A flower with dull green petals, copious amounts of pollen, and long styles with feathery stigmas would be pollinated by?

Answers

Answer 1

The flower is likely adapted for wind pollination, using copious amounts of lightweight pollen and feathery stigmas to capture it.

A flower with dull green petals, copious amounts of pollen, and long styles with feathery stigmas is likely adapted for pollination by wind. This type of flower produces large quantities of lightweight pollen to increase the chances of successful wind dispersal. The dull green color of the petals is a typical characteristic of wind-pollinated flowers, as they do not rely on attracting specific pollinators such as insects or birds. The long styles with feathery stigmas serve to catch and collect the airborne pollen grains. This strategy allows the flower to maximize its chances of pollination by utilizing the natural movement of the wind.

Learn more about pollen here:

https://brainly.com/question/28965040

#SPJ11


Related Questions

Which of the following statements about genes and alleles are true?1. Qualitative traits are each determined by a single gene that has a small number of alleles2. When a gene has 2 alleles, the allele frequency in a population move toward equilibrium values for 0.5 for each allele3. All else being equal, alleles associated with higher reproductive success decrease in frequency4. If the frequency of an allele in a population has changed over generations, then evolution has occured

Answers

The true statement about genes and alleles is ( 4 ) ;  If the frequency of an allele in a population has changed over generations, then evolution has occurred

Genes are made up of two ( 2 ) alleles, The qualitative or quantitative traits of a human being can not be determined by one gene but by a set of genes. also the frequency of alleles contained in a gene, may move differently and not towards the equilibrium values.

Alleles associated with higher reproductive success do not decrease in frequency rather they increase in frequency through natural selection procedures.

Hence we can conclude that If the frequency of an allele in a population has changed over generations, then evolution has occurred.

Learn more : https://brainly.com/question/9388869

Which of the following statements about genes and alleles are true?1. Qualitative traits are each determined

The diagram shows a process used to produce apple trees with the desired trait of sweeter fruits.


Which labels should be used to complete the diagram?

X: Enzymes
Y: Apple tree DNA
X: Enzymes
Y: Gene for sweeter fruit
X: Apple tree DNA
Y: Gene for sweeter fruit
X: Gene for sweeter fruit
Y: Apple tree DNA

Answers

Answer:

d is the correct answer

Explanation:

Answer:

D.) X: Gene for sweeter fruit

     Y: Apple tree DNA

-------------------------------------------

Correct on Edge 2021! Hopefully this helps you!! :D

Suppose that zonosemata flies whose own wings had been clipped and reattached were attacked more frequently than untreated zonosemata flies. How would this result have affected the reliability of the other experimental results?.

Answers

Suppose that Zonosemata flies whose own wings had been clipped and reattached were attacked more frequently than untreated Zonosemata flies.  All results for the experimental groups involving wing surgery would be invalid.

It has been demonstrated that jumping spiders avoid attacking zonosemata insects because of their mimicking technique. Wings from Zonosemata vittigera were transplanted onto houseflies, and vice versa, as part of the experiment.A wing design that resembles legs and a wing-waving display on the tephritid fly Zonosemata vittigera replicate the aggressive territorial behaviours of jumping spiders. When jumping spiders are stalked by zonosemata flies, the spiders show back and retreat as a result of the display. It has been demonstrated through wing transplant studies that effective imitation requires both the wing pattern and wing-waving displays.The tephritid fly Zonosemata vittigera has dark bands on its wings, which it may wave to avoid predators, particularly scurrying spiders.

To learn more about Zonosemata.

brainly.com/question/14465155

#SPJ4

Scientists believe that 250 million years ago _________.
Pilihan jawaban
the continents were farther apart
the continents were underwater
there was only one active volcano on Earth
The continents were connected

Answers

Answer:

the continents were connected

Explanation:

pangea

our sequence is 5' - cttataaagccgtacaaaatctttctagcgcaaaa - 3'. for simplicity sake, only consider the 5' to 3' direction. consider the underlined c. would a change to a g result in a change in gene expression?

Answers

No, a change to a G would not result in a change in gene expression as the underlined C is a non-coding nucleotide and does not have any effect on gene expression.

Non-coding DNA corresponds to the portion of an organism's genome that does not code for amino acids, the building blocks of proteins. Some noncoding DNA sequences are known to play functional roles such as regulation of gene expression, whereas other regions of noncoding DNA have no known function. Other regions of non-coding DNA are important for protein assembly. By altering one of these regions, a variant (also known as a mutation) in the noncoding DNA can turn on the gene, causing the protein to be produced in the wrong place or at the wrong time. There are two types of SNPs in the coding region.Synonymous and non-synonymous SNPs. Synonymous SNPs do not affect the protein sequence, whereas non-synonymous SNPs change the amino acid sequence of the protein.

To know more about Non-coding DNA visit:

https://brainly.com/question/28360970?referrer=searchResults

#SPJ4

In the name "thermosphere," the prefix "thermo-" refers to what?

Answers

Answer:

heat

Explanation:

the spiral organ contains two groups of hair cells, inner and outer. what is the function of the two groups?

Answers

The organ of Corti can become attuned to particular frequencies, such as those of speech or music, thanks to the function of outer hair cells as acoustic pre-amplifiers, which improve frequency selectivity.

What purpose do inner and outer hair cells serve?

The auditory nerve's 95% of fibres that extend to the brain originate from the inner hair cells, which are the true sensory receptors.

What does the spiral organ do and what are its components?

The hearing receptor organ, sometimes referred to as the spiral organ, is found in the cochlea. It is called the organ of Corti. It is a strip of sensory epithelium composed of hair cells that serves as the inner ear's sensory receptors.

To know more about function visit:-

https://brainly.com/question/19918770

#SPJ4

What do multicellular organisms depend on?

Answers

Answer:

mitosis for growth and repair.

Explanation:

Multicellular organisms depend on mitosis for growth and repair. When an animal, plant or other multicellular organism grows, it makes more cells through mitosis. Organisms can repair some of their tissues, using mitosis to regenerate new cells.

In their 1919 Carnegie Institution publication, Morgan and Bridges discussed their observation that crossing over does not occur in male fruit flies (Drosophila melanogaster). They confirmed this observation when they conducted a breeding experiment involving two autosomal recessive mutations they isolated in their lab. Mutations in the blistered gene (bs) produces blistered veins on the fly's wings. Mutations in the curved gene (c) produces wings that curve away from the fly's body. These two genes, bs and c are both located on chromosome II in D. melanogaster. Morgan and Bridges crossed a curved female with a blistered male and all of the F1 progeny were wild-type. They mated Fu males with F, females (sib matings) and observed only three phenotypes among the F2 progeny. Which phenotype was missing from Morgan and Bridges F2 fruit flies?



a. curved

b. blistered

c. wild type

d. blistered and curved

Answers

The phenotype missing from Morgan and Bridges' F2 fruit flies was "curved."

Based on the information provided, Morgan and Bridges conducted a breeding experiment involving two autosomal recessive mutations, blistered (bs) and curved (c), both located on chromosome II in Drosophila melanogaster. They crossed a curved female (cc) with a blistered male (bsbs) and observed that all the F1 progeny were wild-type (bs+ c+). This indicates that both mutations are recessive.

In the F2 generation, when they mated F1 males (bs+ c+) with F1 females (bs+ c+), they observed only three phenotypes among the offspring. The missing phenotype in the F2 fruit flies is "curved" (cc). This means that none of the offspring exhibited the curved wing phenotype.

The observed phenotypes in the F2 generation would be: wild type (bs+ c+), blistered (bsbs c+), and wild type (bs+ cc). The absence of the "curved" phenotype suggests that the mutation in the curved gene (c) did not segregate independently but was closely linked to the blistered gene (bs) on chromosome II, as there was no recombination between the two genes during gamete formation.

Learn more about mutation here:

https://brainly.com/question/13923224

#SPJ11

Spontaneous generation, the claim that living things can come from nonliving things, was an integral part of the theory of how life began and evolved for many years. In the 1600s, Francesco Redi was the first scientist to try to disprove spontaneous generation. Louis Pasteur, in 1859, finally disproved this claim with scientific evidence.

Answers

Answer:

The answer is Scientific thoeries are a culmination of many scientific investigations drawing together all current evidence.

Explanation:

Why are offshore wind farms becoming more common then land based wind farms

Answers

Offshore wind farms are becoming more common than land-based wind farms due to several reasons. In this answer, we will discuss why offshore wind farms are gaining more popularity.

Firstly, offshore wind farms are less obstructive and intrusive than land-based wind farms. Offshore wind farms are usually located far from residential areas, unlike land-based wind farms, which may sometimes lead to complaints from local residents regarding noise and visual impact. With offshore wind farms, this is not a problem, and there are no visual impacts on the surrounding landscapes. Additionally, the noise generated by offshore wind farms is typically quieter, as the turbines are located further away from people.

Secondly, offshore wind farms have stronger and more consistent wind speeds. The wind speed over the ocean is usually stronger and more consistent compared to land. This is due to several reasons, including less turbulence over the ocean and no natural obstacles like mountains or trees that can obstruct the wind flow.

Thirdly, the scale of offshore wind farms is much larger than land-based wind farms. With more space available, wind farms can accommodate larger and more powerful turbines, generating more electricity. Larger wind turbines installed offshore have larger rotor diameters and can access stronger and more consistent winds, enabling them to generate more electricity than land-based turbines.

Finally, offshore wind farms have less visual impact than land-based wind farms. The turbines are much further away from the shore and are not visible to many people, so there is less visual impact. Offshore wind farms can be an attractive option for countries with limited land space and high electricity demand.

In conclusion, offshore wind farms are becoming more common than land-based wind farms due to their less obstructive nature, stronger and more consistent winds, larger scale, and less visual impact. These benefits make offshore wind farms an attractive option for countries seeking to generate more renewable energy and reduce carbon emissions.

To know more about offshore visit :

https://brainly.com/question/28773484

#SPJ11

________ exercise strengthens skeletal muscle, and ________ exercise strengthens skeletal and cardiac muscle.
a. resistance, aerobic
b.aerobic, aerobic
c. aerobic, resistance
d. resistance, resistance

Answers

Answer:

D ANSWER OK

Explanation:

BECAUSE IT IS THE RIGHT ANSWER

Insectivora is a taxonomic grouping that was used to describe insect-eating like armadillos, hedgehogs, moles, and anteaters. The taxonomy of these animals has been revised in recent years, and insectivora is no longer widely accepted because this group of organisms lacks one common ancestor and is instead descended from several ancestors. Which term best describes insectivora?



A. Monophyletic


B. Haplophyletic


C. Paraphyletic


D. Polyphyletic

Answers

The term that best describes "Insectivore" in this context is "C. Paraphyletic."

A monophyletic group consists of an ancestral species and all its descendants. A haplophyletic group includes some, but not all, of the descendants of a common ancestor. A paraphyletic group includes an ancestral species and some, but not all, of its descendants. A polyphyletic group includes species that do not share a common ancestor. Since "Insectivore" comprises organisms descended from several ancestors and lacks one common ancestor, it does not form a monophyletic group. It is considered paraphyletic because it includes some, but not all, of the descendants of the common ancestor.

learn more about:- insectivora here

https://brainly.com/question/31383952

#SPJ11

Summarize the flow of carbon, oxygen ,water, nitrogen, and phosphorus through an ecosystem. ( Minimum of three paragraphs please)

Answers

Answer:

Water is the basis of all living processes. More than half of the human body is made up of water, while human cells are more than 70 percent water. Thus, most land animals need a supply of fresh water to survive. However, when examining the stores of water on earth, 97.5 percent of it is non-potable salt water. Of the remaining water, 99 percent is locked underground as water or as ice. Thus, less than 1 percent of fresh water is easily accessible from lakes and rivers. Many living things, such as plants, animals, and fungi, are dependent on the small amount of fresh surface water supply, a lack of which can have massive effects on ecosystem dynamics. Humans, of course, have developed technologies to increase water availability, such as digging wells to harvest groundwater, storing rainwater, and using desalination to obtain drinkable water from the ocean. Although this pursuit of drinkable water has been ongoing throughout human history, the supply of fresh water is still a major issue in modern times.

Carbon, the second most abundant element in living organisms, is present in all organic molecules. Its role in the structure of macromolecules is of primary importance to living organisms. Carbon compounds contain especially- high forms of energy, which humans use as fuel. Since the 1800s (the beginning of the Industrial Revolution), the number of countries using massive amounts of fossil fuels increased, which raised the levels of carbon dioxide in the atmosphere. This increase in carbon dioxide has been associated with climate change and other disturbances of the earth’s ecosystems. It is a major environmental concern worldwide.

The carbon cycle is most easily studied as two interconnected sub-cycles: one dealing with rapid carbon exchange among living organisms and the other dealing with the long-term cycling of carbon through geologic processes.

Getting nitrogen into the living world is difficult. Plants and phytoplankton are not equipped to incorporate nitrogen from the atmosphere (which exists as tightly-bonded, triple-covalent N2), even though this molecule comprises approximately 78 percent of the atmosphere. Nitrogen enters the living world via free-living and symbiotic bacteria, which incorporate nitrogen into their macromolecules through nitrogen fixation (conversion of N2). Cyanobacteria live in most aquatic ecosystems where sunlight is present; they play a key role in nitrogen fixation. Cyanobacteria are able to use inorganic sources of nitrogen to “fix” nitrogen. Rhizobium bacteria live symbiotically in the root nodules of legumes (such as peas, beans, and peanuts), providing them with the organic nitrogen they need. Free-living bacteria, such as Azotobacter, are also important nitrogen fixers.

Phosphorus is an essential nutrient for living processes. It is a major component of nucleic acid, both DNA and RNA; of phospholipids, the major component of cell membranes; and, as calcium phosphate, makes up the supportive components of our bones. Phosphorus is often the limiting nutrient (necessary for growth) in aquatic ecosystems.

Phosphorus occurs in nature as the phosphate ion (PO43−). In addition to phosphate runoff as a result of human activity, natural surface runoff occurs when it is leached from phosphate-containing rock by weathering, thus sending phosphates into rivers, lakes, and the ocean. This rock has its origins in the ocean. Phosphate-containing ocean sediments form primarily from the bodies of ocean organisms and from their excretions. However, in remote regions, volcanic ash, aerosols, and mineral dust may also be significant phosphate sources. This sediment then is moved to land over geologic time by the uplifting of areas of the earth’s surface.

Explanation:

Oncogenes are genes that can cause tumor formation as a result of a particular mutation. Which of the following potential therapies would be most effective at preventing the expression of an oncogene?aReducing the number of ribosomes in the cell to prevent the creation of the oncogene’s proteinsbBlocking membrane-bound receptors of transcription factorscIntroducing a chemical that binds to transcription factors associated with the oncogene’s promoterdProducing additional transcription factors for tumor suppressor genes in the cell

Answers

Oncogenes are genes that, when mutated, have the potential to promote uncontrolled cell growth and contribute to tumour formation. One of the key steps in the expression of oncogenes is the binding of transcription factors to the promoter region of the gene, which initiates the transcription and subsequent translation of the oncogene's proteins.

To prevent the expression of an oncogene, targeting the transcription factors associated with its promoter is an effective strategy. By introducing a chemical that specifically binds to these transcription factors, their ability to activate the oncogene's expression can be inhibited or reduced. This interference in the transcription process would prevent or decrease the production of the oncogene's proteins, thereby impeding tumour formation. The most effective therapy among the options listed for preventing the expression of an oncogene would be: Introducing a chemical that binds to transcription factors associated with the oncogene's promoter.

Learn more about tumour here ;

https://brainly.com/question/29562847

#SPJ11

adrenocorticotropic hormone​

Answers

Explanation:

adrenocorticotropic hormone= It stimulates the adrenal cortex.

Let chatelier's principle applies to gas exchange

Answers

Le Chatelier's principle states that when a system at equilibrium is subjected to a stress, the system will adjust itself in order to counteract the stress.

This principle can be applied to gas exchange, which is the process of  swapping  feasts between two bodies. When a body is exposed to a  drop in pressure, the body will acclimate itself in order to  offset the  drop in pressure. This can be seen when a diver swims to a lesser depth, where the pressure is lesser.

The diver's lungs will acclimate to the lesser pressure by  dwindling the volume of the lungs,  therefore allowing the diver to take in  further oxygen. also, when a diver swims to a  lower depth, the pressure decreases, and the lungs will acclimate by  adding  the volume to  offset the  drop in pressure.

Question is incomplete the complete question is

What does Le chatelier's principle applies to gas exchange?

To know more about Le Chatelier's principle visit:

https://brainly.com/question/29009512

#SPJ4

Some students are playing ultimate frisbee in a grass field. After their game, they forget a frisbee on the field. The frisbee is dark black and therefore zero PAR (photosynthetically active radiation) passes through the frisbee. Is the following statement true or false? Why? The grass under the frisbee will be metabolically inactive until the frisbee is removed during the next day' s game.
a. The statement is false. Plants can rely on stored energy and be metabolically active even in the absence of sunlight
b. The statement is false. Plants have associations with other organisms and therefore will almost never be metabolically inactive.
c. The statement is true. Plants require sunlight, water, and CO2 to photosynthesize.
d. The statement is true. Plants go dormant when they do not have access to light
e. The statement is false. Plants can use heat energy to photosynthesize, and the black frisbee will heat up as it absorbs PAR.

Answers

False, plants also store energy and exhibit respiration and plants use this stored energy to function.

Photosynthesis is a process that plants and other organisms use to convert light energy into chemical energy that can then be released to fuel the organism's activities via cellular respiration. The pea pod used sunlight energy to build sugar molecules with the help of carbon dioxide and water. When the rabbit ate the pea pod, it received energy from the sun that was stored in the plant's sugar molecules.

Photosynthesis' primary function is to convert solar energy into chemical energy and then store that chemical energy for later use. This process powers the majority of the planet's living systems.

To learn more about photosynthesis, here

https://brainly.com/question/1388366

#SPJ4

Resting membrane potential depends on: i. differential distribution of ions across the axon membrane ii. the opening of voltage-gated calcium channels iii. active transport of ions across the membrane

Answers

Resting membrane potential depends on differential distribution of ions across the axon and active transport of ions across the membrane.

What is resting membrane potential?Resting membrane potential is the static potential difference between the inside of the cell to outside due to the differential distribution of ions on both side of the membrane.It is due to uneven distribution of ions, differential permeability of membrane to the ions and the activity of ion channels like Na+ and K+ channel.During the resting membrane potential, a cell is at rest and does not carry any signal.The value of resting membrane potential varies in different cell types.In a typical nerve cell, value of resting membrane potential is -70mV.When the cells are excited, membrane potential changes drastically for few milliseconds and is called action potential.

Learn more about resting membrane potential here:

https://brainly.com/question/15459255

#SPJ4

Fibers from which structure(s) cross the midline prior to synapsing in the cerebellum?a. Pontine nucleib. Dorsal nucleus of Clarkec. Vestibular nucleid. External cuneate nucleus

Answers

Fibers from the pontine nuclei cross the midline prior to synapsing in the cerebellum. Option a. is correct.

The pontine nuclei are a group of cells located in the pons region of the brainstem. They receive input from various regions of the cerebral cortex and send fibers that cross the midline, known as the middle cerebellar peduncle, to the opposite side of the cerebellum.

These fibers carry information about voluntary movements, motor planning, and coordination. The crossing of fibers at the midline is an important characteristic of the cerebellar pathway.

Once the crossed fibers reach the opposite side of the cerebellum, they synapse with cells in the cerebellar cortex, particularly in the cerebellar hemispheres.

This connection allows for the integration and processing of motor information from different parts of the body. The cerebellum plays a crucial role in fine-tuning motor movements, maintaining balance, and coordinating voluntary actions. The involvement of the pontine nuclei and the crossing of fibers at the midline are key components of the cerebellar circuitry.

Learn more about pontine nuclei here:

https://brainly.com/question/27320384

#SPJ11

Consuming carotenoids may reduce the risk for all of the following except
A. acne.
B. cataracts.
C. age-related macular degeneration.
D. cardiovascular disease.

Answers

Consuming carotenoids is generally associated with various health benefits, including reducing the risk of certain diseases. The correct answer to the question is D. cardiovascular disease

Carotenoids are a group of pigments found in fruits, vegetables, and other plant-based foods that possess antioxidant properties. While they are known to promote overall health, they may not necessarily have a direct impact on all conditions.

Among the options provided, carotenoids have been linked to a reduced risk of acne, cataracts, and age-related macular degeneration (AMD). Carotenoids, such as beta-carotene, lutein, and zeaxanthin, have been shown to have protective effects on the skin and may help in managing acne-prone skin. Similarly, these compounds have been associated with a lower risk of cataracts, which are clouding of the eye's lens, and AMD, a progressive eye disease that affects the central part of the retina.

However, when it comes to cardiovascular disease (CVD), the evidence is less clear. While carotenoids have been studied for their potential cardiovascular benefits, including their antioxidant and anti-inflammatory effects, the relationship between carotenoid consumption and the risk of CVD is complex and not fully understood. Other dietary and lifestyle factors, such as a balanced diet, regular exercise, and avoiding smoking, play significant roles in reducing the risk of cardiovascular disease.

Therefore, the correct answer to the question is D. cardiovascular disease, as consuming carotenoids may not directly reduce the risk of this condition, although they may contribute to overall cardiovascular health in conjunction with a healthy lifestyle.

To know more about carotenoids click here:

https://brainly.com/question/13631581

#SPJ11

what prevents coral reefs from surviving below the euphotic zone? group of answer choices high water density high pressure inadequate sunlight saline water damage from storms

Answers

Inadequate sunlight prevents coral reefs from surviving below the euphotic zone.

The majority of coral reefs are found nearby in shallow water. Due of this, they are particularly susceptible to the negative consequences of human activity, both directly via the exploitation of reef resources and indirectly through the effects of nearby human activities on land and in the coastal zone. The social, cultural, and economic fabric of local coastal communities is intricately intertwined with many of the human activities that harm coral reefs.

Numerous local risks to coral reefs exist, such as:

Physical harm or devastation caused by recreational overuse, coastal development, dredging, quarrying, harmful fishing methods and equipment, boat anchors and groundings, etc (touching or removing corals).

Land-based pollution that makes its way into coastal waterways There are several pollution kinds and sources from land-based activities.

1.sedimentation

2. Nutrients

3. pathogen

4. Toxic substances

To know more about euphotic zone visit:
https://brainly.com/question/18991186
#SPJ4

What are the most harmful plants found in earth​

Answers

Water Hemlock (Cicuta maculata) ...
Deadly Nightshade (Atropa belladonna) ...
White Snakeroot (Ageratina altissima) ...
Castor Bean (Ricinus communis) ...
Rosary Pea (Abrus precatorius) ...
Oleander (Nerium oleander) ...
Tobacco (Nicotiana tabacum)

Explanation:

...... Water Hemlock .......

Do analogous structures show an evolutionary relationship between two species (meaning do they show that individuals with analogous structures come from a common ancestor). Example: Flies and birds have wings. Do wings show that a fly is related to a bird?

Answers

Answer:

The correct answer is - NO.

Explanation:

To be specific to the question, the answer would be no as analogous structures do not show that two distinct come from a common ancestor. However, it shows the evolutionary relationship by stating that the species have different evolutionary origins and developmental patterns as they developed the organs with similar function and appearance but anatomically and embryological development is different.

The answer to the question "Do wings show that a fly is related to a bird?", is no it does not show the relation between fly and bird.

Cuestions
Explain why you needed to use a water plant for collecting the gas produced in photosynthesis

Answers

the conversion of unusable sunlight energy into usable chemical energy,is associated with the actions of the green pigment chlorophyll. most of the time, the photosynthetic process ises water and releases the oxygen that we absolutely must have to stay alive

For this structural characteristic, decide if it is a characteristic of ​ DNA ​, a characteristic of RNA , a characteristic of both ​DNA ​and RNA , or a characteristic of neither DNA ​nor RNA .

It contains thymine as a base.

Answers

answer: DNA

Dna contains thymine as a base, and RNA contains uracil

the anammox reaction of the nitrogen cycle occurs in water true or false

Answers

Answer:

False

Explanation:

In the ocean, an anammox reaction returns nitrogen to the atmosphere. The reaction involves certain bacteria, and it converts ammonium and nitrite ions to nitrogen gas.

Ascomycota is an example of a kingdom.
O True
O False

Answers

Answer:

Im sorry this is all i know

Is ascomycota a parasite?

Most common moulds belonging to the Hyphomycetes are ascomycetes. ... They may be saprobes, parasites (especially of plants), or lichen forming, mostly terrestrial; cosmopolitan (50 orders, 275 families, 3328 genera, 32,325 spp). Ascomycetes are characterized by septate hyphae with simple pores.

Explanation:

How are the sensory regions of the brain related to synesthesia?

Answers

Answer:

These “higher level” brain areas are most likely related to three different cognitive processes inherently part of synaesthesia: the sensory processes (with the sensory areas), the attentional processes especially controlling the binding process (within the parietal lobe), and the cognitive processes.

21. Which 2 body systems work together to
produce and transport blood cells?
a. Circulatory and muscular
b. Digestive and Excretory
c. Skeletal and integumentary
d. Skeletal and circulatory

Answers

d) skeletal and circulatory

explanation :
These are the main roles of the circulatory system. The heart, blood and blood vessels work together to service the cells of the body. Using the network of arteries, veins and capillaries, blood carries carbon dioxide to the lungs (for exhalation) and picks up oxygen.
Other Questions
the nurse is working in the intensive care unit with a client in shock. during hand-off the nurse reports the results of which assessment findings that signal early signs of the decompensation stage? select all that apply. Read the excerpt from Julius Caesar, act 3, scene 2.ANTONY. Friends, Romans, countrymen, lend1445me your ears.I come to bury Caesar, not to praise him.The evil that men do lives after them;The good is oft interrd with their bones.So let it be with Caesar. The noble BrutusHath told you Caesar was ambitious.1450If it were so, it was a grievous fault,And grievously hath Caesar answered it.Here, under leave of Brutus and the restFor Brutus is an honourable man,So are they all, all honourable men1455Come I to speak in Caesars funeral.He was my friend, faithful and just to me.But Brutus says he was ambitious,And Brutus is an honourable man.He hath brought many captives home to Rome,1460Whose ransoms did the general coffers fill.Did this in Caesar seem ambitious?When that the poor have cried, Caesar hath wept.Ambition should be made of sterner stuff.Yet Brutus says he was ambitious,1465And Brutus is an honourable man.You all did see that on the LupercalI thrice presented him a kingly crown,Which he did thrice refuse. Was this ambition?Which conclusion does this excerpt best support?Antony agrees with Brutus definition of ambition.Antony wants to make the people angry by manipulating the words of Brutus and favoring Caesar.Antony believes that Brutus and the others are as virtuous as Caesar.Antony wishes that Caesar would have been more generous and a better friend.47 How blockchain could strengthen the pharmaceutical supply chain? PLEASE HELP DUE TMRW!What is the vocabulary term for a number that can be written as a fraction or a decimal.that either terminates or repeats? A.IntegerB.Rational NumberC.Absolute ValueD.Additive Inverse jobs that are too simple and routine result in employee blank . (check all that apply.) multiple select question. absenteeism loyalty dissatisfaction turnover satisfaction Simplify the quantity 9 minus two thirds times the square root of 9 end quantity squared plus the quantity 1 minus 6 end quantity squared. 74 24 495 1,225 how do game keep physically? What country are the Hurons and Magua helping in this movie? How does homeostasis work within our blood? Question 2: Write Prolog predicate named SubsetT that accepts two lists L1, L2, and verify if L2 is a subset of L1 or not. Sample run: ?-Subset([4,5,3,2],[3,2]). True ?-Subset([4,5,3,2],[10,9]). False the atlantic journey of the irish was similar to the passage of african slaves because maintaining proper hygien like wasing your hands lessen the transmission of the virus Muscles of the pectoral girdle attach proximally on the. If dr. hamline wants to know whether the most difficult items on the statistics test she created were answered correctly only by the top-performing students in her class, she would need to assess:_________ Fallingstar, Inc. has shares of common stock issued and outstanding, with a par value of per share. It declared a % common stock dividend; market value is per share. Which of the following is the correct journal entry to record the transaction? a. debit Common Stock Dividend Distributable 51,154, debit Paid In Capital in Excess of Par-Common $196,606, and credit Retained Earnings $197.760.b. debit Stock Dividends $197.760 and credit Cash $197.760.c. debit Stock Dividends $197.760 and credit Paid - In Capital in Excess of Par-Common $197,760.d. debit Stock Dividends $197.760, credit Common Stock Dividend Distributable 51.154, and credit Paid - In Capital in Excess of Par-Common $196,606. True or false. The center of gravity and center of mass of an object need to be in the same spot? Which equation is not a linear function?y =Y = +2y = 21y = 2 Engineering The equation for the cross section of a spotlight is y+5= 1/2x^2. measured in inches. The bulb is located at the focus. How far is the bulb from theVertex of the cross section? A meal costs $110 plus a service charge of 18%.Calculate the total cost of the meal Describe how moving the mountain lions could affect the ecosystem