A population of 346 field mice are sampled, revealing 288 black mice and 58 grey mice. The grey phenotype is dominant to the recessive black phenotype. Assuming Hardy-Weinberg equilibrium, what is the frequency of homozygous dominant individuals

Answers

Answer 1

The frequency of homozygous dominant individuals is approximately 0.0281, or 2.81%.

The frequency of homozygous dominant individuals can be calculated using the Hardy-Weinberg equilibrium equation.

In this case, the grey phenotype is dominant to the black phenotype. Let's denote the black phenotype as "b" and the grey phenotype as "B".

According to the information provided, there are 288 black mice and 58 grey mice in the sampled population of 346 mice.

To calculate the frequency of homozygous dominant individuals, we need to determine the frequency of the "B" allele.

Let's use the following variables:
- p: frequency of the dominant allele "B"
- q: frequency of the recessive allele "b"

The total frequency of the two alleles must equal 1, so p + q = 1.

Since the grey phenotype is dominant, the frequency of the dominant allele "B" is equal to the frequency of grey mice divided by the total population.

Therefore, p = 58/346 = 0.1677 (approximately).

Using the equation p + q = 1, we can substitute the value of p to find the frequency of the recessive allele "b".

Therefore, q = 1 - p

= 1 - 0.1677

= 0.8323 (approximately).

The frequency of homozygous dominant individuals (BB) can be calculated as p² (p squared).

So, (0.1677)² = 0.0281 (approximately).

Therefore, the frequency of homozygous dominant individuals is approximately 0.0281, or 2.81%.

Keep in mind that this calculation assumes the population is in Hardy-Weinberg equilibrium, which means there is no selection, mutation, migration, or genetic drift occurring.

To know more about homozygous visit:

https://brainly.com/question/30622664

#SPJ11


Related Questions

What new idea about succession came from studying the eruptions of mount saint helens?.

Answers

The new idea about succession came from studying the eruptions of mount saint Helen would be both biological ancestors and alien species play a role in succession.

The term "primary succession" refers to succession that starts in a location devoid of any remains of a previous society. As an illustration, an erupting volcano at Mount Saint Helens, Washington, wiped out all local life. There will be long-lasting changes in this neighborhood. Earth tremors focused on the ground beneath the mountain's north flank signaled the start of the audible volcanic activity.

As these tremors intensified, Mount St. Helens started to release steam and ash via its crater and vents, resulting in a small eruption on March 27. The surrounding volcanoes, which have not erupted in recorded history, will either have minimal or no impact on the chance of an eruption.

 

Learn to know more about Succession on

https://brainly.com/question/10167897

#SPJ4

How far does light travel in 1.2 second?
Express your answer to two significant figures and include the
appropriate units.

Answers

In 1.2 seconds, light travels approximately \(3.6 \times 10^8\) meters, or about 360,000 kilometers. This calculation is based on the speed of light in a vacuum, which is approximately 299,792,458 meters per second. This distance is significant and equivalent to the average distance between the Earth and the Moon.

In 1.2 seconds, light travels approximately \(3.6 \times 10^8\) meters, which is equivalent to 360,000 kilometers or about 223,700 miles. This calculation is based on the speed of light in a vacuum, which is approximately 299,792,458 meters per second.

To find the distance traveled by light in 1.2 seconds, we multiply the speed of light by the time taken: (299,792,458 meters/second) x (1.2 seconds) = 359,751,049.6 meters.

When rounding to two significant figures, the value becomes \(3.6 \times 10^8\)meters. This scientific notation indicates that the number is multiplied by 10 raised to the power of 8, meaning we move the decimal point 8 places to the right.

To put it into perspective, this distance is roughly equal to the average distance between the Earth and the Moon, which is about 384,400 kilometers (238,900 miles). Therefore, in 1.2 seconds, light can travel a substantial distance across the vastness of space.

To know more about light refer here:

https://brainly.com/question/20163140#

#SPJ11

In a certain state, electricity is generated by using the earths heat. Wells drilled and natural steam is taken out through pipes. This natural steam powers the generator and the electricity generated. What type of energy is being used and what type of power plants are set up for harnessing this renewable energy?

Answers

Answer:

Geothermal

Explanation:

The geothermal energy is generated by the Earth's core that is a region with extremely high temperatures. The heat makes the geothermal power plants to work and thus generate energy from it.

the outer segment of each rod contains which, when hit by light, begin(s) chemical reactions in the rod's synapses with retina neurons that eventually transmit information to the brain.. a)derivative of vitamin c. b)rhodopsin c)free nerve endings d)pheromones

Answers

Rhodopsin, which is found in the outer segment of each rod, reacts chemically with retinal cells at the rod's synapses to transfer information to the brain when exposed to light.

What components make up a rod cell?

Rod cells have an inner segment and an outer segment, just as cones. The synaptic terminal connects to another neuron, typically a horizontal or bipolar cell. A cilium that lines the distal segment connects the inner and outer segments.

How can photopigments trigger synapse activation?

When photopigments are activated by light, the rod cell becomes hyperpolarized, which prevents it from delivering its neurotransmitter. As a result, the bipolar cell releases its transmitter at the bipolar-ganglion synapse, stimulating the synapse.

To learn more about rhodopsin visit:

brainly.com/question/29033375

#SPJ4

Unicellular organisms have different structures from each other.Explain why.

Answers

Answer:

The reason why is because in the process of reproduction; there are some mistakes in DNA replication (out of billions of base pairs about 120,000 mistakes). This is what brings us so much variation in organisms.

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Answers

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

Zebrafish (Danio rerio) is an important model organism in the field of genetics. One of the first mutant genes to be studied in this species was golden. The mutant allele was discovered in a pigmentation mutant purchased from a pet store, which changed the color of the fish from the wild-type silver-white coloration to a pale golden color. Calculate the percent likelihood of golden offspring from a cross between a heterozygous wild-type male fish to a golden female fish a 0% b 50% c 25% d 100%

Answers

Answer:

b

Explanation:

Let the wild type trait, the silver-white, be represented by A allele and the mutant trait, the golden color, be represented by a allele.

Heterozygous wild-type male fish would be Aa

Golden female fish would be aa

     Aa    x    aa

  Aa   Aa    aa    aa

2/4 Aa = silver-white

2/4 aa = golden color

Hence, the percent likelihood of golden offspring is 2/4 or 50%.

The correct option is b.

do you think you found most of the species in habitat? what evidence supports your conclusion

Answers

In general, it is unlikely that all the species in a habitat have been found or discovered.

The total number of species on the planet is not known, and new species are still being discovered, particularly in remote or inaccessible areas.

Moreover, the discovery of new species requires extensive and continuous exploration, observation, and documentation, which can be a challenging and time-consuming process.

Many species may remain undiscovered, particularly those that are small, elusive, or have restricted ranges.

In conclusion, it is unlikely that all the species in a habitat have been found or discovered. Continued exploration, research, and observation are required to uncover the biodiversity of a habitat fully.

To know more about biodiversity click on below link:

https://brainly.com/question/13073382#

#SPJ11

Name the 5 characteristics of a mineral

Answers

Answer:

They are natural, inorganic, solid, and are chemical composition and have a crystalline structure.

Match each word to it's correct meaning.

1. energy
force moving an object through a distance
2. joule
unit of measurement for mechanical energy
3. kinetic energy
weight hanging from a point and free to swing
4. mechanical energy
energy of a moving object
5. pendulum
stored energy
6. potential energy
kinetic and potential energy
7. work
ability to do work

Answers

energy - ability to do work
joule - unit of measurement for mechanical energy
kinetic energy - energy of a moving object
mechanical energy - kinetic and potential energy
pendulum - weight hanging from a point and free to swing
potential energy - stored energy
work - force moving an object through a distance

What do you call the items that enchanced the beauty of the products?

Answers

The items that enhance the beauty of products are commonly referred to as decorative or ornamental elements.

These elements are often used to improve the visual appeal of a product and make it more attractive to potential customers. Examples of decorative elements include various forms of artwork, embellishments, patterns, and colors. These items can be added to many different types of products, including clothing, accessories, furniture, and home decor.

They are often used to create a unique or personalized look, as well as to make the product more appealing to specific target markets. The use of decorative elements can help to increase the perceived value of a product and make it more desirable to consumers.

Learn more about decorative elements

https://brainly.com/question/31325035

#SPJ4

Which of the following vessels gives rise to the common hepatic artery, left gastric artery, and splenic artery?
-intestinal arteries
-celiac trunk
-superior mesenteric artery
-superior epigastric artery

Answers

The celiac trunk arteries give rise to the hepatic artery, left gastric artery, and splenic artery.

What artery splits into the common hepatic artery and left gastric artery?

The arteries that supply the stomach are principally controlled by the celiac axis. The normal branch of the celiac axis, which arises from the proximal abdominal aorta, are the normal hepatic, splenic, and left gastric arteries.

What are the hepatic artery left stomach and splenic arteries?

The branch of the celiac artery are the typical hepatic, left gastrointestinal, and splenic arteries. The liver, gall, stomachs, pancreatic, spleen, and a portion of the duodenum are only a few of the organ that make it up the embryo foregut and are supplied with blood by these branches.

To know more about gastric visit:

https://brainly.com/question/13062134

#SPJ1

In this exercise, you've learned of dna profiling and its practical benefits in forensic science. genome editing is another area of importance that is widely popular in today's society. after watching video 2 of 3, how does this technique differ from the profiling method, and what are the advantages of editing our genetic sequences? (answer should be more than two sentences)

Answers

In genome editing, the individual gene is altered, whereas in profiling there will be no alteration.

What is DNA profiling?

DNA profiling involves analyzing the individual's genome for distinctive patterns of DNA sequences. Forensic sciences, it is frequently employed.

- STR patterns are widely focused.

- A polymerase chain reaction is used to multiply the sample provided along with the STR sequences.

- This DNA profiling also makes it possible to identify parents.

What is Genome Editing?

Genome editing involves altering an organism's DNA.

- The genetic material could be added, altered, or removed through this genome editing.

Genome editing differs from the profiling method. In genome editing, the individual gene is altered, whereas in profiling there will be no alteration.

The advantages of editing our genetic sequences are:

- treatment of diseases,

- development of transgenic foods,

- development of disease-resistant crops,

- Life span expansion

Know more about genome editing, visit:

https://brainly.com/question/17065423

#SPJ4

what would be the complementary DNA strand for the following sequence: A-G-C-T-G-G-A-C-T ?

Answers

I’m not entirely sure. So I’m sorry if it’s wrong but I think this is the correct answer:
T-C-G-A-C-C-T-G-A
(Becsuse every letter will be the opposite of its match. So I’m the sequence when it says A, you would replace it with T (because A goes with T) , and when it says G you would replace it with C (because G always goes with C)

Wildlife management Damage from the choices presented below. fox killing a rabbit


A raccoon eating three ears of corn


A coyote eating neighborhood house cats


A muskrat in an urban window

Answers

Wildlife management typically involves finding ways to strike a balance between the needs and behaviors of wild animals and human activities. In the examples you provided:

What is wildlife management?

Fox killing a rabbit: This is a natural and normal behavior for foxes, and they are important predators in many ecosystems. In most cases, it is not necessary or desirable to intervene in these interactions. However, if there are concerns about the overpopulation of rabbits or other ecological factors, a wildlife biologist or other expert may be consulted to assess the situation and recommend appropriate management strategies.

Raccoon eating three ears of corn: Raccoons are opportunistic feeders and will eat a wide variety of foods, including crops like corn. If the damage is minimal, it may be sufficient to simply tolerate the presence of raccoons and take steps to prevent future damage (such as securing the corn or using deterrents). In cases where the damage is severe or persistent, other strategies such as trapping or relocation may be necessary. However, it is important to note that these methods can be controversial and should only be carried out by licensed professionals.

Coyote-eating neighborhood house cats: Coyotes are native predators that play an important role in many ecosystems. However, conflicts can arise when they prey on pets or livestock. To reduce these conflicts, it is important to keep pets indoors or supervised when outside, and to remove attractants such as garbage or pet food. In some cases, it may be necessary to remove individual problem coyotes or implement other management strategies.

Muskrat in an urban window: Muskrats are semi-aquatic rodents that are adapted to wetland habitats. Finding one in an urban area is unusual, and may indicate that the animal is lost or displaced. In this case, the best approach would be to contact a local wildlife rehabilitator or animal control agency to assess the situation and determine the most appropriate course of action. It is important to handle wild animals with care and to avoid touching or approaching them, as they can carry diseases and may become aggressive if frightened or cornered.

Learn more about wildlife

brainly.com/question/27180478

#SPJ11

PLace the steps of Shock Treament in order.


-Airway Management
-BSI
-Control Bleeding
-Cover to prevent heat loss
-Elevate Extremities
-Transport

Answers

Shock Treatment in order is BSI, Control Bleeding, Airway Management, Elevate Extremities, Cover to prevent heat loss, and finally Transport as shock treatment may vary depending on the specific circumstances and protocols that are followed by healthcare providers such as doctors or nurses or emergency responders. 

BSI ensure personal protection by wearing appropriate globes, goggles, masks etc and that is for prevention of the transmission of infectious diseases. Airway management is present to assess the patient's airway and ensure that it is clear and open. And, If necessary, then provide airway support or assist with ventilation to maintain adequate oxygenation.

Learn more about bleeding here.

https://brainly.com/question/32109251

#SPJ1

Sister chromatids present at metaphase ii might not be genetically identical to each other because.

Answers

Answer:

of crossing over events taking place during meiosis I.

as they walked through the haunted house, every room heightened their fear and anxiety. the walls of one room moved to close in around them, while in another they had to lie in coffins, which then opened up beneath them. which division of their ans was most active, and which neurotransmitter(s) would be involved in this pathway? select all that apply.

Answers

The sympathetic nervous system (SNS) is likely most active during the haunted house experience. The SNS is the part of the autonomic nervous system that activates the body's "fight-or-flight" response.

This response causes a release of the neurotransmitters adrenaline and noradrenaline, resulting in increased heart rate, sweating, and other physiological changes.

In addition, other neurotransmitters such as dopamine and serotonin may also be involved. Dopamine is typically involved in feelings of pleasure, but when released too quickly or in large quantities it can cause feelings of fear. Serotonin is linked to feelings of well-being, but it can also be involved in feelings of anxiety.

know more about sympathetic nervous system here

https://brainly.com/question/28485355#

#SPJ11

As they walked through the haunted house, every room heightened their fear and anxiety. the walls of one room moved to close in around them, while in another they had to lie in coffins, which then opened up beneath them. which division of their answer was most active, and which neurotransmitter(s) would be involved in this pathway? select all that apply.

A. sympathetic nervous system

B. Central nervous system

C. Peripheral nervous system

D. none

What happens during systemic gas exchange?

Answers

Systemic gas exchange refers to the process of exchanging gases, specifically oxygen (O2) and carbon dioxide (CO2), between the blood and the tissues in the body.

It occurs in the capillaries throughout the systemic circulation. During systemic gas exchange, the following events take place:

Oxygen Diffusion: Oxygen-rich blood from the lungs is pumped by the heart into the systemic arteries, delivering oxygen to the body's tissues. In the capillaries, the partial pressure of oxygen in the blood is higher than in the surrounding tissues. As a result, oxygen diffuses from the capillaries into the interstitial fluid and then into the cells. This process is driven by the concentration gradient.

Carbon Dioxide Diffusion: At the cellular level, the metabolic process of cellular respiration generates carbon dioxide as a waste product. Carbon dioxide diffuses out of the cells into the interstitial fluid, and then into the capillaries. The partial pressure of carbon dioxide is higher in the tissues compared to the blood, facilitating its diffusion into the blood.

Oxygen Binding to Hemoglobin: Within the red blood cells, oxygen molecules bind to hemoglobin, a protein present in the red blood cell. This allows for efficient transport of oxygen from the lungs to the tissues.

Carbon Dioxide Transport: Most of the carbon dioxide produced by the cells is transported in the blood as bicarbonate ions (HCO3-) dissolved in the plasma. Carbon dioxide also combines with hemoglobin, forming a compound called carbaminohemoglobin, which contributes to carbon dioxide transport.

Return of Deoxygenated Blood: As oxygen is released from the red blood cells, the blood becomes deoxygenated. The deoxygenated blood is then carried back to the heart through the systemic veins to be pumped back to the lungs for reoxygenation.

Overall, systemic gas exchange ensures that oxygen is delivered to the tissues for cellular respiration and that carbon dioxide, a waste product, is efficiently removed from the tissues. This exchange is essential for the proper functioning of cells and organs throughout the body.

Here you can learn more about Systemic gas exchange

https://brainly.com/question/29544297#

#SPJ11  

2 Which substance, needed for protein synthesis, is carried into a leaf from the stem? A carbon dioxide B nitrate C oxygen D starch​

Answers

The substance, needed for protein synthesis, that is carried into a leaf from the stem is nitrate. Nitrate is an essential nutrient that plants use to produce amino acids and proteins. It is a part of the nitrogen cycle and is used in chloroplasts to create essential proteins.Option B is correct

The process of protein synthesis takes place in chloroplasts of the leaves of plants where nitrogen, along with other elements, is utilized to produce proteins. Nitrogen, in the form of nitrate, is an essential element required by the plant for the synthesis of amino acids and proteins.

Plants obtain nitrate through the soil from the water they absorb through their roots. It is transported from the roots to the leaves through the xylem vessels, which form a continuous pipeline from the roots to the stem and leaves of the plant. The process of protein synthesis is important for the growth and development of plants.

It is essential for the production of enzymes, hormones, and structural components such as cell walls and membranes. Nitrate is, therefore, a critical substance for protein synthesis and the growth and development of plants. Option B is correct

For more such questions on nitrate

https://brainly.com/question/28884348

#SPJ8

WBC count that can cause turbidity in the cyanmethemoglobin method resulting to falsely high hemoglobin value:_____.

Answers

A very high WBC count can lead to turbidity in the cyanmethemoglobin method resulting in falsely high hemoglobin value.

Cyanmethemoglobin method is a method which is used for the estimation of hemoglobin. In this method, hemoglobin is converted to cyanmethemoglobin by adding ferricyanide and potassium cyanide. The absorbance is then measured at 540nm using a spectrophotometer.

This is a very advantageous method as it is able to measure all forms of hemoglobin except sulphaemoglonin and also since spectrophotometer is used, subjective errors are avoided. But, if the WBC count is very high, it can lead to turbidity in the cyanmethemoglobin method resulting in falsely high hemoglobin value.

To learn more about hemoglobin here

brainly.com/question/15011428

#SPJ4

Write on meiosis and mitosis; relevances and the processes.

Answers

Answer:

Mitosis is the process of cell division usually dedicated to cell growth or asexual reproduction. There are five phases of mitosis, which include prophase, prometaphase, metaphase, anaphase, and telophase. These phases are followed by cytokinesis. The end product of mitosis is two diploid daughter cells that are genetically identical to the mother cell.

Meiosis is the process of cell division that is dedicated to sexual reproduction. Meiosis occurs in two parts, which the same phases of mitosis that are essentially repeated twice. Meiosis increases genetic diversity due to crossing over and independent assortment that occurs during meiosis 1. The end product of meiosis are four haploid cells that originated from one mother cell.

Explanation:

the building blocks of a habitat consist of _ factors

Answers

Answer:

The building blocks of a habitat consist of environmental factors

What is the answer to this question

What is the answer to this question

Answers

Answer:

Differentiation

Explanation:

It is differentiation

And object is 20 cm from the lens. The image from 6.66667 cm from the length. What is the focal length of the lens? Use the thin lens equation

And object is 20 cm from the lens. The image from 6.66667 cm from the length. What is the focal length

Answers

Answer:

5

Explanation:

The object distance Is 20 I'm

The image distance is 6.666

Therefore the focal length can be calculated as follows

1/f = 1/20 + 1/6.66

= 6.66+20/133.2

= 26.66/133.2

1/f= 26.66/133.2

f = 133.2/26.66

= 4.99

= 5

Hence the focal length is 5

Describe a situation in which an area with a high diversity index is healthier than an area with a low diversity index.

(a) Describe how an organism reproduces by budding.

(b) State one advantage of this type of Reproduction.

Give an example of a generalist that lives in Canada. Explain why this species is able to have a broad niche.

Give an example of a behavioural adaptation and an example of a structural adaptation. How is each adaptation suited for a specific niche?

Answers

A  situation in which an area with a high diversity index is healthier than an area with a low diversity index is an ecological niche filled with tall trees that has high richness in nutrients and also evenness in growth while  another ecological niche filled with the same trees that has only few species that has low richness and and low evenness.

How does  organism reproduces by budding?

An asexual method of making new organisms is budding. A new organism is created in this procedure from a tiny fragment of the parent organism. A newly created bud separates to grow into a new organism. As it continues to develop, the freshly formed organism is still attached.

The benefits of sexual reproduction include the offspring's genetic diversity. The species has a survival advantage because of its ability to adapt to new surroundings. A illness has a lower likelihood of affecting the entire population.

The Canada lynx (Lynx canadensis), which feeds on snowshoe hare, is an illustration of a carnivorous specialist.

An organism has a wide niche if it has adapted to a wide variety of environmental conditions in order to survive. The creature can exist in a variety of diverse situations based on its extensive range of adaptations and survival abilities.

Examples of structural adaptations include an organism's physical traits, such the bill of a bird or the fur of a bear. The remainder consists of behavioral modifications. Behavioral adaptations are used by organisms to help them survive. Calls and migration are two examples of behavioral adaptations in birds.

Because natural selection is the process that leads to this, the adaptation is suitable for a certain niche. A species' nature gradually changes as a result of natural selection in order for it to fit into the niche. If a species becomes extraordinarily well adapted to its habitat and the environment does not change, it can survive for a very long time before going extinct.

Learn more about diversity index  from

https://brainly.com/question/1542287
#SPJ1

In poultry, black is dominant to white, but the heterozygote is blue. If you consistently

eliminated the black and white birds which appear in your flock of Blue Andalusians, how many

generations of such selection would it take to produce a true breeding flock of Blue

Andalusions?

Answers

Answer:

indeterminate

Explanation:

The answer would be an indeterminate number of generations.

The blue trait is a heterozygous trait. In other words, the blue allele does not really exist. Two different alleles team up to produce the trait, whereas, only two the same allelic conditions can produce a true-breeding flock.

Hence, it will take an indeterminate number of generations to produce a true-breeding flock of the Blue Andalusions.

For the location and time interval represented by these rock layers, when did the most drastic and sudden change in life forms occur?
A.
376 million years ago
B.
370 million years ago
C.
360 million years ago
D.
382 million years ago

Answers

Answer:

D

Explanation:

i honestly don't know but here is my answer

Answer: ITS 360!!!!!!!!

Explanation: 382 IS WRONG!!!!!!!

100 POINTS + BRAINLIEST

Which description properly describes a step involved in cellular respiration?

A.) Glucose is created, then the energy gained is transferred to the energy molecule.
B.) Carbon dioxide is combined with oxygen to make glucose.
C.) Water is divided into carbon dioxide and glucose.
D.)Oxygen is combined with the carbon atoms left from the glucose molecule.

Answers

Answer:

i think it's B

couse from my knowledge is that respiration is the intake of carbon dioxide and form it into oxygen

Carbon dioxide is combined with oxygen to make glucose.

Explanation:

Carbon dioxide is combined with oxygen to make glucose description properly describes a step involved in cellular respiration

Differentiate between rank and taxon

Answers

Answer:

A taxon is not an organism, but it’s rather any grouping one can distinguish. It is a taxonomic group or unit. A group of organisms that belongs together as per taxonomists. A taxon differs in sizes an example of big one is the beetles and a small one would be the giraffes.

Rank is simply the level of a taxon in the taxonomic heirarchy .

Other Questions
3 meters of cloth is the ratio of 3:7 21c Skills 5: Digital FluencyUnderstands the appropriate technology tools to workcollaboratively in person and remotely.Has basic knowledg state weather each equation or is a linear function. write yes or no. explain.3y-4x=20 Do you lose your license immediately after a DUI in Florida?. 4 ) Sal bought 2 shirts and pants. Sal remembers each shirt was 10 dollars, and the total was 50 dollars Which equation helps answer the equation: How much were the pants? b. 10 + 10 + x = 50 . x = 50 + 10 d 10 + 10 = 50 + x a . 10 + x = 50 the halo effect and confirmation bias are two forms of bias that might impact whether or not we believe a news source based on what we want to believe. How do you think this percentage would compare to that of manufacturing corporations? How would you explain this difference? I NEED HELP PLEASEEEEE15,956 79,067 = The exponential growth and decay model describes the amount of a particular drug in a patient's bloodstream a certain time after the drug was given to the patient. the amount of this drug in the bloodsteam decreases at a rate of 39% per hour. if 6 units of this drug were given to the patient 2. 5 hours ago, then how many units remain in his bloodstream now? round your answer to 3 places after the decimal point (if necessary) is the absolute value of an integral always less than integral of absolute value for lebesgue integrals xwhich substance is a colloid? multiple choice mayonnaise iced tea milk of magnesia gasoline italian salad dressing During periods when costs are rising and inventory quantities are stable, cost of goods sold will be: o higher under fifo than average cost.o higher under fifo than lifo. o lower under lifo than fifo.o lower under average cost than lifo. Please help me with this problem and if you can show your work NEED ANSWERS ASAP TO THSESE FIVE QUESTIONS 80 POINTS1. Which sentence contains a word choice error?A. Whenever the cat howls, we know it wants to be fed right away.B. Sometimes the cat cannot decide among going out or staying inside.C. The cat likes to go out at any time it pleases and lets us know by crying.D. The cat likes to climb the tree but often gets stuck and needs help.2. Which sentence contains a word choice error?A. It is unclear weather the rain will continue or not this week.B. As the cold front continues throughout the day, rain will be heavy.C. Today will be rainy, but tomorrow will have abundant sunshine.D. The rain should have stopped by now according to the news report.3. Select the correct answer.Which sentence contains a word choice error?The mother was angry with1 her child for breaking the screen door.The man left a customary2 tip for the services rendered.The manager was not angry at3 the night shift because of the delay.The team was all ready4 for the opening game.A. 1B. 2C. 3D. 44. Which sentence contains a word choice error?A. Concerts in the park seem to be more enjoyable than going to an auditorium.B. The orchestra concert last night was the best one I have been to this year.C. We have decided to go see the concert anywhere despite the distance.D. The cello player was the lead for the main piece, and she played beautifully.5. Which sentence contains a word choice error?The salesman has no desire to go anywheres1 on his vacation.I would be willing to go anywhere2.They did everything3 when they went to Six Flags.Everyone4 on the tour visited the White House.A. 1B. 2C. 3D. 4 Ryan has a major problem of overspending from each of his paychecks, even though his ultimate goal is to be saving money for college. His friend Sydney says Ryan's problem is that he's too worried about "keeping up with the Joneses." What does Sydney mean by this?A.Ryan's college savings goals are too lofty, which is why he can't achieve themB.Ryan is buying too many material things or spending too much on experiences so that he feels on par with his peersC.Ryan is imitating a famously wealthy family -- the Joneses -- from American historyD.Ryan doesn't know the 50-20-30 rule for budgeting, so he needs to take a financial management class like the fictitious "Jones" family would do in this situation What principle made Seward want to purchase Alaska for the US? A. Yellow Journalism B. Roosevelt Corollary C. Monroe Doctrine D. Treaty of Paris true or false: a minimum wage below $10 per hour is not a binding minimum wage in this labor market. Classify each of the following reactions as a precipitation, acid-base neutralization, or oxidation reduction Drag the appropriate items to their respective bins. 2HCN (aq) + Ca(OH),(aq) Ca(CN)2(aq) + 2H2O(1) NICI, (n) + Na,(na) - NIS(8) +2NaCl(aq) S:($)+80,(B) +880,() Precipitation Acid-base neutralization Oxidation reduction define a function swaprank() that takes two char parameters passed by reference and swap the values in the two parameters. the function does not return any value. ex: if the input is b c, then the output is: c b What did people plant to increase food production at home? Please help me:( I need help with this and it's very hard.Here are the pick things: Crunchy cropsFlower bedsVictory gardens Winning gardens