(a) Let f: [0, 1] → R be a function. For each n € N, partition [0, 1] into n equal subintervals and suppose that for each n the upper and lower sums are given by Un = 1 + 1/n and Ln = - 1/n, respectively.

Is f integrable? If so, what is ∫^1 0 f(x) dx? Explain your answer.

Answers

Answer 1

f is integrable over [0, 1], and the value of the integral ∫[0 to 1] f(x) dx is 0.

Since the upper sum Un is given by 1 + 1/n for each partition size n, and the lower sum Ln is given by -1/n, we can observe that as n increases, both the upper and lower sums approach the same limit, which is 1. Therefore, the limit of the upper and lower sums as n approaches infinity is the same, indicating that f is integrable over the interval [0, 1].

The value of the integral ∫[0 to 1] f(x) dx can be found by taking the common limit of the upper and lower sums as n approaches infinity. In this case, the common limit is 1. Therefore, the integral evaluates to 1 - 1 = 0.

Hence, f is integrable over [0, 1], and the value of the integral ∫[0 to 1] f(x) dx is 0.

Learn more about integral here:

https://brainly.com/question/31059545

#SPJ11


Related Questions

A developer wants to divide an 84 acre parcel of land into lots in the ratio 6:2:4. How many acres are each land division. WILL AWARD BRAINLIEST.

Answers

Answer:

42 acres, 14 acres, 28 acres

true or false A rational number is a nonterminating, nonrepeating number

Answers

Answer:

A rational number is a nonterminating, nonrepeating number. this is false

false. A rational number is any number that can be expressed as a ratio of two integers.

What is the volume of a sphere with a radius of 41 in, rounded to the nearest tenth of a cubic inch?

Answers

Volume = 288695.6 in³

Step-by-step explanation:

Volume of a sphere is given by

\(V = \frac{4}{3} \pi {r}^{3} \)

Where r is the radius of the sphere

From the question

radius = 41 in

Substitute the value into the above formula

We have

\(V = \frac{4}{3} \times {41}^{3} \pi\)

\( = \frac{275684}{3} \pi\)

= 288695.6097

We have the final answer as

Volume = 288695.6 in³ to the nearest tenth

Hope this helps you

The answer on deltamath is

288695.6 in³

Simplify the Radical Expression
3V2 - V8 +4V12+53

Simplify the Radical Expression3V2 - V8 +4V12+53

Answers

The answer is the other one V2+13

Can you help me graph and list the (Zeros, Maximums, Minimums, Asymptotes)

Can you help me graph and list the (Zeros, Maximums, Minimums, Asymptotes)

Answers

The zero of the function is at 33.69 degree , the graph is plotted and attached with the answer.

What is a Function ?

A function is a law that relates a dependent variable and an independent variable with each other

It is given that

y = 2tan (x - π/2) +3

To find the zeroes of a function that function has to be equated to zero.

2tan (x - π/2) +3 = 0

2tan (x - π/2)  = -3

tan (x - π/2)  = -3/2

x - 90 = -56.31

x = 33.69 degree

The zero of the function is at 33.69 degree

For finding the maxima /minima

the derivative is

dy/dx = 2 sec² (x - π/2)

the point at which the slope is zero is substituted in the second derivative to find maxima/minima

d²y/dx² = 4 sec² (x - π/2) tan (x - π/2)

if the value is negative then it is a maxima and if it is positive it is a minima.

The vertical asymptote is found by finding the values that make the function undefined

x = 0+ πn

No horizontal or oblique asymptote

To know more about Function

https://brainly.com/question/12431044

#SPJ1

Can you help me graph and list the (Zeros, Maximums, Minimums, Asymptotes)

HELP ASAP PLS! THIS IS KINDA TOUGH!

HELP ASAP PLS! THIS IS KINDA TOUGH!

Answers

Answer:

Do as a which is c if I'm not than rost me

Step-by-step explanation:

can someone help me solve this please?

can someone help me solve this please?

Answers

Answer:

h = 9

Step-by-step explanation:

You can use the Pythagorean theorem to solve this.  Consider each half of the main triangle their own triangles.  

h = a

a^2 + b^2 = c^2

or

a^2 = c^2 - b^2

a^2 = 10^2 - 5^2

a^2 = 100 - 25

a^2 = 75

a = √75

a = 8.66, or 9

h = 9 (when rounded)

UHH HELP ME PLS AND I WILL MARK BRAINLIEST

UHH HELP ME PLS AND I WILL MARK BRAINLIEST

Answers

Answer:

First option: 3619.1 cubic centimetres

Step-by-step explanation:

Use this formula for figure out the volume of a cone:

\(V=\pi r^2\frac{h}{3}\)

---------------------------------------------------------------------------------------------------------------

So:

π × 144 × 8 ≈ 3619.1

---------------------------------------------------------------------------------------------------------------

Have a good day :)

Carl used 10 2/9 of an inch of string to tie a parcel and another 5 1/4 of an inch of string to tie a box, how much string is left if he started with 20 inches?

(please put you solution)

Answers

Answer:

4 19/36

Step-by-step explanation:

we have to subtract the sum of 10 2/9 and 5 1/4 from 20 to get the answer.

 =>     10 2/9 + 5 1/4

          As   a c/d    is     a + c/d,

          10 2/9 + 5 1/4 can also be written as  10+5+2/9+1/4

     

           now  we have to simplify it

 =>      10+5 = 15  

 =>      2/9 =  (2*4)/9*4)  =  8/36,    1/4  =  (1*9)/(4*9)  =  9/36

           now we have the same denominators

           add,

           8/36 + 9/36  =  (8+9)/36    =      17/36

 

 =>      now we know that 10 2/9 +  5 1/4  is  15 17/36 (  which is 15 + 17/36)

           

 =>      next step is to convert 15 17/36 into an improper fraction

           15 17/36  =     [(15*36)+17]/36     =     [540+17]/36    =   557/36

           

 =>       now we just have to subtract  557/26 from 20

            20 -  557/36  =   [(20*36)-557]/36   =    [720-557]/36   =    163/36

         

 =>   we can convert 163/36 into a mixed fraction if we want to  

        163/36 converted into mixed fraction is 4 19/36

        hope this helps :)

when the angle of an incline with a block resting on it increases the normal support force? A) decreases B) increases C) stays the same

Answers

Answer:

normal force decreases

Step-by-step explanation:

N=mgcosθ, and cosine decreases as theta increases

consider joining our disc*rd server for unlimited hw help! we also have an active giveaway rn. code: RPEdT3erFm <3

Answer:

A) decreases

Step-by-step explanation:

As the angle of the incline increases, the normal force decreases, which decreases the frictional force. The incline can be raised until the object just begins to slide.

Hey! Can you plz help me? I promise to give brainliest

Hey! Can you plz help me? I promise to give brainliest

Answers

Answer: answer D

Step-by-step explanation:

i am pretty sure it is D. not 100%, but like 90%. they are both on the outside of the lines, so that is why i know they are exterior. and, they are on opposite sides, so that makes them alternate.

my Christmas present to you​

Answers

merry Christmas to you!

Kyle invests £48 000 in an account that pays 3.1 percent compound interest per annum. Work out how much money Kyle will have in his account in years.

Answers

Answer:

(If compounded annually)

(first 5 years)

1 year = 48,000(1.031)¹ = £49,488.00

2 years = 48,000(1.031)² = £51,022.13

3 years = 48,000(1.031)³ = £52,603.81

4 years = 48,000(1.031)⁴ = £54,234.53

5 years = 48,000(1.031)⁵ = £55,915.80

Step-by-step explanation:

A = P(1 + r/n)^(nt)

money Kyle will have in his account in x years if compounded annually (once per year) per annum (every year) =

48,000(1 + 3.1%/1)^1x = 48,000(1.031)^x

Kyle can expect \(48000(1.031)^{n}\) in his account in n years after compounding.

What is compound interest?

The compound interest is the interest calculated on the aggregated interest and the principal amount. The formula to calculate the sum after compound interest is:

S=P\((1+r)^{n}\)

How to calculate total amount while compounding?

We have been given amount as 48000 pounds and the rate of compounding is 3.1%. We will apply the above formula to calculate the sum:

S=48000\((1+0.031)^{n}\)

Learn more about compound interest at https://brainly.com/question/24924853

#SPJ2

-135.4 + 78 1/2 =___

Answers

-56.9 hope this helps :)

Your friend Frans tells you that the system of linear equations you are solving cannot have a unique solution because the reduced matrix has a row of zeros. Comment on his claim. The claim is right. The claim is wrong. Need Help?

Answers

Answer: Incorrect

Step-by-step explanation:

Your friend Frans' claim is incorrect. A row of zeros in the reduced matrix means that the corresponding equation in the system is redundant and does not provide any additional information. This does not necessarily mean that the system does not have a unique solution. In fact, a row of zeros in the reduced matrix is common when solving systems of linear equations using Gaussian elimination, and it can still lead to a unique solution or even an infinite number of solutions. Therefore, Frans' claim is wrong.

RJ went into a store and eyeballed a pair of jeans. The proprietor of the
store said that the jeans were on sale. They were:
(.000005)(.02)(10,000)(5×10¹8)
2.5×10¹3
dollars off a $100 pair of jeans. RJ quickly did the math and walked out of
the store paying $
for his jeans.

Answers

Answer: sorry i needed points :<

Step-by-step explanation:

based on a normal distribution with a mean of 500 and a standard deviation of 150, the z-value for an observation of 200 is closest to:

Answers

The z-score for an observation of 200 is approximately -2.000.

Z-Value for Observation 200

Here are the steps to calculate the z-score for an observation of 200 based on a normal distribution with a mean of 500 and a standard deviation of 150:

Subtract the mean (μ) from the observation (x):

        x - μ = 200 - 500 = -300

Divide the result from step 1 by the standard deviation (σ):

        -300 / 150 = -2

Round to the nearest thousandth to get the final z-score:

        -2 ≈ -2.000

So, the z-score for an observation of 200 is approximately -2.000.

A z-score is a measure of how many standard deviations a given value is from the mean of a dataset. It is calculated by subtracting the mean of the dataset from a given value and dividing the result by the standard deviation of the dataset.

In the case of a normal distribution with a mean of 500 and a standard deviation of 150, a z-score of -2 would indicate that an observation of 200 is 2 standard deviations below the mean. This information can be used to determine the proportion of data within the dataset that is above or below a certain value, or to make comparisons between different datasets.

Learn more about Z-Value for Observation here:

https://brainly.com/question/13404740

#SPJ4

A closed tin of milk has diameter 12cm and height 8cm. Find the total surface area of the tin (take π=22÷7)​

Answers

The total surface area of the closed milk tin is 528 cm²

The shape of the closed tin of milk is cylinder.

The formula for calculating the total surface area of cylinder is the curved surface area of the cylinder + the area of the two circles(on the top and the bottom) which equals to 2πr(r+h), where r is the radius of the cylinder and h represents the height of the cylinder.

The diameter of the cylinder is 12cm and the height of the cylinder is 8cm.

The radius of the cylinder is half of the diameter of the cylinder which is 12/2=6cm

By putting the values, we get = 2×22/7×6(6+8)

    = 264/7(14)

    = 264(2)

    = 528 cm²

To know more about Total surface area - https://brainly.com/app/ask?q=The+total+surface+area+

#SPJ9

(x^4/7^-8)^7

Solve asap pls​

Answers

Answer: x=2

Step-by-step explanation: (x^4/7^-8 )^7

(4x/-56)^7 (7×8=56)

4x/-8

x/-2

x = 2



Sarah took the advertising department from her company on a round trip to meet with a potential client. Including Sarah a total of 10 people took the trip. She was able to purchase coach tickets for $230 and first class tickets for $1290. She used her total budget for airfare for the trip, which was $7600. How many first class tickets did she buy? How many coach tickets did she buy?

Answers

You can set up a system of equations for this problem. Let x = number of coach tickets and y = number of first class tickets. Then:

330x + 1220y = 12730 (cost of coach tickets plus cost of first class tickets is total budget)

x + y = 17 (number of coach tickets plus number of first class tickets is total number of people)

Solve the second equation for y to get y = 17 - x, then plug that into the first equation and solve for x:

330x + 1220(17 - x) = 12730

330x + 20740 - 1220x = 12730

-890x + 20740 = 12730

-890x = -8010

x = 9

Sarah bought x = 9 coach tickets. Plug that into the second equation and solve for y:

9 + y = 17

y = 8

Sarah bought y = 8 first class tickets.

A group contains n men and n women. how many ways are there to arrange these people in a row if the men and women alternate?

Answers

A group contains n men and n women. 2n! number of ways are there to arrange these people in a row if the men and women alternate. Arrangement is known as permutation.

A permutation of a set in mathematics is, broadly speaking, the rearrangement of its elements if the set already has an ordered structure into a sequence or linear order. The act or procedure of altering the linear order of an ordered set is referred to as a "permutation."

When the order of the arrangements counts, a permutation is a mathematical technique that establishes the total number of alternative arrangements in a collection. Choosing only a few items from a collection of options in a specific sequence is a common task in arithmetic problems.

Learn more about permutation here

https://brainly.com/question/1216161

#SPJ4

The value of a boat is $22,000. It loses 20% of its value every year. Find the approximate monthly percent decrease in value. Round your answer to the nearest hundredth of a percent. PLZ HELP! I"LL GIVE BRAINLIEST!!!!

Answers

Answer:

If it lost 20% of the original value per year, it lost $4,400 in value in the first year.

There are 12 months in a year.

4,400 divided by 12 is 366.67 (rounded since this is about money)

So the boat lost $366.67 in value each month for the first year.

Or 1.67% value per month

hey could someone help me with this. i’ll mark u brainiest if u don’t leave a link.

hey could someone help me with this. ill mark u brainiest if u dont leave a link.

Answers

Answer:

10,000

Step-by-step explanation:

10 to the power of 4 is equal to 10x10x10x10 which is 10,000! I hope this helps

Answer:

the answer will be 10000!

Step-by-step explanation:

10 x 10 x 10 x 10 = 10000

or...

10 x 10 = 100

100 x 100 = 10000

or...

jusr simply add 4 zero to 1!

suppose someone offers max the following gamble: with probability 0.50 he will win $10 and with probability 0.50 he will lose $8. the expected value of this gamble is

Answers

The expected value of this gamble is $1.

The expected value of this gamble is the weighted average of all possible outcomes where the weights are the probabilities of each outcome happening.

The formula for expected value (EV) is as follows:

          Expected Value = (Probability of Winning × Amount Won) − (Probability of Losing × Amount Lost)

Hence, substituting the values:

          Expected Value = (0.5 × $10) − (0.5 × $8)

          Expected Value = $5 - $4

          Expected Value = $1

Therefore, the expected value of this gamble is $1.

Learn more problems on the expected value in the given link:

https://brainly.com/question/24305645

#SPJ11

Which value of m makes this equation true?

Which value of m makes this equation true?

Answers

Answer:

m = -27/13

Step-by-step explanation:

Given equation,

→ (2m - 27)/3 = 5m

Now the value of m will be,

→ (2m - 27)/3 = 5m

→ 2m - 27 = 5m × 3

→ 2m - 15m = 27

→ -13m = 27

→ [ m = -27/13 ]

Hence, value of m is -27/13.

Help me. The question is giving me problems help.

D/3

Help me. The question is giving me problems help.D/3

Answers

The real world situation that can be modelled with the given  expression can be modelled as shown below.

What is expression?In mathematics, an expression or mathematical expression is a finite combination of symbols that is well-formed according to rules that depend on the context.Mathematical symbols can designate numbers (constants), variables, operations, functions, brackets, punctuation, and grouping to help determine order of operations and other aspects of logical syntax.

Given is the expression as -

D/3

A real world situation that can be modelled with this expression can be written as follows -

Amanda has a total of {D} bananas. She divides the bananas into 3 of her childrens equally. Write an expression that would represent the amount of bananas recieved by each of her child.

Therefore, the real world situation that can be modelled with the given  expression can be modelled as shown above.

To solve more questions on expressions, visit the link below -

brainly.com/question/1041084

#SPJ1

A beaker has a mass of 129 g. What is the mass of this beaker in kilograms?

Answers

Answer: 0.129 kg

Step-by-step explanation:

A gram to a kilogram can be found by dividing the value of grams by 1000, or multiplying the value by 0.001

The box office at a theater is selling tickets for a series of rock concerts. So far, they have sold 53 balcony tickets and 94 general admission floor tickets for Friday's show, for a total of $4,482 in receipts. For Saturday's show, 53 balcony tickets and 47 general admission floor tickets have been sold, equaling $3,354 in receipts. How much does each ticket cost?

Answers

The box office sold 360 tickets to a concert at

the college. The total receipts were $4,170. General

admission tickets cost $15 and student tickets cost $10.

How many of each kind of ticket was sold?

Answer: 114 general admission tickets and 246 student tickets were sold.

Step-by-step explanation:

Let x represent the number of general admission tickets that were sold.

Let y represent the number of student tickets that were sold.

The box office sold 360 tickets to a concert at the college. It means that

x + y = 360

General admission tickets cost $15 and student tickets cost $10. The total receipts were $4170. It means that

15x + 10y = 4170- - - - - - - - -1

Substituting x = 360 - y into equation 1, it becomes

15(360 - y) + 10y = 4170

5400 - 15y + 10y = 4170

- 15y + 10y = 4170 - 5400

- 5y = - 1230

y = - 1230/-5

y = 246

x = 360 - y = 360 - 246

x = 114

Answer:

Step-by-step explanation:

Subtract 2nd equation from the first

53b+94g-53b-47g=4482-3354

47g=1128

g=24, using this value in 53b+94g=4482 gives you

53b+94(24)=4482

53b+2256=4482

53b=2226

b=43

So general admission tickets cost $24 and balcony tickets cost $43.

Alice is playing a game in which she will roll 4 6-sided dice at the same time. She gets 5 points for each die that shows an even result. Let x represent the total number of points awarded on any given toss of the dice. What is the expected value of x? A. 1/2 B. 2 C. 10 D. 15 E. 20

Answers

The number of points is simply 5 times this random variable, and E(C*Y) = C*E(Y), where C is a constant and Y is a random variable, according to expected value principles. As a result, E(X) = 5*2 = 10.

What is probability?

The field of mathematics concerned with probability is known as probability theory. Although there are various distinct interpretations of probability, probability theory approaches the idea rigorously mathematically by articulating it through a set of axioms. A probability is a number that represents the possibility or chance that a specific event will occur. Probabilities can be stated as proportions ranging from 0 to 1, as well as percentages ranging from 0% to 100%.

Here,

The number of dice that are showing an even number is a binomial random variable with n = 4, and p = 1/2 (because half the faces on the die are even and half are odd).

The expected value of this random variable is n*p = 4*1/2 = 2.

The number of points is simply 5 times this random variable, and by the rules of expected value, E(C*Y) = C*E(Y), where C is a constant and Y is a random variable. Thus E(X) = 5*2 = 10.

To know more about probability,

https://brainly.com/question/30034780

#SPJ4

40 POINTS QUESTION
PLS HELP

A Ferris wheel with a radius of 19m rotates once every 56 seconds. The top of the
wheel is 42.5m above the ground.

Determine a sine and cosine equation of the function that gives the rider's height
above the ground in metres, as a function of time, in seconds, with the rider starting
at the bottom.​

Answers

Answer:

(First of all its 20 points not 40 but any ways) A ferris wheel has a raidus of 20 m. Passengers get on halfway up on the right side. The direction of rotation is counter clockwise. The bottom of the ferris wheel is 2 m above ground. It rotates every 36 seconds. Determine height above the ground after 15 seconds algebraically. Determine seconds to the nearest tenth when height is 38 m above the ground algebraically.

**

let t=seconds after wheel starts to rotate.

let h=meters above ground after wheel starts to rotate

..

The formula I got: h(t)=20sin(πt/18)+22

This is close to the formula you got, except I left the negative sign out since passengers start to rise after the wheel starts going counter-clockwise.

..

After 15 seconds:

h=20sin(15π/18)+22

=20sin(5π/6)+22

=20*(1/2)+22

=32 m

..

When h=38 m

38=20sin(πt/18)+22

38-22=20sin(πt/18)

20sin(πt/18)=16

sin(πt/18)=16/20=4/5=.8

arcsin(.8)=0.927

πt/18=0.927 (radians)

t=(.927*18)/π≈5.31

..

height above the ground after 15 seconds≈38 m

seconds elapsed when height is 38 m above ground≈5.3 seconds

Other Questions
A marine ecosystem is exposed to a potentially devastating invasive species and responds by remaining stable throughout the invasion. it could be said that _____. what is the ration of 8/20 trying to arrange for encounters and interactions is one way of engaging in which affinity-seeking strategy? trying to arrange for encounters and interactions is one way of engaging in which affinity-seeking strategy? visibility self-involvement commonalities other-involvement When obtaining information on products and services from websites, discussion boards, and blogs, it is important NOT to assume that vendors' claims are accurate.True or false click the down arrow on auto. when would you want to change the channel on which the wireless signal is broadcast? 9. under channel Two angle measures in a triangle is 81 and 62 what is the missing angle simplify: 7(3x-4)pls help Transcribe the following dna strands into mrna strands: ATTCGACGTCGATAGCTAGG PLEASE HELP PLEASE I'LL GIVE BRAINLIEST PLEASE The principle dash our requests. Helppp ya boyyyyyy!!!!!!!!! Could someone help me with this it would mean a lot ! :) When fun bun inc., an international fast-food chain, set up operations in china, it had to teach farmers how to grow a particular variety of potatoes, and bakers had to be taught how to make hamburger buns. this is an example of: Which of the following is not true about cells?Which of the following is not true about cells?All living cells always come from other living cells.All living thing begins life as a single cell.It takes many cells to make a living organism.The cell is the basic unit of the structure and function of life. Green Grocer Wholesale, Inc. received an $850.00 check from Bob for a grocery purchase. The check was from Forest Enterprises to Ana and had been indorsed to Bob who, in turn, indorsed the check to Green. The clerk at Green failed to carefully examine the check, not noticing that the number 5 had been changed to an 8. Green Grocer has: Which point on the diagram best represents the position of the Earth and the Sunwhen it is winter in North AmericaA.point aB.point bC.point cD.point d HELPPPPPP please and thank you Question 3 of 25Read the following excerpt from a 1775 speech by Patrick Henry in which hepresents his ideas concerning the American colonists' relationship with GreatBritain:Mr. President, it is natural to man to indulge in the illusionsof hope. We are apt to shut our eyes against a painful truth,and listen to the song of the siren, till she transforms usinto beasts. Is this the part of wise men, engaged in agreat and arduous struggle for liberty? Are we disposed tobe of the number of those, who, having eyes, see not, andhaving ears, hear not, the things which so nearly concerntheir temporal salvation? For my part, whatever anguish ofspirit it may cost, I am willing to know the whole truth, toknow the worst, and to provide for it.Which best explains the purpose of the rhetorical device used in this excerpt?OA. The rhetorical questions highlight the absurdity of passivelyignoring the truth about Great Britain's intentions.OB. The repetition of the words "sir" and "throne" emphasize the pointthat the colonists are subordinate to Great Britain. The imagery ofa colonist with no eyes and no ears illustrates how helpless theyall are at the hands of Great BritainOC. The personification of the struggle for liberty makes it a familiarand relatable topic.OD. The use of parallelism draws attention to the many peaceful stepsthe colonists have taken A die is rolled 3. What is the probability of getting a 1 on the first roll, a 2 on the second roll, and a 3 on the third roll A nurse is assessing a client for early manifestations of chronic kidney disease (ckd). Which would the nurse expect the client to display?.