It rounds to the most significant number in the amount. When rounding to a significant figure, look at the first non-zero digit if doing so to one. If rounding to two significant figures, look at the digit following the first non-zero digit.
Similar to how we would round a number to three decimal places, we round a number to three significant figures. When there are three digits, we start counting at the first non-zero digit. The final digit is then rounded. We add zeros to all remaining spaces to the right of the decimal point.
Learn more about the non-zero digit,
https://brainly.com/question/24211030
#SPJ4,
Charles Darwin concluded that the 13 species of finches on the Galapagos islands:A. all adapted to the same predators in different ways.B. All of these.C. probably evolved from one single ancestral species from the mainland.D. are identical to species on the mainland.
The correct answer is C. probably evolved from one single ancestral species from the mainland. Darwin realized that Finches differed form their relatives in mainland. The finches he saw were all particular on their own, so he concluded that their isolation from mainland and their insular habitat make them to evolve different traits, eventually each finch become a different species.
A biologist suspects that a plant species has two codominant alleles for flower petal color, one for rer
(R) and one for white (W). The biologist crosses one plant with red flower petals with one plants with
white flower petals..
The plant species has two codominant alleles for flower petal color: red (R) and white (W).
When the biologist crosses one plant with red flower petals with one plant with white flower petals, the resulting offspring will all be heterozygous for flower petal color (RW). This is because each parent can only pass on one allele to their offspring, resulting in a genotype of RW. Because the alleles for flower petal color in this species are codominant, the phenotype of the offspring will be a blend of red and white petals.
This means that the flowers of the heterozygous offspring will have both red and white petals, resulting in a pinkish color.In conclusion, the biologist's hypothesis that the plant species has two codominant alleles for flower petal color (R and W) is supported by the results of the cross. The offspring are heterozygous for both alleles, resulting in a phenotype that is a blend of both red and white petals.
Learn more about codominant alleles here:
https://brainly.com/question/8368376
#SPJ11
Mutations within the DNA sequence of an organism can-
a) result in alterations that are harmful to an organism
b) result in alterations that do not affect the organism
c) all of the above
d) result in alterations that are helpful to an organism
Mutations within the DNA sequence of an organism can result in alterations that are harmful to an organism, resulting in alterations that do not affect the organism. Therefore option c is correct.
Mutations within the DNA sequence of an organism can result in a range of outcomes.
Some mutations can be harmful, leading to changes in protein structure or function that negatively impact the organism's survival or reproductive success.
Other mutations may have no significant effect on the organism, particularly if they occur in non-coding regions or are "silent" mutations that do not change the amino acid sequence.
Additionally, mutations can be beneficial, providing advantageous traits that enhance the organism's adaptation to its environment or improve its reproductive fitness.
The variability in mutation outcomes is a fundamental driver of genetic diversity and evolution in populations.
Therefore option C all of the above is correct.
Know more about DNA sequence:
https://brainly.com/question/34432861
#SPJ6
20 points PLEASE HELP
edge 2021
Which is the correct pathway of air to the lungs?
mouth/nose, pharynx , larynx , trachea ,. bronchial tubes , lungs
mouth/nose , larynx ,. pharynx , trachea , bronchial tubes , lungs
mouth /nose , trachea , pharynx , larynx ,. bronchioles ,. lungs
mouth/nose ,. pharynx ,trachea , larynx , bronchioles , lungs
Answer:
The air that we breathe in enters the nose or mouth, flows through the throat (pharynx) and voice box (larynx) and enters the windpipe (trachea). The trachea divides into two hollow tubes called bronchi. ... The medical term for all the air tubes from the nose and mouth down to the bronchioles is 'the respiratory tract'.
Which of the following describes why a glucose transporter is needed to move glucose into the cell?
Glucose is nonpolar and requires ATP to move across the membrane.
Answer A: Glucose is nonpolar and requires A T P to move across the membrane.
A
Glucose molecules are polar and need to move from low concentration to high concentration.
Answer B: Glucose molecules are polar and need to move from low concentration to high concentration.
B
Glucose molecules are charged, and charged molecules are only ever actively transported.
Answer C: Glucose molecules are charged, and charged molecules are only ever actively transported.
C
Answer D: Glucose is large and polar and cannot pass through the phospholipid bilayer.
A glucose transporter is needed to move glucose into the cell because glucose molecules are polar and need to move from low concentration to high concentration.
What do you mean by Glucose Transporters?Glucose transporters may be defined as proteins that facilitate the transport of glucose across the plasma membrane.
Glucose transporters work with the concentration gradient. This process of moving glucose across the cell membrane is called facilitated diffusion.
Therefore, a glucose transporter is needed to move glucose into the cell because glucose molecules are polar and need to move from low concentration to high concentration.
To learn more about Glucose transporters, refer to the link:
https://brainly.com/question/24986163
What is the 95% CI for data set 2?
data points - 10, 20, 30
n = 3
mean = 20
s = 10
SEM = 5.77
2SEM = 11.54
Answer: 20 ± 11.32
Explanation: Confidence Interval (CI) is an interval of values where there is a % certainty the true mean value lies in. For example, a 95% CI means there is a 95% certainty the true mean value lies in the interval.
For the data set 2, z-value for 95% confidence interval is z = 1.96
Formula to calculate CI is
x ± \(z\frac{s}{\sqrt{n} }\)
where
x is mean
z is z-value
s is standard deviation
n is the sample number
Then:
20 ± \(1.96\frac{10}{\sqrt{3} }\)
20 ± \(1.96\frac{10}{1.7320}\)
20 ± \(\frac{19.6}{1.7320}\)
20 ± 11.32
The 95% CI is 20 ± 11.32, which means there is a 95% certainty the true value is between 8.68 and 31.32.
. To study the effects of genes on infants' stress response, researchers can Compare infants' interactions when their mothers work full-time or when their mothers stay at home with them. Compare adopted and non-adopted infants when they meet a stranger. Compare monozygotic and dizygotic twins when they are separated from their mother. Compare siblings when they fight with each other.
The following are ways in which researchers can do this: Compare infants' interactions when their mothers work full-time or when their mothers stay at home with them and work full-time or stay at home with them will reveal the effects of maternal employment on infants' stress response.
Some studies suggest that maternal employment is associated with higher levels of cortisol, the stress hormone, in infants. Infants' cortisol levels are typically lower when their mothers stay at home with them than when they work full-time .Compare adopted and non-adopted infants when they meet a stranger.
Researchers can also study the effects of genes on infants' stress response by comparing adopted and non-adopted infants when they meet a stranger. Adopted infants have a different genetic background than non-adopted infants. This difference in genetic background can have an impact on how the infants respond to a stranger. Some studies have shown that adopted infants show a higher level of cortisol response than non-adopted infants when they meet a stranger.
Compare monozygotic and dizygotic twins when they are separated from their mother. Researchers can also study the effects of genes on infants' stress response by comparing monozygotic and dizygotic twins when they are separated from their mother. Monozygotic twins share 100% of their genetic makeup, while dizygotic twins share only 50% of their genetic makeup.
Therefore, any difference in cortisol response between monozygotic and dizygotic twins when they are separated from their mother can be attributed to genetic factors. Compare siblings when they fight with each other. Finally, researchers can study the effects of genes on infants' stress response by comparing siblings when they fight with each other. Siblings share 50% of their genetic makeup and 100% of their environment.
Therefore, any difference in cortisol response between siblings when they fight with each other can be attributed to genetic factors.
To know more about infants, refer here:
https://brainly.com/question/11894437#
#SPJ11
Animal Cells Answers
Explanation:
1. The cell membrane is a thin, semipermeable layer that surrounds the cell and separates the cell from its environment.
2. The nucleus is the control center of the cell, containing the cell's genetic material (DNA) and governing all of the cell's activities.
3. Endoplasmic reticulum (ER) is a network of membranes in the cytoplasm of the cell, which is involved in the production, modification, and transport of proteins and lipids.
4. Mitochondria are organelles that produce energy for the cell through cellular respiration.
5. The Golgi apparatus is a membrane-bound organelle that modifies and packages proteins and lipids for storage and transport.
6. Ribosomes are organelles that produce proteins based on instructions from the nucleus.
7. Lysosomes are organelles that contain digestive enzymes and help the cell break down and recycle waste materials.
8. The cytoskeleton is a network of proteins that helps the cell maintain its shape and provides support for the movement of organelles and other materials within the cell.
What type of scientist would be the best qualified to perform genetic engineering to pro- duce seed that are more productive in agriculture? A. biochemist B. geologist C. molecular biologist D. paleontologist
The type of scientist best qualified to perform genetic engineering to produce more productive seeds in agriculture would be a molecular biologist, the correct option is C.
Molecular biologists specialize in studying the structure, function, and interactions of molecules within biological systems, including DNA and genes. Genetic engineering involves manipulating the genetic material of organisms, which requires a deep understanding of molecular biology principles.
Molecular biologists have the expertise to identify and isolate specific genes responsible for desired traits in crop plants, such as increased productivity or resistance to pests or diseases. They can then modify or introduce these genes into target plants to achieve the desired outcomes, the correct option is C.
To learn more about genetic follow the link:
https://brainly.com/question/28980835
#SPJ4
A biologist observed a plant cell in a drop of water as shown in diagram A. The biologist added a 10% salt solution to the slide and observed the cell as shown in diagram B. The change in appearance of the cell resulted from A) more salt moving out of the cell than into the cell B) more salt moving into the cell than out of the cell C) more water moving into the cell than out of the cell D) more water moving out of the cell than into the cell
Explanation:
hope this helps
check it out
A biologist added a 10% salt solution to the slide and observed the cell as shown in diagram B. The change in appearance of the cell resulted from
D) more water moving out of the cell than into the cellAccording to the complete diagram, we can see that there is a transport between cells as there is a change in appearance as the biologist added a 10% solution to the second cell.
As a result of this, we can see that through the rigid cell wall, vacuole and cytoplasm, there are mechanisms for transport as it allowed more water to move out of the cell than into the cell which caused the shrinkage.
Therefore, the correct answer is option D
Read more here:
https://brainly.com/question/454390
hi help please! what is the difference between mitosis & meiosis?
Answer:
Mitosis is the process by which body cells divide and multiply. Through mitosis, a parent cell will split into two daughter cells, each containing 46 chromosomes.
Meiosis is the process by which sex cells divide and multiply. Through meiosis, a parent cell will split into four daughter cells, each containing 23 chromosomes.
Hope this helps! :)
what is the name of one of the lower chambers of the heart that receives blood from the upper chambers and pumps it into the arteries?
An environmental impact refers to a change in the habitat and living conditions in ecosystems for plant and animal species. Which of the following
describes an environmental impact of using direct seeding mulch-based cropping (DMC) instead of traditional agricultural methods?
A. Reduced labor costs
B. Increased amount of food source
C. Stimulated biological activity in soils
D. Less equipment needed to farm
The statement that describes an environmental impact of using direct seeding mulch-based cropping instead of traditional agricultural methods is that there is reduced labor costs.
What is direct seeding mulch-based cropping (DMC)?The direct seeding mulch-based cropping is one of the agro-ecology strategies to improve agricultural practices.
Prior to the implementation of DMC, traditional approach of agriculture has been used. This has been labor-intensive i.e. uses a lot a labor.
Therefore, the statement that describes an environmental impact of using direct seeding mulch-based cropping (DMC) instead of traditional agricultural methods is that there is reduced labor costs.
Learn more about DMC at: https://brainly.com/question/3632132
List features shared by plants and charophytes that are not shared with most other eukaryotes
The features which are shared by plants and charophytes that are not shared with most other eukaryotes include:
ChloroplastCellulose structure.What is a Chlorophyll?This is referred to as a type of pigment which is green in color and is found and housed in the organelle known as chloroplast. It also traps the solar energy from the Sun which is required for photosynthetic activities and making of food by them.
Plants and charophytes have shared characteristics such as the presence of chlorophyll a and b and a cellulose structure which makes them rigid which makes them different from other eukaryotes.
Read more about Plants here https://brainly.com/question/600212
#SPJ1
Think about the land in the region where you live. How was it shaped by plate tectonics? Is it still impacted by the movement of plates? Explain your answer.
the region is southeast
Explanation:
Geologic history is the way into this aid and to understanding the story recorded in the stones of the Southeastern US. By finding out about the geologic history of your space, you can all the more likely comprehend the kinds of rocks that are in your terrace and why they are there. In this part, we will view the historical backdrop of the Southeast as it unfurled: as a progression of significant occasions that made and molded the region in the course of the last one billion years. These occasions will go about as the structure for the subjects in the sections to follow and will reveal insight into why our locale looks the manner in which it does.
At long last, Wegener examined the stratigraphy of various rocks and mountain ranges. The east shore of South America and the west shoreline of Africa appear to fit together like bits of a jigsaw puzzle, and Wegener found their stone layers "fit" similarly as plainly. South America and Africa were not by any means the only landmasses with comparable geography. Wegener found that the Appalachian Mountains of the eastern United States, for example, were topographically identified with the Caledonian Mountains of Scotland.
Pangaea existed around 240 million years prior. By around 200 million years prior, this supercontinent started separating. For more than a long period of time, Pangaea isolated into pieces that moved away from each other. These pieces gradually expected their situations as the mainland we perceive today. Today, researchers feel that few supercontinents like Pangaea have shaped and separated throughout the span of the Earth's life expectancy. These incorporate Pannotia, which was framed around 600 million years prior, and Rodinia, which existed in excess of a billion years prior.
Structural Activity Researchers didn't acknowledge Wegener's hypothesis of mainland float. One of the components ailing in the hypothesis was the system for how it functions—for what reason did the landmasses float and what examples did they follow? Wegener recommended that maybe the pivot of the Earth made the landmasses shift towards and aside from one another. (It doesn't.) Today, we realize that the landmasses lay on enormous pieces of rock called structural plates. The plates are continually moving and collaborating in a cycle called plate tectonics. The landmasses are as yet moving today. Probably the most powerful destinations of structural action are ocean bottom spreading zones and goliath break valleys.
How do plants turn sunlight into energy?
This needs to have a chemical equation, reactants, and products.
A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT
The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.
In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.
In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.
The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.
It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.
For more such answers on RNA
https://brainly.com/question/13939644
#SPJ8
read the abstract for the article on coral trees in italy (number 2 listed in the above examples). what is the purpose of their work?
The purpose of the tentacles of coral polyps is for defense, food capture, and clearing. This is the main purpose of this particular activity.
What are the composition of coral reefs and their process of reproduction?Coral reefs are made up of genetically identical coral polyps. new polyps develop as offshoots from the parental polyp. Coral reefs are made up of genetically identical coral polyps. new polyps develop as offshoots from the parental polyp.
The type of reproduction do coral polyps use to multiply themselves are budding as the outgrowth and eventual splitting off of a new individual from a parent and fission is the separation of a parent into two or more offspring of about equal size and the another process is fragmentation which is the breaking of the parent body into several pieces follow by regeneration.
Therefore, The purpose of the tentacles of coral polyps is for defense, food capture, and clearing. This is the main purpose of this particular activity.
Learn more about coral polyps on:
https://brainly.com/question/2102287
#SPJ1
hich of the following amino acids can contribute to the three-dimensional structure of a protein by forming covalent bonds with an identical amino acid in another part of the protein
Cysteine contributes to the three-dimensional structure of a protein by forming covalent bonds with an identical amino acid in another part of the protein.
What is the Cysteine Structure?Covalent disulfide bonds form between the sulfhydryl (-SH) groups of cysteines in different parts of a protein are very important in determining the three-dimensional shape of the protein.is a HOOC-CH-(NH2)-CH2-SH proteinogenic amino acid that is semi-essential. Cysteine's thiol side chain frequently functions as a nucleophile in enzyme processes.The sign Cyz is occasionally used when a deprotonated catalytic residue is present.The sign Cym can also be used to usually denote the deprotonated form.The thiol is capable of being oxidized to produce the disulfide derivative cystine, which is crucial for many proteins' structural integrity. Cyx is sometimes used in this context. It carries the E identifier E920 when added to food.The codons UGU and UGC encode the amino acid cysteine.Cysteine and methionine, which contain sulfur, are more quickly oxidized than other amino acids.To know more about Cysteine with the given
https://brainly.com/question/14835777
#SPJ4
In order for geothermal energy to be produced efficiently, the geology of the area needs high subsurface _______
A. Depth
B. Pressure
C. Salinity
D. Temperature
help me please help me help me help me help me help
Answer:
D. Temperature
plz mark me as brainliest
many biologists think the current rate of species extinction indicates that a sixth mass extinction is underway. life has endured numerous mass extinctions and has always bounced back. how might the impact of human activities make this sixth mass extinction different from previous mass extinctions?
The 6th mass extinction is likewise known as the Anthropocene extinction and it's miles one-of-a-kind from the preceding 5 due to the fact it's miles especially resulting from humans.
This extinction is one hundred to one thousand instances quicker than the ultimate 5 extinctions and if it progresses withinside the following charge 1/2 of of the world's species could be wiped out.
Unlike preceding extinction activities resulting from herbal phenomena, the 6th mass extinction is pushed through human activity, primarily (aleven though now no longer restrained to) the unsustainable use of land, water and electricity use, and weather change.
Read more about the species;
https://brainly.com/question/13690300
#SPJ4
What are autosomes?
Chromosomes that are related to the sex or gender of an individual.
Chromosomes that are NOT related to the gender of an individual.
Chromosomes that automatically replicate on their own.
The third stage of the cell cycle.
Will give brainliest
1)An autosomes is any of the numbered chromosomes, as it is opposed to sex chromosomes humans have 22 pairs of autosomes and has one pair of sex chromosomes that is X and Y chromosomes
2)The X and Y chromosomes are also known as sex chromosomes it determines the biological of the sex of an individual females inherit an X chromosome from the father for a XX genotype while the males inherit the Y chromosome from the father for a XY genotype
Note : mother's only can pass on X chromosome
3) During the DNA synthesis phase the cell replicates chromosomes during its mitosis phase the duplicated chromosomes are segregated (that sets apart from the rest of from everyone that gets divided is called segregated)and migrating to opposite of the cell .
4)*The first stage of the cell cycle is interphase
*The second stage of the cell cycle is division of the nucleus
*The third stage of the cell cycle is cytokinesis
Cytokinesis means th division of cytoplasm of a cell at the end of mitosis bringing about the seperation into the two daughter cells is called cytokinesis.
The diagram below shows parts of a plant cell.
Which organelle stores the information that determines an individual plant's leaf shape?
Organelle Function
Cell Membrane A double layer that supports and protects the cell. Allows materials in and out.
Lysosome Contains digestive enzymes that destroy damaged organelles and invaders.
Cytoplasm Jelly-like fluid that surrounds and protects the organelles.
Nucleus The control center of the cell. Contains the DNA
Nuclear Membrane Surrounds the nucleus.
Nucleolus A round structure in the nucleus that makes ribosomes.
Vacuole Stores food and water.
Golgi Body Processes and packages materials for the cell.
Mitochondria The “Powerhouse”. Breaks down food to produce energy in the form of ATP.
Rough E.R. Builds and transports substances through the cell. Has ribosomes on it.
Smooth E.R. Builds and transports substances through the cell. Does not have ribosomes.
Ribosome Helps make protein for the cell.
Cell Wall Gives shape and protection to plant cells.
Chloroplast Changes sunlight into sugar for plant cells. Contains a green pigment called chlorophyll.
organelle 1 is large vacuole, 2nd organelle is mitochondria, organelle 3 is nucleus and organelle 4 is cell wall.
What are the function of plant cell organelle ?Cell Membrane is a double layer made up of lipid and protein, small amount of carbohydrate which supports and protects the cell allow the substances enter and exit the cell.
Lysosome have some digestive enzymes which destroy damaged organelles and invaders, cytoplasm of the cell which is a jelly-like fluid that surrounds and protects all the cell organelles.
Nucleus is present at the Centre of the cell carry the genetic material in the DNA, Nuclear Membrane is the outer covering which Surrounds the nucleus, Nucleolus which is a round structure makes ribosomes, Vacuole Stores food and water.
Golgi Body of the cell can Process and packages materials for the cell whereas Mitochondria is the “Powerhouse” of the cell that involve in Breaks down food to produce energy in the form of ATP.
Rough E.R. makes and transports substances through the cell and Smooth E.R. does not have ribosomes; Ribosome make protein for the cell.
For more details regarding cell wall, visit
https://brainly.com/question/10945910
#SPJ2
What reproductive cells produce new fungi?A. sporesB. seedsC. hyphaeD. buds
Fungi reproduces through a reproductive cell that's able to produce another individual without fusing with another cell. This cell can be spreaded to spread the individuals too. The name of this cell is spore, therefore the correct answer is A. spores.
If a secondary consumer is an omnivore what would it eat?
A. Tertiary Consumers
B. Producers and Primary Consumers
C. Only the Producers
D. Tertiary and Secondary Consumers
Answer:
probably b because a producer is a plant and the secondary producer is eaten by the tertiary consumer so it's not a nor a
Explanation:
yourmom.com
describe two ways experimental design can be used in medicine and healthcare
Answer:
Experimental or interventional studies compare the effect of treatments or interventions with control in humans. Placebo or different treatment(s) or intervention(s) may be used as control. Experimental studies have to be transparent and evidence-based. Two examples include clinical studies as well as observational drug studies.
Which of the following affects the carrying capacity of an ecosystem?
A.
availability of water
B.
number of predators
C.
availability of food
D.
all of these
Answer:
I think your answer would be D. All of These.
Explanation:
All of them are needed.
PLEASE ANSWER QUICK!!
1. Gila monsters are lethargic creatures that feed primarily on eggs raided from
nests and newborn mammals. Food in the desert Biome can be difficult to attain.
Their oversized tails allow them to go months between meals. What biomolecule
and its function does their tail represent?
2. Name and describe the difference between cohesion and adhesion. Give an example of each property.
3. Name examples of enzymes. What is their function and why are they important?
4. Gila monsters are lethargic creatures that feed primarily on eggs raided from nests and newborn mammals. Good in the desert Biome can be difficult to attain. Their oversized tails allow them to go months between meals. What biomolecule and its function does their tail represent?
Answer:
the last one is they use is for protiens
Explanation:
!
1. The tail of the Gila monsters stores fat in their tails, which serves the same function as the lipids which are used to store energy in the form of tri-glyceraldehydes.
2. Adhesion is the attractive force, while cohesion is the intermolecular force between 2 molecules.
3. There are many enzymes that catalyze a reaction, e.g., lipases help in breakdown of fats, and sugars like sucrose and lactose are broken down by sucrase and lactase.
1.Gila monsters are desert lizards, with short legs and tails. They are able to survive for longer periods by storing fat in their tails. Fat is generally stored in the form of tri-glyceraldehydes in adipocytes.
The body uses triglycerides not only stores fat but also helps in the transportation of energy. It is essential to comprehend that triglycerides play a vital role as they serve as a dependable source whenever the body is in need of them.
When we consume an excess of food, our body stores fatty acids in fat cells, leading to the buildup of body fat. Conversely, if we fast or abstain from food for a certain period, triglycerides are released from the fat cells into our bloodstream, providing the necessary fuel for our body to continue functioning.
Therefore, our body primarily uses triglycerides as the major biomolecule to store fats.
2. Cohesion and adhesion are both a type of attractive force, except for the reason that cohesion acts between the same molecules, and adhesion acts between different molecules. There can be a notable difference between the two, which is described below -
1. Cohesion is an intermolecular force, while adhesion is an intramolecular force.
2. Cohesion requires hydrogen bonding and Van Der Waal forces, and adhesion requires electrostatic attraction between the two molecules.
3. A notable example of cohesion is when the water droplets forms due to cohesion on the surface tension of the liquid. While spreading of the liquid on a solid surface is a good example of adhesion.
Both cohesion and adhesion are attractive forces but require a different form of chemical interaction between either the same molecule or different molecules to occur.
3. Enzymes work by binding with the substrate, which results in the formation of an enzyme-substrate complex.
There is a swarm of enzymes used in a biological system, but some common enzymes used in the digestive system include lactase, sucrase, and lipases.
Sucrase catalyzes the hydrolysis of sucrose molecules because it is a digestive enzyme. This reaction results in the formation of fructose and glucose.
Lipases, on the other hand, help in the hydrolysis of phospholipids and triglycerides and result in the component fatty acid along with a glycerol molecule.
Enzymes can have various functions and are important for the proper functioning of biological systems. Some commonly used enzymes are sucrase and lipases.
Learn more about Triglycerides here:
https://brainly.com/question/13840067
#SPJ7
Cellular respiration and photosynthesis are similar in that both produce
Answer:
oxygen
Explanation:
Answer:
The two processes are similar in that they both produce energy, but in two different forms.
Explanation:
They both provide each other with the necessary ingredients for the process to take place: glucose and oxygen for cellular respiration, carbon dioxide and water for photosynthesis.
Hope this helped!!!
An atp molecule is made up of witch of the following
Answer:
ATP means adenosine triphosphate. It consists of carbon, hydrogen, nitrogen, oxygen, and phorphorus, with the formula C10H16N5O13P3. Structurally it is a nucleoside made up of adenine (a nucleobase) and a ribose sugar molecule, with three phosphate groups. It transfers a phosphate group to another molecule to phosphorylate it (give it energy to get the bonds into a transition state)
Explanation: