The social consequence of not using the land is that it will protect the lives of species and prevents a reduction in carbon sequestering by the trees.
A social consequence refers to any unforeseen event which can be positive or negative, experienced by a society and has an effect on them.
A positive social consequence benefits a group of the socially connected group and can also stimulate future purpose.
A negative social consequence has its repercussions and can be attributed to negligence and bad factors.
Conservation of the ecosystem is paramount as well as the survival of the community.
A positive social consequence from the given information is that if the forested wetland is preserved to support a variety of species, It will protect the lives of the species and prevent a reduction in carbon sequestering by the trees.
The community could have emergency ambulances to cater for the movement of patients in case of emergency to the hospitals or educate them on how to take good care of their health and how to minimize hazards at home and offices.
Learn more about social consequences here:
https://brainly.com/question/3794486?referrer=searchResults
How are exponential and logistic growth models similar? How are they different?
Answer:
Both models refer to the population but in different ways. One major difference is that exponential growth starts slow then picks up as the population increases while logistic growth starts rapidly, then slows down after reaching the carrying capacity.
Answer:
Exponential growth has no furthest breaking point and populaces become rapidly. Logistic growth has a point of confinement and development approaches this cutoff in a sigmoidal manner. Logistic growth is more realistic, in actuality, yet exponential development is a superior model for bacterial societies, and so on that have boundless assets and space.
Explanation:
edge
4. The main elements in Earth's crust are oxygen and
(5 Points)
O A. iron
O B. copper
O C. silicon
O D. nickel
Answer: C: Silicon
Explanation: Makes up 27.7% of Earths crust. Iron takes up 8.1% so I would say the answer is silicon.
One Strand of DNA is listed below. Which of the following best
represents the complementary strand of DNA?
DNA Strand: TCGAGGCTAA
A. ACGUCCGAUU
B. GATCTTAGCC
C. AGTCCGAUU
Answer:Problem Set 4 Answers
1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d. The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
2. Below is a table for the genetic code:
T
C
A
G
T
TTT Phe (F)
TTC "
TTA Leu (L)
TTG "
TCT Ser (S)
TCC "
TCA "
TCG "
TAT Tyr (Y)
TAC "
TAA Stop
TAG Stop
TGT Cys (C)
TGC "
TGA Stop
TGG Trp (W)
C
CTT Leu (L)
CTC "
CTA "
CTG "
CCT Pro (P)
CCC "
CCA "
CCG "
CAT His (H)
CAC "
CAA Gln (Q)
CAG "
CGT Arg (R)
CGC "
CGA "
CGG "
A
ATT Ile (I)
ATC "
ATA "
ATG Met (M)
ACT Thr (T)
ACC "
ACA "
ACG "
AAT Asn (N)
AAC "
AAA Lys (K)
AAG "
AGT Ser (S)
AGC "
AGA Arg (R)
AGG "
G
GTT Val (V)
GTC "
GTA "
GTG "
GCT Ala (A)
GCC "
GCA "
GCG "
GAT Asp (D)
GAC "
GAA Glu (E)
GAG "
GGT Gly (G)
GGC "
GGA "
GGG "
a. The following codons can be mutated by one base to produce an amber codon:
CAG Gln
AAG Lys
GAG Glu
TCG Ser
TTG Leu
TGG Trp
TAA Stop
TAT Tyr
TAC Tyr
b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.
c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.
3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain. The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.
b. Template strand is the DNA strand off which the mRNA is synthesized. The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.
c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA. The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit. The sequence signals which AUG acts as the translation start in mRNA.
4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.
b. False, a frameshift mutation affects all the subsequent amino acids.
c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.
d. False, the wobble is first base (5’ to 3’) in the anticodon.
e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.
f. True. For example, a single base substitution causing CAT to change to AAT would signal a termination.
g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.
5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate. Therefore, the products remaining will consist of pppNp, Np, and N-OH
b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.
c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.
d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.
6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product. With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.
Explanation:
The complementary strand of the mentioned DNA strand is AGCTCCGATT.
What is DNA?DNA is a hereditary material which is present in human beings as well as all other living organisms. Every cell which is present in an organism's body has DNA which is the same. Most of the DNA is situated in the cell's nucleus and small amount of it can be found in the cell's mitochondria as well.
Information which is stored in DNA is stored as codes made up of four chemical bases namely, adenine, thymine , cytosine and guanine.Human DNA consists of 3 billion bases .The order of the bases determines information which is required for building and maintaining an organism.
DNA bases are capable of pairing up with each other. Adenine pairs with thymine and guanine pairs up with cytosine .Each base is also attached to a sugar molecule and a phosphate group. A base, phosphate sugar are together called as nucleotides.
Learn more about DNA,here:
https://brainly.com/question/2293843
#SPJ2
Your question is incomplete but most probably your full question was ,one Strand of DNA is listed below. Which of the following best
represents the complementary strand of DNA?
DNA Strand: TCGAGGCTAA
A. ACGUCCGAUU
B. GATCTTAGCC
C. AGTCCGAUU
D. AGCTCCGATT.
what is PM 2.5 and how does it affect people?
1
The part of an ecosystem where plants and animals live.
Answer:
habitat
Explanation:
They live in the habitat of an ecosystem
Answer:
Habitat
Explanation:
A Habitat supports both plants and animals.
food and territory are balancing factors in an ecosystem what type of phenomena balance these factors
Answer:
uhh either natural and reproductive pretty sure it's reproductive
how do you set up a single trait cross and how can you make a prediction based on this cross?
Setting up a single-trait cross involves selecting two parents with different versions of a single trait and crossing them to produce offspring with predictable traits, and this type of cross is used to study the inheritance pattern of a single trait.
What is single trait cross?Here, the parents are chosen such that one parent should have two copies of the dominant allele (represented by a capital letter) and the other should have two copies of the recessive allele (represented by a lowercase letter), and then the alleles are separated and the F1 offspring are obtained, and here all are dominant.
Hence, a single-trait cross involves selecting two parents with different versions of a single trait and crossing them to produce offspring, and this type of cross is used to study the inheritance pattern and from alleles the prediction is done.
Learn more about the single-trait cross here.
https://brainly.com/question/29734663
#SPJ9
Evaluate each of the statements below. Select those that accurately describe the role of genes and chromosomes in the process of inheriting a specific trait. Choose all THREE that apply. Question options:
Chromosomes are made of DNA.
There are 26 pairs of chromosomes in humans.
Alleles are the different forms of a gene that can exist.
Chromosomes contain genes that control the inheritance of traits.
Genes are made of chromosomes and contain all of the genetic information for an organism
What is the process by which bacteria return nitrogen back into the air. *
which two countries have the greatest total ecological footprints
According to the Global Footprint Network, the two countries with the greatest total ecological footprints are China and the United States.
In 2016, China's total ecological footprint was 18.7 billion global hectares (gha) while the United States' was 7.2 billion gha. The ecological footprint measures the amount of biologically productive land and water required to sustain a population's consumption and waste production. It takes into account factors such as food consumption, energy usage, transportation, and housing.
Understanding Ecological Footprint
An ecological footprint measures the amount of natural resources used by a country or individual, taking into account land and water consumption, energy usage, waste production, and more.
Identifying the Countries with the Largest Footprints
According to the Global Footprint Network, the United States and China have the largest ecological footprints among all nations.
Comparing the Ecological Footprints
China has the highest overall footprint due to its large population and rapid industrialization, while the United States has a larger per capita footprint due to higher consumption levels and greater resource usage.
In conclusion, the two countries with the greatest total ecological footprints are the United States and China.
Learn more about ecological footprint
brainly.com/question/28526715
#SPJ11
do deers eat foxes? i will mark brainliest
Answer: what? No, deers are herbivores man
Explanation:
Can someone plz help me? :)
Carbonated soda is a combination of sugar, flavors, and water. Which of the following best describes the composition of the soda?
A. It is a homogeneous solution because substances are dissolved into water.
B. It is a compound since it results from the combination of elements.
C. It is a suspension because sugar particles cannot fully dissolve.
D. It is an element since water is found in all living things
It is a compound since it results from the combination of elements of the following best describes the composition of the soda.
The correct option is B.
Is Coke a carbonated soda?Carbonated water - The bulk of Coca-Cola is made up of water. The carbonated component, that's what give the beverage its fizz and bubbles, uses pure carbon dioxide. Sugar: Sugar gives Coca-Cola Classic its sweet flavor and some of its texture. Coca-Cola Zero Sweetener and Diet Coke both lack sugar.
Is carbonated soda healthy?While soda and other carbonated beverages have been linked to adverse health consequences, Saima Lodhi, MD, an internal medicine specialist at Scripps Coastal Medical Center Hillcrest, asserts that carbonation is not inherently dangerous.
To know more about Carbonated soda visit:
https://brainly.com/question/28756573
#SPJ4
The nitrogen base pairs in the DNA molecule are adenine and or cytosine and .
The nitrogenous bases Adenine form two hydrogen bonds with thymine and the cytosine form three hydrogen bonds with the guanine. Simply, A combines with T and G combines with the C. It is often called as a complementary base pairing because of each base pair bonds only with its specific complementary base partner in a DNA molecule.
The nitrogenous bases Adenine form two hydrogen bonds with thymine and the cytosine form three hydrogen bonds with the guanine.
What are Nitrogen bases?A combines with T and G combines with the C. It is often called as a complementary base pairing because of each base pair bonds only with its specific complementary base partner in a DNA molecule.
The creation of nucleotides, which in turn create the nucleic acids like DNA and RNA, uses a set of five nitrogenous bases.
The sequencing of these bases in DNA and RNA is how information is stored, making them of utmost importance. The nucleotides A C U G are represented by the letters that make up the codons in the genetic code.
Therefore, The nitrogenous bases Adenine form two hydrogen bonds with thymine and the cytosine form three hydrogen bonds with the guanine.
To learn more about nitrogen bases, refer to the link:
https://brainly.com/question/30112562
#SPJ2
Can someone plz help me?
Answer:
d
Explanation:
endocrine system controls all biological processes
What are the 14 parts of the digestive system?
The digestive system is mostly composed of the mouth, esophagus, stomach, small intestine, large intestine, rectum, and anus (in order of their function). They are assisted in their efforts by the liver, gall bladder, and pancreas.
Which 12 components make up the digestive system?The mouth, pharynx, esophagus, stomach, small and large intestines, rectum, and anus make up the digestive system's alimentary tract. Some of the auxiliary organs associated with the gastrointestinal tract are the pancreas, liver, gallbladder, and salivary glands.
What makes digestion crucial?Food must be digested in order to be broken down into nutrients that the body may use for energy, development, and cell repair. Nutrients from food and drink must be broken down into smaller molecules before being absorbed by the circulation and sent to the cells throughout the body.
What comes first in digestion?Long before food even enters the stomach, digestion starts in the mouth. Our salivary glands under the lower jaw, under the tongue, and in front of the ear start secreting saliva when we sight, smell, taste, or even just think about a delicious meal (spit). Spit moistens the food as the teeth rip and cut it to make swallowing simpler.
To know more about digestive system visit:
https://brainly.com/question/956634
#SPJ4
HELP PLS
Some traits have multiple alleles (more than 2). What are the phenotypes for each of the four different alleles in the example provided?
Answer:
Although an individual gene may code for a specific physical trait, that gene can exist in different forms, or alleles. One allele for every gene in an organism is inherited from each of that organism's parents.
according to the cdc, one of the ten essential public health services is:
According to the CDC, one of the ten essential public health services is "monitoring health status to identify and solve community health problems."
The ten essential public health services are a framework developed by the Centers for Disease Control and Prevention (CDC) to outline the fundamental responsibilities of public health agencies and organizations. These services serve as a guide for public health practice and are aimed at promoting and protecting the health of communities.
One of the essential public health services is "monitoring health status to identify and solve community health problems." This service emphasizes the importance of collecting, analyzing, and interpreting data on the health of populations to identify trends, patterns, and emerging health issues.
Monitoring health status involves surveillance systems that track diseases, injuries, and other health indicators in a community. This information is crucial for identifying public health threats, evaluating the impact of interventions, and developing strategies to address health disparities and promote health equity.
By monitoring health status, public health agencies can assess the health needs of a population, prioritize areas for intervention, and allocate resources effectively. This essential service plays a vital role in informing public health policies, programs, and interventions to improve the overall health and well-being of communities.
To learn more about public health services, here
https://brainly.com/question/30639590
#SPJ4
What is
evaporation, and
how does it
contribute to the
survival of
species
Answer:
The evaporation happens when a liquid turns into a gas and this help when evaporation removes heat and can act as a cooling mechanism
Which statements about geocentric model and heliocentric model are true? Select the two correct answers.
A. They both are models of the solar system.
B. They both show the position of Earth relative to the Sun.
C. They both show Earth at the center of the solar system.
D. They both show the Sun at the center of the solar system.
Answer: Your correct answer would be both A & B.
Explanation: A is the correct answer because both of these models are in fact models of our solar system. The geocentric model had Earth at the center of the solar system with all the other planets and sun rotating around us. The heliocentric model is the accepted model of our solar system today with the sun at the center and planets rotating in slightly elliptical fashions around it due to gravitational pull. B is also correct because as I just explained, both models position Earth in relativity to the sun though both models vary greatly. The aim of both of these models was to specify where Earth was exactly in the solar system. I hope this has been of use to you! Please do not hesitate to ask if you have other questions :)
The two correct statements about the geocentric and the heliocentric model are:
They both show the position of Earth relative to the Sun. They both are models of the solar system.The geocentric model
The geocentric model has the assumption that the earth is at the center of the universe. The sun and the planets are said to revolve around the earth in this model
The heliocentric model:
The heliocentric model has the assumption that the sun is at the center of the universe. The earth and the planets revolve around it.
Read more on https://brainly.com/question/23066689?referrer=searchResults
Which type of mutation affects the largest number of genes? A. Missense mutation B. Silent mutation C. Point mutation D. Chromosomal mutation
Answer is: Chromosomal mutation
What are the 3 kinds of muscles in our bodies?
Answer:
There are 3 types of muscles: Skeletal, Smooth, and Cardiac
Explanation:
Skeletal muscle – enable people to move and perform daily activities. they play an essential role in respiratory mechanics and help in maintaining posture and balance.
Smooth muscle – present throughout the body, where it serves a variety of functions. It is in the stomach and intestines, where it helps with digestion and nutrient collection.
Cardiac muscle – The cardiac muscle is responsible for the contractility of the heart and, therefore, the pumping action. The cardiac muscle must contract with enough force and enough blood to supply the metabolic demands of the entire body.
Hope it helped!
3. Why is water important to the rock cycle?
(A) It can erode and help form rocks.
(B) It cools the Earth's crust as rocks form.
(C) It adds pressure to rocks forming beneath the
surface.
(D) It causes accelerated erosion through extreme
weather
Answer:
a
EXPLANATION:
Water plays an important role in weathering and breaking down rock.
Answer:
this is the answer
Explanation:
water plays main role in rock cycle
marfan syndrome, a dominant single-gene defect, is characterized by lens dislocation, long limbs, spindly fingers, a caved-in chest, and a weakened aorta. this is an example of a(n) trait
Marfan syndrome, a dominant single-gene defect, is characterized by lens dislocation, long limbs, spindly fingers, a caved-in chest, and a weakened aorta. is an example of a B) pleiotropic trait.
The connective tissue in many parts of the body can be affected by Marfan syndrome. Structures like bones, ligaments, muscles, blood vessels and heart valves all benefit from the strength and flexibility provided by connective tissue. The severity, onset time, and rate of progression of Marfan syndrome symptoms vary greatly.
Despite the fact that Marfan syndrome is brought on by a single gene mutation, it has a wide range of effects on growth and development, including height, vision, and heart function. This is an illustration of pleiotropy, in which a single gene influences multiple traits. This type of gene is referred to as pleiotropic (pleio- = many, -tropic = effects) because it controls multiple seemingly unrelated features.
Know more about Marfan syndrome here: https://brainly.com/question/1335306
#SPJ4
Which of these are gametes? (Select all that apply.)
zygote
spore
sperm
egg
Answer:
sperm and egg
Explanation:
Gametes are the reproductive or germinal cells of an organism. The sperms produced by the males and the egg produced by the females are an example of gametes. Thus, options c and d are correct.
What are gametes?Gametes are the structures of reproduction that can be called the reproductive cells of the animal or the plant species. The gamete produced by a male is sperm, while that produced by a female is an egg or an ovum.
The spores differ from gametes as they are agents of asexual reproduction and are produced by bacteria, algae, and fungi. Whereas the zygotes are the fertilized cell by the male and the female gamete.
Therefore, the sperms and the eggs are the gametes.
Learn more about gametes here:
https://brainly.com/question/2569962
#SPJ2
How could you describe the levels of organization in a decomposer?
an organism, especially a soil bacterium, fungus, or invertebrate, that decomposes organic material.
Which statement is FALSE about the Cell Cycle? Question 4 options:
A. During Prophase, the cell fully splits into a parent and a daughter cell.
B. Most of the cell's life is spent in Interphase, growing larger.
C. The stages of the cell cycle repeat themselves.
D. The cytoplasm divides during the process called cytokinesis.
Answer:
the answer is A since the cell splits into two only during the cytokinesis
Answer: I belive its A
Explanation:
Constriction of the ________ decreases hydrostatic pressure in the nephron's filtering structures; the _________.
Select one:
1. Afferent arterioles, glomerular capillaries
2. Efferent arterioles, proximal convoluted tubules
3. Renal vein, peritubular capillaries
4. Renal arteries, juxtaglomerular apparatus
5. Vasa recta, ascending loop of Henle
As stated in the preceding statement glomerular capillaries, afferent arterioles
What does hydrostatic pressure mean?The definition of hydrostatic pressure is. "The pressure that a liquid at equilibrium experiences at any given time as a result of the force of gravity." As the gravity of the fluid increases that whenever a downward pressure is applied, hydrostatic pressure directly proportional to the distance measured from the surface.
What does osmosis' hydrostatic pressure mean?Osmotic pressure, which is connected toward the protein concentration on each side of a membrane forcing water to towards the region had greater concentration, is different from hydrostatic pressure, which is the pressure of body water against a membrane.
To know more about hydrostatic pressure visit:
https://brainly.com/question/28206120
#SPJ4
what is the role of a promoter region of a gene? what is the role of a promoter region of a gene? serve as the original region of transcription of a gene. recruit rna polymerase to the transcriptional start site. recruit transcription factors that form the initiation complex. recruit rho protein to assist in transcription. protect the gene from mutations in intergenic regions.
Answer:
According to genomics, a gene's promoter is the area of DNA upstream of it where important proteins, such RNA polymerase and transcription factors, bind to start the gene's transcription. A molecule of RNA is created as a result of the transcription (such as mRNA).
Explanation:
Function of promoter region of a Gene :To ensure that you obtain strong and robust transcription of that gene, promoters can be highly complicated and collaborate with other DNA regions known as enhancers. This is a field that has grown significantly and contributed to our understanding of a wide range of disorders.To learn more about promoter region of a gene refer:
https://brainly.com/question/13718397
#SPJ2
According to genomics, a gene's promoter is the area of DNA upstream of it where important proteins, such RNA polymerase and transcription factors, bind to start the gene's transcription.
What is promoter?An area of DNA known as a promoter is where RNA polymerase starts to transcribe a gene. Promoter sequences are often found upstream of the transcription initiation site or at its 5′ terminus.
RNA polymerase and the required transcription factors bind to both promoters and transcription initiation sites. Promoter sequences identify the DNA strand that will be transcribed and describe the direction of transcription.
Promoters use the information RNA polymerase provides to them in these two steps to determine how lactase will be produced. Promoters can range in length from 100 to 1,000 base pairs.
Therefore, According to genomics, a gene's promoter is the area of DNA upstream of it where important proteins, such RNA polymerase and transcription factors, bind to start the gene's transcription.
To learn more about promoter, refer to the link:
https://brainly.com/question/26239758
#SPJ5
cis-1,2-dimethylcyclohexane always has one axial and one equatorial methyl group. t or f
Cis-1,2-dimethylcyclohexane always has one axial and one equatorial methyl group. The given statement is True.
What is Isomer?In chemistry, isomers are molecules or polyatomic ions with identical molecular formulae – that is, same number of atoms of each element – but distinct arrangements of atoms in space.
Isomerism is existence or possibility of isomers. Isomers do not necessarily share similar chemical or physical properties
What is conformer?Conformational isomerism is a form of stereoisomerism in which the isomers can be interconverted just by rotations about formally single bonds.
What is stereoisomerism?In stereochemistry, stereoisomerism, or spatial isomerism, is a form of isomerism in which molecules have the same molecular formula and sequence of bonded atoms (constitution),
They differ in the three-dimensional orientations of their atoms in space.
Geometric isomers are compounds with the same atomic and bond composition but different spatial arrangements of the component atoms.
In cis-1,2-dimethylcyclohexane, one methyl group is axial and one methyl group is equatorial in both ring flip conformers, so neither conformer is more stable than the other.
Learn more about Geometrical Isomer from brainly.com/question/13422357.
#SPJ4