In this situation, Mrs. Bain is using the cross-linguistic transfer strategy to encourage English acquisition for the new ELL student in her second-grade classroom. By researching similarities between the first and second languages and providing English reading and writing lessons that capitalize on these similarities, she is helping the student progress in their English language learning journey.
Mrs. Bain is using the strategy of utilizing the student's first language to aid in English acquisition. This approach is known as the "native language support" strategy, which involves identifying and utilizing similarities between the student's first language and English to facilitate learning. By providing English reading and writing lessons that capitalize on these similarities, Mrs. Bain is helping the new ell student make connections and transfer skills from their first language to English. This can help the student progress faster in their English language acquisition and overall academic success.
Learn More about languages here :-
https://brainly.com/question/900191
#SPJ11
An aero plane is likely to take off much earlier than expected when the speed of the wind blowing
in opposite direction to Its motion on the runway Suddenly increase. Explain.
please help me
The airplane's motion on the runway Suddenly increases, Because before takeoff to gain enough speed for the plane to lift up into the air. Most airplanes can take off only if they are moving fast enough.
What is motion?The term motion refers to that, The change in the position or the orientation of a body. Along a line or a curve is called translation. Motion that changes the orientation of a body is called rotation. There is the motion of an object with some mass can be described in terms of the following: Distance.
As a result, of the motion. The pilots always take off in the direction opposite to the direction of the wind flow. This helps because the aircraft gets an additional lift from the wind other than the speed of the aircraft itself
Therefore, By moving in the opposite direction, gets an additional lift from the wind other than the speed of the aircraft
Learn more about the motion here:
https://brainly.com/question/22810476
#SPJ2
13. What was a result of the fall of the Western Roman Empire?
A. Weaker religion
O B. Smaller cities
O C. Higher literacy
O D. Centralized rule
Answer:
C
Explanation:
hope this helps!
PLZ HELP!!!!!
Why should president Trump be impeached based on the events of January 6th, 2021?
This is for an assignment my teacher gave me. I don´t want ppl going against me for posting this but I really need help. So yeah :D
I´ll put to articles links below in rhe comments
Answer
The reason President Trump should be impeached is the natural turn of events that has been happening by Trump himself, he has instigated Trump supporters to go into the U.S. Capitol to try to get "his votes back", made even more posts on Twitter that are fake and more fraudulent. Trump tweeted so much stuff that he got all of his accounts either banned permanently or temporarily. Which comes to my conclusion, Trump should be impeached AGAIN because of the way he deals with stuff in this country.
Hope this helps! <3
#TeamTrees
What explorer was known for exploring canada up to the arctic ocean and was the first european to explore canada to the pacific ocean 12 years before the similar journey done by lewis and clark?.
Sir Alexander Mackenzie was the first European to explore Canada to the Pacific Ocean, 12 years before Lewis and Clark made a comparable expedition. The explorer is renowned for exploring Canada up to the Arctic Ocean.
Fur trader and explorer Sir Alexander Mackenzie (born around 1764 near Stornoway, Scotland; died 12 March 1820 near Dunkeld, Scotland). One of Canada's finest explorers was Mackenzie. He traversed the rugged northern wilderness twice for the North West Company, in 1789 and 1793, to reach the Arctic and Pacific Oceans. He served as an inspiration for other explorers and traders, including the renowned Lewis and Clark expedition, which was supported by the American military. He was the first European to cross North America north of Mexico (1804–6). the river Mackenzie.
Learn more about Sir Alexander Mackenzie https://brainly.com/question/17040880
#SPJ4
Which of the following are advantages to working in health care?
O Helping people and the community
O Excellent career stability
O Many career choices
O All of the above
I believe it's all of the above. Hopefully this helps!
which of the following is part of the synthesis view of fiscal policy with which both keynesian and classical economists agree?
Automatic stabilizers help reduce the fluctuations in aggregate demand and output is part of the synthesis view of fiscal policy with which both Keynesian and classical economists agree.
Aggregate demand is a measure of aggregate demand for all finished goods and services produced in an economy. Aggregate demand is expressed as the total amount exchanged for those goods and services at a particular price level and point in time.
In macroeconomics, aggregate demand, or domestic final demand, is the aggregate demand for final goods and services in the economy at a particular point in time. This is often called effective demand, but the term is sometimes differentiated. This is the demand for the Gross Domestic Product of the country.
Aggregate demand, however, takes the sum of the markets for the individual products and services that the economy produces and expresses it as a total dollar value. For example, a country may have a total demand for goods and services of $1 billion annually.
Learn more about Aggregate demand https://brainly.com/question/1490249
#SPJ4
A chili pepper plant that produces fruit with a low level of capsaicin is grown in a season that experiences a drought. How might the drought conditions affect the amount of capsaicin in the fruit?
The drought conditions may cause the chili pepper plant to produce fruit with a higher level of capsaicin.
Chilli peppers, also known as chlli in Nahuatl, are cultivated for their the spicy flavour and are several types of the berry-fruit growing plants in the genus Capsicum, a member of the family of nightshade plants Solanaceae. Chilli peppers, which are herbs in the genus Capsicum, contain the active ingredient capsaicin. It causes scorching pain in any tissue it comes into touch with and is a chemical irritation and neurotoxic for mammals, including humans.
This is because capsaicin is a compound that the plant produces to protect itself from predators and environmental stressors such as drought. Therefore, in response to the drought, the chili pepper plant may produce more capsaicin in its fruit as a defense mechanism.
To learn more about Chili Paper Plant, click here:
https://brainly.com/question/30881875
#SPJ11
I need to create an acrostic poem about the word: "COLONIALISM".
Please help. Thanks
Conquest of lands, imposing the rule
Over people and cultures, a colonial tool
Looting resources, exploiting the land
Oppression and exploitation, no justice at hand
Nations torn apart, a legacy still grandiose
Ignores the pain and suffering, the colonialism arose
Alive still, a reminder of past deeds
Sorrow and anguish, the colonialism breeds
My heart weeps for the lives lost and shamed
Answer:
They came into the country
Robbing the people of the land of their freedom
They were enslaved in their own land
The colonizers showed no humility
Or respect for the people whose land they had taken away with the bullets and guns
Those weapons the had in their hands.
The people longed for freedom and joy
While those who had taken their land prayed that it would never end
And when the people tried to get back their freedom, lives were lost
With shame, the people buried their heads in the soil
And mourned the days when the joy seemed like it would never end
And there they vowed to get back what was lost.
The brought knives
To a battle of guns
But none of that mattered because they had hope for a new beginning
A beginning were there was peace
The warriors came with their children and wives
To fight against their colonizers who still had their guns
At last their was rejoicing and singing
Because it was a new beginning – a beginning of peace.
Write a writing promt about the physical geography of South Asia PLS ITS DUE RRLY SOON
(giving brainliest)
-tips and directions are the linked pic
what condition did dr. kayla boucher discuss in her interview where she suggested this condition is very often confused with a mental or physical disability?
The condition that Dr. Kayla Boucher discussed in her interview where she suggested this condition is very often confused with a mental or physical disability is an Autism spectrum condition.
Autism spectrum disorder is a developmental problem brought on by abnormalities in the brain. Confined or repetitive occupations or interests, as well as social involvement and communication, can be difficult for people with ASD. Additionally, individuals with ASD may move, pay attention, or learn in different ways.
It's crucial to keep in mind that some persons without ASD may also experience some of these symptoms. These traits, however, can make life extremely difficult for those who have ASD. These individuals struggle with social engagement and communication, as well as a unique learning and movement patterns.
To learn more about Autism, visit the link below:
brainly.com/question/29820912
#SPJ4
After studying the Magna Carta, Petition of Right, and the English Bill of Rights, what ideas from these documents impact creating a government for the United States?
The Magna Carta established the moral and political foundation that, in many ways, served as the basis for the creation of the United States.
What was the purpose of the Magna Carta and the English Bill of Rights?The English Bill of Rights was subsequently enacted by the Parliament in 1689, and like Magna Carta, it established guidelines for limiting the monarch's authority and defending the civil liberties of the populace.
The Magna Carta and the English Bill of Rights had a significant impact on American conceptions of government. The principles of limited government and common law were embodied in the Magna Carta, which also had an impact on the Supremacy Clause, habeas corpus, and other constitutional concepts.
Learn more about the Magna Carta here:
https://brainly.com/question/549211
#SPJ1
the thickening of the vaginal walls, which occurs in the plateau stage of the sexual response cycle, is known as the
The thickening of the vaginal walls, which occurs in the plateau stage of the sexual response cycle, is known as the vaginal tenting effect.
Your question is "the thickening of the vaginal walls, which occurs in the plateau stage of the sexual response cycle, is known as the".
The thickening of the vaginal walls, which occurs in the plateau stage of the sexual response cycle, is known as vasocongestion.
The correct answer is "The thickening of the vaginal walls, which occurs in the plateau stage of the sexual response cycle, is known as the vaginal tenting effect."
To know more about plateau stage refer here:
https://brainly.com/question/11951720#
#SPJ11
With a properly set rear view mirror, you should be able to see at least _____ feet behind the vehicle.
With a properly set rearview mirror, you should be able to see at least 200 feet behind the vehicle.
A rearview mirror is a vehicle's exterior mirror that enables the driver to see what is happening behind them. It is a primary safety feature for all vehicles, including cars, buses, trucks, and others. A properly set rearview mirror is one of the most important things to consider when driving.
You must be aware of what is happening behind you to avoid collisions and ensure the safety of other drivers. The rearview mirror should be adjusted to maximize the view from the driver's seat. Therefore, you should be able to see at least 200 feet behind the vehicle.
How to adjust your rearview mirror: Start by adjusting your side mirrors so that you can see the sides of your car. Then, position the rearview mirror so that you can see the entire rear window. When driving, if the rearview mirror is properly adjusted, you will be able to see the cars behind you without having to move your head. The rearview mirror should be adjusted so that it is level with your eyes and no part of the rear window is visible.
To know more about rearview mirror refer here:
https://brainly.com/question/15150799#
#SPJ11
summarize an answer to this question: What effect did the Open Door Policy have on those involved; China, United States and European countries?
Answer:
The creation of the Open Door Policy increased foreign influence in China, which led to a rise in anti-foreign and anti-colonial sentiment in the country. The backlash against foreigners led to widespread killings of missionaries working in China and an increase in nationalist feelings among the Chinese.
Explanation:
I don't really know if this is correct but I tried-
Also are you bi?
The figure below represents the market for corn, which is perfectly competitive.Farmer Roy is a producer of corn in this market.Use the information in the graph to describe the demand curve for Farmer Roy's corn.Note:The dotted lines are a little off?the intersection is at 8 and 5 respectively.
The demand curve for Farmer Roy's corn can be determined from the graph. Since the market for corn is perfectly competitive, Farmer Roy is a price taker and cannot influence the market price. Therefore, the demand curve for Farmer Roy's corn is the same as the market demand curve.
From the graph, we can see that the market demand curve for corn is downward sloping, indicating that as the price of corn decreases, the quantity demanded increases. This is a typical demand curve for a product.
As Farmer Roy is a producer of corn in this market, he cannot influence the market price of corn and must accept the prevailing market price. Therefore, the demand curve for Farmer Roy's corn is the same as the market demand curve.
This means that Farmer Roy can sell any quantity of corn at the prevailing market price. If he tries to sell his corn at a higher price than the market price, he will not be able to sell any corn as buyers will purchase from other producers at the lower market price.
In summary, the demand curve for Farmer Roy's corn is the same as the market demand curve, and he must accept the prevailing market price for his corn.
Learn more about price taker: https://brainly.com/question/30036691
#SPJ11
How has the space program impacted education in Florida?
Answer:
New science and math programs were created, and existing programs were strengthened, as money poured in to educate Floridians to work in the space industry.
Explanation:
What was an effect of the US government selling war bonds?
O Citizens received government loans to support them during the war.
Citizens saw immediate returns on their investments.
The public protested the mandatory war bonds.
O The government raised hundreds of billions of dollars.
Helppp ASAP for 39 points
Answer:
The government raised hundreds of billions of dollars.
Explanation:
War bonds are debt securities issued by the government in order to raised enough money to fund their military's operations.
The government sell this bonds to the public (which usually purchased by the people in the private sectors or the government of another country). This bond basically represent that United States government have a debt to the purchaser, and it will pay it all back in the future along with the returns.
Since bonds issued by the government is generally a safe investment, selling war bonds could rise hundreds of billions of dollars.
Answer:
The government raised hundreds of billions of dollars.
Explanation:
I got it correct trust me
What was the primary reason that the Civil War was fought?
A.
Land
B.
Stolen weapons
C.
Horses
D
Slavery
Answer:
D) Slavery
Explanation: The north and south were split on whether or not the should have slavery. The south seceded from the states and became the confederacy. The north became the union. After 4 years of continual war, the union won, and slavery was abolished. The south's economy crumbled, and it eventually led to the creation of the Klux Klan. Even in the north, black Americans were still treated differently after the civil war. They were segregated from others until Martin Luther king jr's speech led to the end of segregation in 1964.
Which three sentences describe key events in the settlement and development of the Massachusetts Bay Colony?
A John Winthrop became the leader of the colony.
B Tobacco was grown as the cash crop for the colony.
C The majority of colonists were Quakers.
D Government was established based on religious principles
E The House of Burgesses was established.
F James Oglethorpe brought debtors to the colony.
G Town meetings were part of local colonial government.
Just please help
Answer:
the three sentences describe key event is B,E and F
Tobacco was grown as the cash crop for the colony, The House of Burgesses was established and James Oglethorpe brought debtors to the colony, three sentences describe key events in the settlement and development of the Massachusetts Bay Colony. Therefore options B, E, and F are correct.
What is Bay?A bay is an area of water that is only partially encircled by land. In comparison to a gulf, a bay is often more open and smaller. A bay's mouth, where it meets the lake or ocean, is typically wider than a gulf's.
These distinctions have not always been recognized when naming bays and gulfs. For instance, the Persian Gulf is much smaller than Canada's Hudson Bay.
Other names for bays include lagoons, sounds, and bights. Nigeria's capital, Lagos, is a bayside city. It is located on Lagos Lagoon in the Atlantic Ocean's Gulf of Guinea and Benin Bight.
Bays can emerge in several ways. Large bays are formed as a result of plate tectonics, the process of continents sliding together and rifting apart.
To learn more about Bay follow the link.
https://brainly.com/question/13775454
#SPJ2
Deviance often leads to social change. What may be seen as disruptive, problematic behavior at one moment, might later be recognized as a brave statement against injustice. The idea that small groups of people can reshaped societal norms and values is exemplified by the __________ .
Answer:
Primary group
Explanation:
Considering that a primary group is a type of group that is characterized by its members having closer, personal, and surviving relationships.
For example, families and close friends are instances of primary groups, and they can influence individuals such that they modified societal standards and qualities through shared activities and culture.
Hence, The idea that small groups of people can reshape societal norms and values is exemplified by the PRIMARY GROUPS
The idea that small groups of people can reshape societal norms and values is exemplified by the Primary group.
What is the primary group?The primary group is that which is close to the individual in terms of personal relationship. The group has a strong influence on the mindset and decisions of the individual such as family and close friends.
Therefore, these groups have formed their behavior depending upon their cultural norms and values that further may change the societal standards as well.
Learn more about the primary group here;
https://brainly.com/question/12801521
After arriving at a mass-casualty incident where other ambulances are already present, you should:______
After arriving at a mass-casualty incident where other ambulances are already present, you should notify the dispatcher.
You should alert the dispatcher when you arrive at a mass casualty incident where other ambulances are already present before starting A: care for the most seriously injured patients.What is triage's purpose in a mass casualty situation?
a device that is used by medical professionals and first responders in mass casualty situations. Responders can distribute their limited resources wisely and effectively by using triage tags, and they can give victims the urgent care they need until more help arrives.What is the initial objective of triage for mass casualties?
Moving patients away from the incident and toward services that provide more comprehensive care is the aim. The majority of mass casualty incident triaging systems classify injured people using tags or coloured designations.Learn more about goal of triage
brainly.com/question/28233706
#SPJ4
Drag each power or responsibility to the image that represents the correct branch of government.
The Capitol Building, the White House, and the Supreme Court building (left to right) are shown.
declares laws
unconstitutional
can override a presidential veto
interprets laws
negotiates and signs treaties
controls executive budget
issues executive orders
The Capitol Building : can override a presidential veto, controls executive budget.
The White House: negotiates and signs treaties, issues executive orders.
The Supreme Court: declares laws unconstitutional, interprets laws.
What is the Capitol building?The United States Capitol, also known as The Capitol or the Capitol Building, is the home of the United States Congress, the federal government's legislative branch.
The Capitol is where Congress meets to create our nation's laws, as well as where presidents are inaugurated and deliver their annual State of the Union addresses.
The White House serves as the president of the United States' official residence and workplace.
The United States Supreme Court is the highest court in the federal judiciary of the United States. It has final appellate jurisdiction over all federal court cases in the United States, as well as state court cases involving a point of U.S. Constitutional or federal law.
Therefore, each power or responsibility is matched to the place that represents the correct branch of government.
To learn more about Capitol building, click here:
https://brainly.com/question/14343681
#SPJ2
Which of the following should informed citizen follow in order to fulfill his/her civic responsibilities
Answer: Politics
Explanation: An informed citizen follow in order to fulfill his/her civic responsibilities is Politics. This answer has been confirmed as correct and helpful
What type of succession is depicted in figure 2? Justify your answer.
Answer:
In stage A, an old forest was burned. In stage B, regrowth begins with grasses and wildflowers.
Explanation:
this is the answer i got from edge 2021
Which is not a reason Romans mistreated Christians?
They refuse to serve in the Roman army.
They were afraid they were going to take over the Roman Empire.
They had a very strong king.
Felt Christians were making fun of their Roman Gods.
Answer:
"Gods" (and any subsequent words) was ignored because we limit queries to 32 words.
which of the following would not be considered a conversion cost by a baking company?
what happened to the Little Rock 9
Answer:
They had to huddle in a area that looked barely noticeable. They found this empty building only to find themselves in a kids place called Chesters kidzone
Explanation:
design a primer that would be good for recognizing the beginning of the following "sequence of interest." describe why your primer is a good one. 3'-acacaggatacgtgctgctcaatgccatgatagccggtcacaagctaatccgattatcgcgcaattcctaaattcgctaaagcgaatcttcaggaaggaaccccgaaggcctttt-5', and so on.
The primer 5'-acacaggatacgtgctgctcaatg-3' is a good choice for recognizing the beginning of the given sequence of interest due to its complementary base pairing, suitable melting temperature, specificity, and avoidance of secondary structures.
A suitable primer for recognizing the beginning of the given "sequence of interest" would be 5'-acacaggatacgtgctgctc-3'.
- The primer sequence is designed to be complementary to the first 20 nucleotides of the given sequence. This ensures a strong binding affinity and specificity.
- The primer starts with a 5' end, allowing it to bind to the 3' end of the template DNA during the PCR amplification process.
- The primer has a balanced GC content, which helps to stabilize the primer-template hybridization and enhance the efficiency of PCR amplification.
- The primer has an appropriate length of 20 nucleotides, which strikes a balance between specificity and stability of primer binding.
- The primer sequence does not contain any self-complementary or repetitive motifs, which could lead to non-specific binding or primer-dimer formation.
- The primer has been designed to avoid regions with potential secondary structures or high GC content, which can hinder primer binding and amplification.
Overall, this primer is a good choice for recognizing the beginning of the given sequence of interest due to its complementarity, balanced GC content, appropriate length, and absence of non-specific binding concerns.
Learn more about primer sequence: https://brainly.com/question/13939729
#SPJ11
The complete question is:
Design a primer that would be good for recognizing the beginning of the following "sequence of interest." Describe why your primer is a good one. 3'-ACACAGGATACGTGCTGCTCAATGCCATGATAGCCGGTCACAAGCTAATCCGATTATCGCGCAATTCCTAAATTCGCTAAAGCGAATCTTCAGGAAGGAACCCCGAAGGCCTTTT - 5', and so on.
for what 2 reasons did the tang dynasty ruler turn against Buddhism
Answer:
During the Tang dynasty, Buddhism declined, and Confucianism became more popular. Even though Buddhism was at its peak during the early Tang dynasty, many of the Tang officials were of the Confucian discipline and regarded Buddhism as a disruptive force in China. So, in 845, the Tang emperor started a full-scale persecution of Buddhists. More than 4600 monasteries and 40,000 temples and shrines were destroyed. Other religious groups were also brought under government control
Explanation:
ILL GIVE 7 BRANLIEST AND ITS 30 POINT S ILL GIVE 5 STARSAND THANKS PLS HELP
DIRECTIONS
Use complete sentences to respond to each question about your novel or short story.
When providing quotations from your text, include page numbers in parentheses.
EXAMPLE
Who is the protagonist of your novel or short story? Describe the protagonist.
The protagonist of my novel is a tough, 16-year-old girl named Delaney who is struggling to raise her little sisters.
Provide a quotation from the text to support your answer.
Although she was just 16 years old, Delaney had spent much of her life providing for her sisters. She displayed the toughness and weariness of someone twice her age (page 16).
Novel or Short Story Title:
What is the title of your novel or short story?
Who is the protagonist of your novel or short story? Describe the protagonist.
Provide a quotation from the text to support your answer.
Who is the antagonist of your novel or short story? Describe the antagonist.
Provide a quotation from the text to support your answer.
Describe the main conflict in your novel or short story.
Which of the four major types of conflict best describes the situation you described?
Choose a short passage that develops the setting of your novel. Include the quotation and answer the associated questions in the space below.
Quotation from the text:
What do you see, hear, or smell as a result of the description you have chosen?
How do these details affect the mood or emotional setting of your novel or short story at this point?
How do events develop our understanding of the plot and the characters? Complete the chart below to answer this question.
Event from the Rising Action
Develops the Plot
Character’s Name
Character’s Response to the Event
What the Response Reveals About the Character
Choose two events from the rising action of your novel or short story and record them below.
In complete sentences, explain how the event develops the plot.
Identify a character who was a part of the event or affected by the event. Write his or her name below.
Record the character’s response to the event. This box should be completed with a direct quotation from your reading. Make sure you use quotation marks around any material that comes from your novel or short story.
In complete sentences, explain what you can infer or what you learn about the character based on his or her response.
EXAMPLE:
Event: Outlaws tried to rob the stagecoach. Lone Stranger and Pronto saved the people and scared the outlaws.
EXAMPLE:
This event prevents Lone Stranger and Pronto from taking their vacation and getting home to see their loved ones.
EXAMPLE:
Lone Stranger
EXAMPLE:
“We are headed to Rock Creek on our way to Rolling Ridge. We’ll ride along with you, just in case there is any more trouble.”
EXAMPLE:
This example shows that Lone Stranger is brave and helpful to others.
Event 1
Event 2
Answer:
........
Explanation:
okey to explain the 16 words includeing the example want to say:-
protagonist means the mean character(actor) of your story. you have to know as mach as well about your mean character ....
2) then what is the title( name ) of your story means eg:- my spy, encanto.
3)antagonist mean the bad guy who found in your story. describe what he want ,who is he,how he know your protagonist ,..etc..
4)describe the conflict means the cause of the conflict and effet..
and the conflict happen b/n who and who
5)4 types of conflic include b/n .person to person.person to nature you can say b/c i love to go there...........etc
The protagonist of "The Great Gatsby" is Jay Gatsby, a wealthy man who is deeply in love with a woman named Daisy Buchanan.
What wa the character "The Great Gatsby" is Jay Gatsby ?He is described as charming, charismatic, and mysterious, with a hidden past and a burning desire to recapture the love he lost with Daisy.
Provide a quotation from the text to support your answer.
"Jay Gatsby, who represented everything for which I have an unaffected scorn. If personality is an unbroken series of successful gestures, then there was something gorgeous about him".
Who is the antagonist of your novel or short story? Describe the antagonist.
The antagonist of "The Great Gatsby" is Tom Buchanan, Daisy's husband. He is a wealthy, arrogant man who is having an affair and is threatened by Gatsby's pursuit of Daisy. He represents the corruption and decadence of the wealthy elite of the 1920s.
Provide a quotation from the text to support your answer.
"Making a short deft movement, Tom Buchanan broke her nose with his open hand" (page 41).
Describe the main conflict in your novel or short story.
The main conflict in "The Great Gatsby" is the love triangle between Gatsby, Daisy, and Tom. Gatsby is desperate to win Daisy's love back and will do anything to get her, while Tom is determined to keep Daisy and protect his own interests.
Which of the four major types of conflict best describes the situation you described?
The main conflict can be described as a person vs. person conflict, as Gatsby and Tom are in direct opposition to each other over Daisy.
Choose a short passage that develops the setting of your novel. Include the quotation and answer the associated questions in the space below.
Quotation from the text: "I lived at West Egg, the—well, the less fashionable of the two, though this is a most superficial tag to express the bizarre and not a little sinister contrast between them. My house was at the very tip of the egg, only fifty yards from the Sound, and squeezed between two huge places that rented for twelve or fifteen thousand a season" .
What do you see, hear, or smell as a result of the description you have chosen?
The passage describes the location of West Egg, a less fashionable area compared to the more elite East Egg, and the narrator's house located near the Sound, with two large, expensive mansions on either side.
How do these details affect the mood or emotional setting of your novel or short story at this point?
The description of the setting creates a mood of contrast and unease, with the stark difference between West Egg and East Egg and the narrator's humble house wedged between two grand estates.
Learn more about The novel here
https://brainly.com/question/28161709
#SPJ7