/6399058

#SPJ1

Why is the predator prey relationship necessary for the stability of an ecosystem

Answers

Answer:

So that they can maintain a large number of animals.

Explanation:

The animals will eventually die out because it's not eating enough of their "prey".

DNA and RNA have three important structural differences. These include all of the following EXCEPT that __________.
A. in living cells, DNA is usually a double-stranded molecule while RNA can often be single-stranded
B. DNA contains deoxyribose while RNA contains the sugar ribose
C. DNA contains phosphate while RNA does not
D. DNA contains the bases A, G, C, and T while RNA contains the bases A, G, C, and U

Answers

Answer: C.

Explanation: DNA contains phosphate while RNA does not.

02.Un avión de masa 25000 kg se mueve con una aceleración de 3.5 m/s2. Determine la
fuerza que actúa sobre el avión.

Answers

Answer:

Force acting on the plane = 87,500 N

Explanation:

Given:

Mass of airplane = 25,000 kilogram

Acceleration of plane = 3.5 m/s²

Find:

Force acting on the plane

Computation:

⇒ Force = Mass x acceleration

⇒ Force acting on the plane = Mass of airplane x Acceleration of plane

⇒ Force acting on the plane = 25,000 x 3.5

Force acting on the plane = 87,500 N

which muscles assist in the flexion and rotation of the neck and are involved in traumatic whiplash injuries?

Answers

The muscles that assist in the flexion and rotation of the neck and are involved in traumatic whiplash injuries are the sternocleidomastoid muscles and the scalene muscles.

The sternocleidomastoid muscles are located on either side of the neck and are responsible for rotating the head and flexing the neck. These muscles are commonly injured during whiplash injuries due to the rapid forward and backward movement of the head and neck during a car accident or other traumatic event.

The scalene muscles are located on the sides of the neck and are responsible for flexing the neck and assisting in breathing. These muscles are also commonly injured during whiplash injuries due to the rapid movement of the head and neck.

In summary, the sternocleidomastoid muscles and the scalene muscles are the primary muscles involved in the flexion and rotation of the neck and are commonly injured during traumatic whiplash injuries.

Learn more about whiplash injuries here:

https://brainly.com/question/28138070

#SPJ11

the heterozygosity of a population several generations after a founder event (bottleneck) depends on what

Answers

The heterozygosity of a population several generations after a founder event (bottleneck) depends on the degree of inbreeding that has taken place during and after the bottleneck event.

A founder event is a genetic bottleneck that occurs when a small group of individuals leaves the main population to start a new one. The small group, by definition, carries a limited representation of the genetic diversity in the main population. As a result, the genetic variation of the new population tends to be lower than that of the original population.The heterozygosity of a population is a measure of the amount of genetic diversity in the population. It is defined as the proportion of individuals in the population that are heterozygous for a given gene or set of genes.

Inbreeding, which occurs when genetically related individuals mate with each other, reduces heterozygosity by increasing the frequency of homozygous genotypes. As a result, the degree of inbreeding that occurs during and after a bottleneck event determines how much heterozygosity will be lost in the population over time. Therefore, the heterozygosity of a population several generations after a founder event (bottleneck) depends on the level of inbreeding that occurred during and after the bottleneck.

Learn more about inbreeding at

https://brainly.com/question/15166010

#SPJ11

Pls help me out here!!!

In two or more complete sentences compare transformation and transfection gene therapies.

Answers

Answer:

The main difference between transfection and transformation is that the transfection refers to the introduction of foreign DNA. Into mammalian cells while the transformation refers to the introduction of foreign DNA into bacterial, yeast or plant cells.

Explanation:

Hope this helps have a nice day!

Endangered Species
Research an endangered species. Include an image of this species. Discuss the following questions: Approximately how many are left? When is the estimated time they will be extinct? What is the major cause of their future demise?

Vulnerable Species Research a vulnerable (threatened) species. Include an image of this species. How many are there left or have reappeared? What is being done to help them come back? What was the cause of their decline or demise?

Answers

a. Endangered Species: African Elephant: The African elephant is a majestic species that is facing extinction due to various factors. Approximately 415,000 African elephants remain in the wild, with their population declining by 60% over the last 75 years.

b. According to the International Union for Conservation of Nature (IUCN), the African elephant is classified as vulnerable, and it is estimated that if current trends continue, they could be extinct within the next few decades.

The major cause of their future demise is the illegal wildlife trade, particularly the demand for ivory. Poaching for ivory has led to the killing of tens of thousands of elephants each year, resulting in severe population declines in many African countries. In addition to poaching, habitat loss and fragmentation, human-wildlife conflict, and climate change also pose significant threats to African elephants.

To help African elephants, several conservation efforts are underway. These include anti-poaching measures, habitat restoration, and community-based conservation programs. In addition, many countries have banned the trade in ivory, although enforcement of these laws can be challenging.

Vulnerable Species: Snow Leopard: The snow leopard is a vulnerable species that is found in the high-altitude mountain ranges of Central and South Asia. Approximately 4,000 to 6,500 snow leopards remain in the wild, with their population declining by 20% over the last three decades. According to the IUCN, the snow leopard is classified as vulnerable due to habitat loss and fragmentation, poaching, and retaliatory killings by herders.

The major cause of their decline is habitat loss and fragmentation due to human activities such as mining, agriculture, and infrastructure development. In addition, poaching for their pelts and body parts is also a significant threat to snow leopards. Retaliatory killings by herders who lose their livestock to snow leopards are also a major cause of their decline.

To help snow leopards, several conservation efforts are underway. These include habitat restoration, anti-poaching measures, and community-based conservation programs. In addition, the Snow Leopard Trust and other organizations are working to educate local communities about the importance of snow leopards and to promote sustainable development practices that minimize negative impacts on snow leopard habitat.

Learn more about African Elephant Visit : brainly.com/question/21415053
#SPJ11

Make a list of 5 kinds of variation that you can see between the dogs

Answers

fox wolf bear dog panda

write down the distinguish chracteristics
of five kingdom classification

Answers

Answer:

Monera, Protista, Fungi, Plantae and Animalia. The organisms which are placed under the kingdom Animalia are heterotrophic and depend on the other organisms for food .

Explanation:

hope this helps :)

The apparatus shown in the diagram can be used to measure the change in rate of photosynthesis in pondweed when the lamp is moved closer or further away from the pondweed. What would change to cause an increase or decrease in that rate?

The apparatus shown in the diagram can be used to measure the change in rate of photosynthesis in pondweed

Answers

Answer:

the oxygen will increase and make bubbles in the water the thing that will decrease is CO2

hope this helps you

Explanation:

plants take sunlight water and CO2 to make sugars this also creates oxygen

this process is called respiration

Answer: light/light intsensity

Explanation:

Wave absorption results in some of the waves energy being converted into thermal energy.

Answers

When a wave is absorbed, the matter absorbs energy from the wave, reducing the amplitude in the process.

As an illustration, when a sound wave strikes foam padding, the energy passes through the material and occasionally transforms into heat or other types of energy.

What happens to a sound wave's energy when it is absorbed by a substance?

The molecules of a medium, like water, absorb sound as it flows through them and catch it.

The medium really converts part of the sound wave's acoustic energy into heat.

One way that this occurs is that the sound's acoustic energy induces the medium's molecules to begin vibrating.

learn more about Wave absorption refer

https://brainly.com/question/25799707

#SPJ4

Evidence suggests that originally the Earth's atmosphere contained a large amount of carbon dioxide and almost no oxygen. Our
atmosphere is different today: it contains a large amount of oxygen, which is good, since we need it to breathe
What caused this atmospheric change?
A)
Global warming
B)
A meteor impact
C) Photosynthetic organisms like cyanobacteria taking in carbon dioxide and
releasing oxygen
D) Photosynthetic organisms like cyanobacteria taking in oxygen and
releasing carbon dioxide

Answers

Answer:

c

Explanation:

i just did it on study island

According to the graph, which of the following populations has likely reached it's carrying capacity?

(Option A): Population A
(Option B): Population B
(Option C): Population C
(Option D): Population D

According to the graph, which of the following populations has likely reached it's carrying capacity?(Option

Answers

Answer:

population A

Explanation:

because, it starts at 1 so it starts when the first person started the population, and it has a constant rate of change

In a chemical reaction, what would happen if the reactants are heated

Answers

Answer: the average kinetic energy of the molecules increase

Explanation: it means that more molecules are moving faster and hitting each other with more energy and if more molecules hit each other with enough energy to react, then the rate of the reaction increases

5. In a scientific investigation, a scientist is testing to see
the effect of light intensity (strength of the light) on
plant growth. During her investigation, the scientist
ensures that all subject plants get the same amount of
water, are planted in the same type of soil and placed
in a lab room at the same temperature. Each of these
factors are an example of a
A) control group
B) experimental group
C) control variable
D) independent variable

Answers

Answer: C control variable

Explanation: I say control variable because it is what is being kept the same during the investigation. It is not of primary concern in the experimental outcome because it is all kept the same in each of the subject plants.

:)

(THIS IS WHAT I THINK!!!)

If a vulture consumes remains of a racoon on the side of a highway explain how that is important and explain how that benefits the environment.

Answers

If a vulture which is a scavenger, consumes remains of a racoon on the side of a highway, it will help to control environmental pollution and stop the spread of diseases by the dead animal.

What are scavengers?

Scavengers are organisms which feed on leftover or carcasses of dead organism. Example of a scavenger is the vulture.

Vultures feed on dead organisms or food that has been left over by other organisms.

Scavenging plays an important role by removing substances which may lead to spread of diseases from the environment.

Thus, if a vulture consumes remains of a racoon on the side of a highway, it will help to remove the carcasses which may serve as a breeding ground for diseases. It also helps to control environmental pollution.

In conclusion, scavengers like vultures help to control environmental pollution.

Learn more about scavengers at: https://brainly.com/question/259333

#SPJ1

how do birdwatchers make use of a variation

Answers

Birdwatchers make use of variation by observing and documenting the diverse physical characteristics, behaviors, and habitats exhibited by different bird species, which helps them identify and understand the unique features and adaptations of each species.

Birdwatchers, also known as birders, rely on the study of variation among bird species to enhance their understanding and appreciation of avian life. Variation refers to the differences in physical traits, behaviors, and habitats that exist between bird species. By carefully observing and documenting these variations, birdwatchers can develop a comprehensive knowledge of different bird species and their specific adaptations.

Physical characteristics play a crucial role in identifying bird species. Birdwatchers carefully examine features such as size, shape, coloration, patterns, beak shape, and wing structure to differentiate between various species. By noting the variations in these physical attributes, birders can accurately identify different birds and classify them accordingly. For example, the coloration and pattern of feathers can help distinguish between male and female birds or indicate the age of an individual.

In addition to physical traits, bird behavior is another essential aspect of variation that birdwatchers consider. Observing and documenting the behaviors exhibited by different species provide insights into their ecological roles, breeding strategies, feeding habits, and social dynamics. Variations in behavior can include courtship displays, feeding techniques, migratory patterns, vocalizations, and nesting habits. By studying these behavioral variations, birdwatchers can gain a deeper understanding of the natural history and ecological interactions of each species.

Habitat variation is yet another crucial aspect that birdwatchers take into account. Birds occupy diverse habitats, including forests, wetlands, grasslands, deserts, mountains, and urban areas. Each habitat provides unique resources and challenges, leading to variations in the species that inhabit them. By exploring different habitats and observing the bird species present, birdwatchers can expand their knowledge of how birds adapt to specific environments. Understanding habitat preferences and requirements helps birders identify the specific areas where certain bird species are more likely to be found.

In summary, birdwatchers make use of variation by closely examining and documenting the diverse physical characteristics, behaviors, and habitats exhibited by different bird species. This approach allows them to identify and understand the unique features and adaptations of each species, contributing to their overall knowledge and appreciation of avian life.

For more questions on birdwatchers

https://brainly.com/question/27779441

#SPJ8

The mother has long fur:
(FF)
F= long fur

The father does not have long fur:
(ff)
f=short fur

Answers

Answer:

are you looking for a pedigree, or a square pedigree?

Explanation:

pal: histology > integumentary system > lab practical > question 8 5 of 12 part a identify the highlighted region of the skin.

Answers

The highlighted region of the skin is the (specific region).

Since I cannot visually see the highlighted region, I am unable to provide the exact identification. However, I can provide you with some common regions found in the integumentary system to help you identify the highlighted region on your own:

1. Epidermis: The outermost layer of the skin, consisting of multiple layers of cells.
2. Dermis: The layer beneath the epidermis, containing connective tissue, hair follicles, sweat glands, and blood vessels.
3. Hypodermis (subcutaneous layer): The deepest layer, consisting of adipose tissue and providing insulation, cushioning, and energy storage.

Once you identify the specific highlighted region, refer to the appropriate layer or structure to understand its function and characteristics within the integumentary system.

learn more about epidermis

https://brainly.com/question/28045754

#SPJ11

Why do humans have a strong impact on the fast carbon cycle?

Answers

Burning fossil fuels or cement has relatively little of an influence on humans in terms of producing carbon dioxide. The general people has been duped into believing we are a major factor in the greenhouse effect.

The biggest misconception regarding the movement for people to emit no net amount of CO2 is that natural supplies of this plant nourishment dwarf our emissions. This indicates that even if all people disappeared overnight, atmospheric CO2 levels would not significantly drop.

The statistics on the steady increase in CO2 throughout the heaviest periods of the global lockdown, which significantly restricted any human-sourced emissions, will give you a decent idea of this.

As for the so-called greenhouse gases, CO2 naturally occurs in water vapor, which makes up more than three times as much of the GHG as CO2. This indicates that the human component of the GHG is 0.6 percent.

When you take into account how little human emissions are in the grand scheme of things, you have to stop and wonder if any efforts you make to lower your emissions are in vain.

Thank you,

Eddie

When plate tectonic processes closed off the Mediterranean Sea from the Atlantic ocean during the Late Miocene, species went extinct because the ______.

Answers

When plate tectonic processes closed off the Mediterranean Sea from the Atlantic Ocean during the Late Miocene, species went extinct because the Mediterranean Sea became more saline.

The closure of the Strait of Gibraltar, which occurred as a result of plate tectonic processes during the Late Miocene, caused the Mediterranean Sea to become more isolated from the Atlantic Ocean. This isolation led to a decrease in the amount of freshwater entering the Mediterranean, causing the sea to become more saline over time. This change in salinity had a profound impact on the marine organisms living in the Mediterranean, many of which were not adapted to survive in such high salinity conditions.

As a result, a number of species went extinct, while others evolved adaptations to the new environment. This event is an example of how changes in the Earth's geology and climate can have significant impacts on the evolution and extinction of species over time.

To know more about Late Miocene,

https://brainly.com/question/31360708

#SPJ11

The thoracic duct collects lymph from all of the body except for the o left upper quadrant right upper quadrant left lower quadrant Oright lower quadrant

Answers

The thoracic duct collects lymph from all of the body except for the right upper quadrant.

What is lymph?

Lymph is a fluid that circulates through the lymphatic system, which is a network of vessels and nodes that help defend the body against infections and other diseases. It carries immune cells and waste products away from tissues to be filtered and eliminated by the body.

The thoracic duct is the largest and longest lymphatic vessel in the body. It collects lymph from most of the body and drains it into the bloodstream at the junction of the left subclavian and internal jugular veins. The only part of the body that is not drained by the thoracic duct is the right upper quadrant. The lymph from this area is collected by the right lymphatic duct, which drains into the right subclavian vein.

The left upper quadrant, left lower quadrant, and right lower quadrant are all drained by the thoracic duct. Therefore, the correct answer to the question is "right upper quadrant."

Read more about lymph here: https://brainly.com/question/3318384

#SPJ11

Describe the difference between an independent variable and a controlled variable.

Answers

Answer:

Dependent variable: What you're measuring.

Independent variable: The variable the researcher is changing.

Controlled variable: The variable that is being used as an example that is not being experimented on. It is kept the same throughout the whole experiment.

Explanation:

Dependent and independent variables are variables in mathematical modeling, statistical modeling and experimental sciences. Dependent variables receive this name because, in an experiment, their values are studied under the supposition or hypothesis that they depend, by some law or rule (e.g., by a mathematical function), on the values of other variables. Independent variables, in turn, are not seen as depending on any other variable in the scope of the experiment in question; thus, even if the existing dependency is invertible (e.g., by finding the inverse function when it exists), the nomenclature is kept if the inverse dependency is not the object of study in the experiment. In this sense, some common independent variables are time, space, density, mass, fluid flow rate,[1][2] and previous values of some observed value of interest (e.g. human population size) to predict future values (the dependent variable).
Other Questions
#2Scientists determined that excess fertilizer from a pig farm entered a shallow lake. The fertilizer initially caused anincrease in aquatic plants in the lake. However, as the plants died and decomposed, there was a decrease in oxygenlevels in the water. The intensity at which a fish species is affected by oxygen levels in the water varies. Trout are thefirst to feel the effects at oxygen levels below 5.0 parts per million. Carp been able to survive levels down to about 1.0ppm for extended periods.What will most likely happen to the trout and carp populations in the lake if low oxygen level,or hypoxia, continue over an extended period? Explain using the concepts of range oftolerance and abiotic factors. John Quincy Adams was able to steal the presidency away from Andrew Jackson because of the secret deal he made known as the Why did each of the states write a constitution as soon as independence was declared? Options: They needed to replace the British government, during the Revolutionary War, with a government of their own. They believed that a monarch would take over if they waited. They needed a way to force colonists to join the war effort. They were required by the British government to create them. Which value of p makes the equation 7p+3 = 4p + 9 true?O p=5O p=0O p=2 In a dns database zone, which resource record consists of a computer names and ipv4 address? Can somebody help me? A coin is tossed and a die is rolled. What is the probability that the coin shows heads and the die shows an odd number? help me please (2a+3)(3a-4) Find the general solution of xy' - y = 2x ln x. Please solve using I = e^integrate x dx What causes changes of states in matter?A. thermal energy/heatB. moleculesC. airD. melting American car makers promote the idea that Japan makes it difficult for others to compete in the industry because the country has more than 2,000 african-american men held public office during reconstruction. they were elected into positions at all levels of government, including the house of representatives , the u.s. senate, and the state supreme court of . this represented a fundamental shift in power in the south Let R+R be a linear transformation such that T(1, 1, 1) = (2,0, -1), T(0, -1,2)=(-3,2, -1), and T(1, 0, 1) = (1, 1, 0) Find T(5, 4, -3) T(5, 4, -3)= (17.-3. 4) T(5, 4, -3)=(13. -7,-4) T(5, 4, -3)=(13. How is 1700s Florida different than the Florida we know today? Briefly explain the ways women have participated in the church and what kinds of roles they have had, and how those roles could contribute to the community and religion. 3. Construct a regular pentagon inscribed in a circle of radius 1+5. Compute the exact side length of the regular pentagon and the angles you get "for free". Then construct a rhombus with side length Find the area and the perimeter of a rectangle with a length of 27 feet and awidth of 107 feet. If a bank has a duration gap of 2 years, then a rise in interest rates from 6 percent to 9 percent will lead to a rise in the market value of its net worth of 5.66 percent. a rise in net interest income of 5.66 percent. a fall in the market value of its net worth of 5.66 percent. a fall in net interest income of 5.66 percent. an unknown change. isaac believes that his technical skills empower him to choose how, when, and even if he will interact with corporations. he's not alone. A student left a piece of meat uncovered on a kitchen counter overnight. In the morning, he saw that little organisms were crawling on the meat. He concluded that conditions were right for these organisms to spontaneously come to life on the meat.Explain why the student's conclusion was wrong. Hyperventilation causes generalized ________, which ________ blood flow to the brain and can result in feeling dizzy or faint.