Answer:
A and B
Explanation:
<3
which statement best describes the relationship between a hypothesis and a scientific theory? a. multiple supported hypotheses are used to form scientific theory. b. a scientific theory can be proven or disproven by a hypothesis
The statement that best describes the relationship between a hypothesis and a scientific theory is:
A) Multiple supported hypotheses are used to form a scientific theory.
A hypothesis is a proposed explanation or prediction for a specific phenomenon or set of observations. It is a tentative statement that can be tested through experimentation or further observation.
Hypotheses are often specific and focused, aiming to address a particular aspect or question within a broader scientific inquiry.
On the other hand, a scientific theory is a well-substantiated and comprehensive explanation that has been extensively tested and supported by multiple lines of evidence.
It goes beyond individual hypotheses and provides a broader framework to explain a range of related phenomena. A scientific theory is based on the accumulation of evidence from various sources, including experimental data, observational studies, and theoretical models.
Therefore, multiple supported hypotheses contribute to the development of a scientific theory. As hypotheses are tested and confirmed through empirical evidence, they collectively support and contribute to the formation of a broader scientific theory.
Theories are not proven or disproven by single hypotheses but are rather refined and strengthened over time as new evidence emerges. Therefore, the correct is A.
For more such answers on hypothesis and a scientific theory
https://brainly.com/question/18363155
#SPJ11
What are two types of Buddhism?
There are two main divisions in Buddhism: Theravada Buddhism and Mahayana Buddhism.
Answer:
C) Mahayana and Theravada
on edge 2022
Match the terms to their definition.
1 .
an animal or insect that is known to transmit a specific disease
immunization
2 .
vaccination, artificially stimulating antibodies to a disease
leukocyte
3 .
white blood cell
pathogenic
4 .
producing disease
vector
To understand how vaccines work, it helps to first look at how the body fights illness. When germs, such as bacteria or viruses, invade the body, they attack and multiply. This invasion, called an infection, is what causes disease. The immune system uses your white blood cells to fight infection. These white blood cells consist primarily of macrophages, B-lymphocytes and T-lymphocytes:
Macrophages are white blood cells that swallow up and digest germs, plus dead or dying cells. The macrophages leave behind parts of the invading germs called antigens. The body identifies antigens as dangerous and stimulates antibodies to attack them.
B-lymphocytes are defensive white blood cells; they can produce antibodies to fight off infection.
T-lymphocytes are another type of defensive white blood cell, that recognizes a familiar germ, if the body is exposed again to the same disease
The first time the body is infected with a certain germ, it can take several days for the immune system to make and use all the tools needed to fight the infection. After the infection, the immune system remembers what it learned about how to protect the body against that disease. If your body encounters the same germ again, the T-lymphocytes recognize the familiar germ and the B-lymphocytes can produce antibodies to fight off infection.
How Vaccines Work
Vaccines can help protect against certain diseases by imitating an infection. This type of imitation infection, helps teach the immune system how to fight off a future infection. Sometimes, after getting a vaccine, the imitation infection can cause minor symptoms, such as fever. Such minor symptoms are normal and should be expected as the body builds immunity.
Once the vaccinated body is left with a supply of T-lymphocytes and B-lymphocytes that will remember how to fight that disease. However, it typically takes a few weeks for the body to produce T-lymphocytes and B-lymphocytes after vaccination. Therefore, it is possible that a person infected with a disease just before or just after vaccination could develop symptoms and get that disease, because the vaccine has not had enough time to provide protection. While vaccines are the safest way to protect a person from a disease, no vaccine is perfect. It is possible to get a disease even when vaccinated, but the person is less likely to become seriously ill.
Types of Vaccines
Scientists take many approaches to developing vaccines. These approaches are based on information about the diseases the vaccine will prevent, such as how germs infect cells, how the immune system responds to it, regions of the world where the vaccine would be used, the strain of a virus or bacteria and environmental conditions. Today there are five main types of vaccines that infants and young children receive in the U.S.:
Live, attenuated vaccines fight viruses and bacteria. These vaccines contain a version of the living virus or bacteria that has been weakened so that it does not cause serious disease in people with healthy immune systems. Because live, attenuated vaccines are the closest thing to a natural infection, they are good teachers for the immune system. Examples of live, attenuated vaccines include measles, mumps, and rubella vaccine (MMR) and varicella (chickenpox) vaccine. Even though they are very effective, not everyone can receive these vaccines. Children with weakened immune systems—for example, those who are undergoing chemotherapy—cannot get live vaccines.
Non-live vaccines also fight viruses and bacteria. These vaccines are made by inactivating, or killing, the germ during the process of making the vaccine. The inactivated polio vaccine is an example of this type of vaccine. Often, multiple doses are necessary to build up and/or maintain immunity.
Toxoid vaccines prevent diseases caused by bacteria that produce toxins (poisons) in the body. In the process of making these vaccines, the toxins are weakened so they cannot cause illness. Weakened toxins are called toxoids. When the immune system receives a vaccine containing a toxoid, it learns how to fight off the natural toxin. The DTaP vaccine contains diphtheria and tetanus toxoids.
Subunit vaccines include only parts of the virus or bacteria, or subunits, instead of the entire germ. Because these vaccines contain only the essential antigens and not all the other molecules that make up the germ, side effects are less common. The pertussis (whooping cough) component of the DTaP vaccine is an example of a subunit vaccine.
Conjugate vaccines fight a type of bacteria that has antigens. These bacteria have antigens with an outer coating of
la barrera de Linfocitos B
Answer:Cada linfocito B, al ser activado, produce un anticuerpo específico. El cuerpo tiene millones de linfocitos B diferentes capaces de detectar antígenos distintos. Sin unas barreras de defensa a punto y en forma, no tendríamos manera de combatir los agentes extraños que ingresan en nuestro cuerpo desde el exterior.
Explanation:
Question 4
Below is the CODING STRAND of a small gene that codes for a peptide. Assume the gene has a
traditional start codon.
How many amino acids long is the peptide if we assume traditional start and traditional stop
codon?
5' AATCCGTATCTATGACCGTTTGGAAACACTAAGCGGTACTC 3'
3
5
6
9
Transcription is mRNA synthesis, which occurs by complementing a segment of the DNA template strand. The translation is the protein growth, which occurs by adding amino acids coded by mRNA codons. C) the polypeptide is 6 amino acids long.
What are transcription and translation?The whole process of protein synthesis includes Transcription and translation.
TRANSCRIPTION
Transcription is the mRNA synthesis process and occurs in the nucleus.
The DNA template strand is read in direction 3'→ 5' to build the mRNA molecule in direction 5'→ 3'. The template strand is the one that is going to be complemented by the mRNA.
mRNA molecule has the same sequence as the DNA coding strand, but it carries uracil instead of thymine.
TRANSLATION
Translation is the process through which polypeptide grows. It occurs in the cytoplasm.
rRNA and tRNA read mRNA in the direction 5'→ 3' and add the correct amino acids to build the new protein.
Amino acids are coded by mRNA codons. Protein synthesis initiates in the AUG start codon -Metionin- and ends when reaching either of the stop codons UAA, UAG, or UGA.
In the exposed example, we have a DNA strand. We know that it is the coding strand, so it has the same sequence as mRNA molecule.
DNA coding strand5' AATCCGTATCTATGACCGTTTGGAAACACTAAGCGGTACTC 3'
mRNA molecule5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'
Kowing mRNA sequence, we can grow the protein.
So first, we need to find the initiation codon (AUG), begining from the mRNA 5' extreme. Then we need to find a stop codon (UAA, UAG, or UGA).
mRNA start codon5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'
mRNA stop codon5' AAUCCGUAUCUAUGACCGUUUGGAAACACUAAGCGGUACUC 3'
So this protein begins in AUG and ends in UAA.
To grow the protein, we need to separate mRNA codons and find the corresponding amino acids.
mRNA codons ⇒ AUG ACC GUU UGG AAA CAC UAA amino acids ⇒ Met Thr Val Trp Lys His Stop Protein ⇒ Met-Thr-Val-Trp-Lys-HisAccording to this reasoning, the polypeptide is 6 amino acids long. Option C) is correct.
You can learn more about protein synthesis at
https://brainly.com/question/16305501
#SPJ1
Carbon is a very important molecule in biology. Describe two different facets of this element that contribute to its significance in the make up of cells. Explain how functional groups change the nature of hydrocarbon chains? How can knowledge of atomic structure help you to understand different reactions that occur with biological molecules?
Answer:
Carbon is the most valuable element to life. Carbon is the central element for life organic compounds , i.e. include carbohydrates , lipids , proteins and nucleic acids. Cells are made of many complex molecules, called macromolecules, such as proteins, nucleic acids (RNA and DNA), carbohydrates, and lipids. The macromolecules are a subset of organic molecules (any carbon-containing liquid, solid, or gas) that are especially important for life.
Explanation:
if all cells contain the exact same copy of DNA, how do they become specialized?
Even if all the cells have the same DNA they biochemical function are different, that's because differents sets of genes must be turned on and off in each cell type by the action of enzymes and other molecules. Each cell have the same 20,000 or so genes but they are biochemically selected by the action of molecules as hormones and chemical signaling. Therefore, different cells use different parts of the DNA code as directions.
Are fingers made of diploid cells or haploid cells?
Fingers are made from diploid cells. All of the cells in our body are made from diploid cells except in the reproductive cells which are made from haploid cells.
Rey, who has a normal vision (XY),married Cindy
who has a normal vision but carries a gene for
color-blindness (XX) What is the chance to
have a colorblind baby girl?
Answer:
There is no chance that Rey —who has a normal vision man— and Cindy, who is a woman colorblind carrier, will have a colorblind daughter.
Explanation:
If a man with normal vision and women who is a carrier of colorblindness has a daughter there is a 50/50 chance of having a colorblindness carrier daughter. And all daughters would have normal vision.
Color blindness is a visual condition characterized by the inability to discern some colors, and has a recessive inheritance pattern linked to the X sex chromosome. This means that all males with the defective gene (Xd) would be color blind, while a female to be color blind must have both X chromosomes affected.
In the case of Rey and Cindy
♂ XY
♀XdX
Alleles X Y
Xd XdX XdY
X XX XY
Of the daughters they have, half could be carriers, while the other half would not have the altered gene. In any case, none of their daughters could be colorblind.
How is the skin part of the integumentary system and the excretory system?
(Hint: Think of what happens when your body gets very hot.)
The skin shields the body from external conditions and aids in the regulation of the body's internal functions as part of the integumentary system.
What is integumentary system?The integumentary system is a collection of organs that make up the body's outermost covering. It is made up of the skin and its appendages, and it serves to protect and preserve the animal's body by functioning as a physical barrier between the exterior and interior environments.
The excretory system's skin, on the other hand, acts as a regulator for the amount of fluids and salt in our bodies.
For more information regarding integumentary system, visit:
https://brainly.com/question/2801375
#SPJ1
What are the factors that determine the level of harm an introduced chemical has on the environment? (Site 1)
Answer:
Following are the factors are given below:-
Explanation:
In general, the toxicity of a substance depends on the following factors.
Chemical type and inherent behavior. Dosage, in particular the link dose-time. Exposure route. Species. Stage in life, such as child, young adult, or an older adult. Gender. Fitness to drink. Metabolism. Allocation inside the organ. Excretion Human safety, including organ function and childbirth, requiring physical effects that can affect toxicity. Nutritional status Many chemicals are available. Circadian rhythms (the time of day caused by a medication or other substance)The major factors that determine the level of harm an introduced chemical have on the environment -
type of chemical concentration weather conditionssolubility in waterThe environment of the ecosystem and the health of organisms are affected by the use and the accumulation of persistent pollutants. The following are the factors that help in determining the level of harm of an introduced chemical:
type of chemical - types of chemicals determine the level of toxicity of a particular chemical.concentration - concentration of chemical dependency on the harm of the chemical.weather conditions - the chemical effect on weather also affects the level of harm.solubility in water - chemicals solubility in water affects harm on the organisms.Thus, The major factors that determine the level of harm an introduced chemical have on the environment -
type of chemical concentration weather conditionssolubility in waterLearn more:
https://brainly.com/question/3372836
Can someone plz help me? :)
Two students are planning an experiment that will test how planaria (aquatic flatworms) respond to different environments. They will conduct two investigations—one that tests the worms’ responses to different water temperatures and one that tests the worms’ responses to different levels of acidity. Student 1 wants to buy two groups of flatworms and use a different group for each investigation. Student 2 thinks the same group of worms should be used for both investigations.
Student 2 is right.
Constant variables
In research investigations, some variables should be kept constant across various experimental groups in order for the outcome of the investigation to be valid.
For example, in order to test how flatworms respond to different environments, one variable that should be kept constant is the flatworms. The flatworms to be used must be of the same species, sex, age, etc.
The investigator can then go ahead to divide the flatworms into two or more groups and then subject them to different environments. Other variables should also be kept constant in order to determine the effects that are only specific to the different environments only.
More on constant variables can be found here: https://brainly.com/question/474060
#SPJ1
Which of the following is a method of choice for achieving a sufficient level of microbial control in routine day to day situations? Sterilization of tools/instruments that come into contact with human tissues. Treatment of any materials both before and after they come into contact with human tissues to avoid spread of infectious agents. Washing and scrubbing with soaps and detergents. Irradiation of all products to sterilize them prior to use.
In routine day-to-day situations, the most effective method for achieving a sufficient level of microbial control is c. washing and scrubbing with soaps and detergents.
This approach is practical, cost-effective, and accessible to everyone, making it an ideal solution for everyday use in maintaining hygiene and reducing the risk of infection.
While other methods like sterilization of tools/instruments, treatment of materials before and after contact with human tissues, and irradiation of products can be highly effective in specific settings, they are not practical for everyday use. Sterilization and irradiation are typically reserved for critical medical and laboratory environments, where maintaining a sterile environment is crucial. Treatment of materials before and after contact with human tissues is also important in specific settings like hospitals but is not applicable in most day-to-day situations.
Washing and scrubbing with soaps and detergents, on the other hand, can be employed in various contexts such as personal hygiene, household cleaning, and food preparation. These practices are essential in preventing the spread of infectious agents and maintaining a healthy environment for everyone.
To learn more about microbial control, refer:-
https://brainly.com/question/9121417
#SPJ11
What are the three things all cells have in common?
Baby Brain Power
How does the bar graph on page 5 expand on
information presented in the passage?
It shows exactly how many synapses a person's
brain has at birth
Speech, emotional regulation, movement, and
vision-all of these extraordinary abilities and
many more are possible thanks to the organ
that serves as the body's control center. When
one thinks of "brain power, it is the faces of
adult inventors, professors, and novelists that
Ekely come to mind. Remarkably the most
critical time period with respect to brain
development occurs relatively soon after an
individual is bom.
A newborn enters the world as a fairly helpless
creature, but her brain hos billions upon
bitions of specialized cells coiled neurons.
It gives more information than the passage by
showing that the number of synapses returns to
what it was at birth.
It provides specific information about how many
synaptic connections are formed in each year of a
person's life.
It gives information about synaptic connections
beyond the time period described in the passage.
2
3
4
5
Answer:
C
Explanation:
Took it
define sublimation
Answer:
Explanation:
its where u turn a object in it's solid state directly to gas, without it entering the liquid state
Why would organisms evolve to HAVE vestigial body parts
Explanation:
Structures that have lost their use through evolution are called vestigial structures. They provide evidence for evolution because they suggest that an organism changed from using the structure to not using the structure, or using it for a different purpose..
Hope it will help :)
Most fresh water fish are hypertonic, meaning their body cells contain more salt than the surrounding water. Since osmosis should push water into their cells, why don't they explode? They don'Ât drink any water because they get so much from osmosis. They have adapted to live with high osmotic pressure. They urinate a lot, so the water does not build up. Their cells have adapted to absorb salt. All of the above
Answer:
They urinate a lot, so the water does not build up.
Explanation:
Freshwater fishes are fishes that live in freshwater habitat i.e. little or no salt. This means that the fishes are hypertonic (have more salt) to their external environment. Due to their hypertonicity, freshwater fishes tend to take in more water via osmosis.
Freshwater fishes, however, do not explode despite this phenomenon because they pass out the excess water via urine waste. Freshwater fishes urinate a lot, hence, the absorbed water does not build up in their bodies.
Describe the difference between a organism that is a consumer and an organism that is a producer
Answer:
Consumer: a person or thing that eats or uses something.
Producer: an organism that produces. (makes) its own food.
Explanation:
Hope that helps buddy :)
What kinds of environmental factors might cause the Marfan syndrome gene to affect two siblings very differently?
(a) The importance of studying international accounting has grown over the years. Briefly discuss the reasons for the growth of international accounting in recent years. (b) Culture encompasses the values and attitudes shared by a society. Analyse how the culture of a nation influences domestic and international accounting.
(a)The growth of international accounting in recent years can be attributed to several factors; Globalization, Stakeholder Demands, Regulatory Pressure. (b) Here are some ways in which culture impacts accounting; Accounting Principles and Practices, Regulatory Environment, Ethical Considerations.
Globalization: With the increasing interconnectedness of economies and the expansion of multinational companies, there is a growing need for a standardized accounting framework that can facilitate cross-border transactions and ensure consistency in financial reporting.
Investor and Stakeholder Demands: Investors and stakeholders have become more globally focused, seeking investment opportunities and partnerships in foreign markets. These stakeholders require reliable and transparent financial information to make informed decisions, leading to the need for international accounting standards.
Regulatory Pressure: Governments and regulatory bodies worldwide are recognizing the importance of harmonized accounting standards to promote transparency, accountability, and comparability.
The culture of a nation significantly influences both domestic and international accounting practices. Here are some ways;
Accounting Principles and Practices: Culture shapes the underlying values, beliefs, and norms of a society, which in turn influence the development and application of accounting principles and practices. For example, cultures that prioritize individualism may have accounting systems that focus on individual financial performance, while collectivist cultures may emphasize the community or group's financial well-being.
Legal and Regulatory Environment: Culture influences the legal and regulatory framework within which accounting operates. Different cultures may have varying levels of acceptance for transparency, disclosure, and enforcement of accounting standards.
Ethical Considerations: Culture shapes ethical norms and values, which influence accounting decisions and practices. What may be considered acceptable ethical behavior in one culture may be viewed differently in another culture.
To know more about international accounting here
https://brainly.com/question/28455766
#SPJ4
All the organisms and their physical and chemical environment within a specific area best describe ________.
The definition 'All the organisms and their physical and chemical environment within a specific area' best describes the ecosystems.
What are ecosystems?Ecosystems can be defined as particular geographic areas that exhibit certain abiotic factors which interact with a community (i.e., a group of populations) to shape the environment.
In conclusion, the definition 'All the organisms and their physical and chemical environment within a specific area' best describes the ecosystems.
Learn more about ecosystems here:
https://brainly.com/question/842527
#SPJ1
Jerry is recording the amount of daylight his town receives throughout the month of September. He records the data each Monday of the month. His results are shown in the table below.
According to Jerry's data, the amount of daylight is getting shorter. If this pattern holds, daytime hours will continue to shorten, and nighttime hours will lengthen.
How does the timing of day and night change?During the observations, Jerry is recording the amount of daylight his town receives throughout the month of September.
The length of day and night on the surface of the earth varies from season to season due to the axial tilt of the earth's rotation axis with regard to its orbital axis.
Therefore, the length of the nighttime will increase the next week is the prediction according to Jerry's data.
Learn more about daylight, here:
https://brainly.com/question/17267903
#SPJ1
The given question is incomplete, so the most probable complete question is,
Jerry is recording the amount of daylight his town receives throughout the month of September. He records the data each Monday of the month. His results are shown in the table below.
Hours of Daylight Received
Week Hours of Daylight
1 8.34
2 8.12
3 7.98
4 7.63
Which of the following predictions is supported by the data Jerry collected?
A. The amount of daylight will increase the next month.
B. The length of the nighttime will increase the next week.
C. The weather in Jerry's town will be hotter the next month.
D. The Sun will not rise until 8:00 A.M. the next week.
Diploid structures in moss life cycle Click on all of the boxes that label structures that are diploid in the moss life cycle
In the moss life cycle, the diploid structures are labeled as sporophytes and sporangium.
Mosses have a life cycle that alternates between two generations: the haploid gametophyte generation and the diploid sporophyte generation. The gametophyte generation produces haploid gametes, which fuse during fertilization to form a diploid zygote.
The zygote develops into a diploid sporophyte, which is dependent on the gametophyte for nutrition. The sporophyte consists of a foot, seta, and capsule. The capsule contains sporangium, which is a diploid structure that produces spores through meiosis. When the capsule bursts, the spores are released and germinate to form a new gametophyte generation.
To learn more about diploid follow the link:
brainly.com/question/24301939
#SPJ4
The complete question is:
What are the diploid structures in moss life cycle?
what 3 things are necessary for germination to begin
Water, oxygen and the right temperature are the three essential criteria for germination to begin.
An organism develops from a seed or spore through a process known as germination. The phrase is used to describe the emergence of a seedling from an angiosperm or gymnosperm seed, the development of a sporeling from a spore, such as a spore from a fungus, fern, or bacteria, and the development of a pollen tube from a seed plant's pollen grain.
The germination rate is a measure of the likelihood that seeds from a given plant species, variety, or seedlot will sprout over a specific time frame. It is a measurement of the germination time course and is typically stated as a percentage; for example, a germination rate of 85% means that, under ideal conditions, 85 out of every 100 seeds will likely germinate throughout the specified germination period.
To know more about germination
brainly.com/question/15976369
#SPJ4
Think about your own life, and the “scientific” inquiries that you’ve pursued. Can you think of examples where you have built on the knowledge of someone who came before you, and consciously taken it to the next step? Was this next step an improvement? Is there now a better understanding of this subject that you explored? Perhaps an activity you do is now more efficient, or you have created a better design? Write a paragraph about one or two of these experiences.
doesn't have to be a certain type of science.
Answer: A science fair.
Explanation: There was one time when I competed in a science fair, and it was a lot of fun. I learned many things and met many people. My experiment was on measuring the density of gelatin when at different temperatures and mixed with different solutions such as salt, sugar, milk, water, etc. This next step was an improvement because I learned many facts and a good lesson. All in all it was a great experience for everyone involved and everyone involved learned many things.
Research some ways in which scientists and engineers have harnessed and currently use the energy in fossil fuels to benefit society. Think about how these methods involve a chemical reaction and explain how energy is conserved. Describe one method of using fossil fuels for energy and state one advantage and disadvantage about this method. In your replies to others' comments, state whether you agree or disagree with the advantages and disadvantages they list and explain your reasoning.
Hint: Consider what happens to fossil fuels (such as coal, natural gas, and petroleum) when they are burned.
coal is a non renewable energy source it is produced from small sediments that compact and over time forms what is known as a peat then dye to hwat and pressure coal is formed as is sksbsksbsjdnsjndjdndndjdbdjbdjdjxndjdndjdbrhdhr
what are the many forms of energy? how is energy either potential of kinetic
Answer:
The different types of energy include thermal energy, radiant energy, chemical energy, nuclear energy, electrical energy, motion energy, sound energy, elastic energy and gravitational energy.
You need energy to do any work, which is why the ability to do any work is energy. Read that again. Potential and kinetic energy are two forms of energy that can be converted into each other. Potential energy can be converted to kinetic energy and vice versa.
Explanation:
What do you think would happen if you inoculated a new culture
with a wrinkly colony, grew the culture overnight, and then plated
a sample of the bacteria?
If you inoculate a new culture with a wrinkly colony, grow the culture overnight, and then plated a sample of the bacteria, you would expect to see two different types of colonies on the plate.
Wrinkly colonies are composed of bacterial cells that have mutated and lost the ability to produce a molecule known as cyclic diguanylate (c-di-GMP). As a result, the bacteria become sticky and adhere to one another, forming a dense mat of cells that resembles a wrinkled surface.
Bacterial colonies with normal morphology.The second type of colonies will resemble the typical morphology of the bacterial cells present in the culture before inoculating with the wrinkly colony. Because not all bacterial cells in the culture have the same mutation that created the wrinkly colony, you would expect to see colonies with a normal morphology as well.
To know more about wrinkly colony visit:
https://brainly.com/question/17668182
#SPJ11