6. How many sixths are in 3 2/3

5. How many tenths are in 2 3/5?

Answers

Answer 1

Answer:

1. 12

2. 36

Step-by-step explanation:

3 * 2 / 3

multiply & divide by 2

= 3 * 2 * 2 / ( 3 * 2)

= 12 / 6

12 (twelve) sixths

Study

Answer:

36 tenths

Explanation:

Well the first part to working this out is understanding that there are 10 tenths in a whole. So 3 wholes is 30 tenths.

The second part is 3 over 5 or 3/5. To write this in tenths you have to effectively double it (if you double the denominator you must double the numerator) What ever you do to the top you must do to the bottom and vice versa. So that 3 over five becomes six over ten. Add them together now you can add these fractions because they are over the same denominator (their bottom number is the same)

30 tenths plus 6 tenths equals 36 tenths.


Related Questions

300/200 as a terminating decimal.

Answers

Answer:

1 100/200

Step-by-step explanation:

Answer:

1.5

Step-by-step explanation:

Let S be the subspace of P3 consisting of all polynomials p(x) such that p(0) = 0 and let T be the subspace of all polynomials q(x) such that q(1) = 0. (a) Find a basis for S. (b) Find a basis for T. (c) Find a basis for SAT.

Answers

Let S be the subspace of P3 consisting of all polynomials p(x) such that p(0) = 0 and let T be the subspace of all polynomials q(x) such that q(1) = 0.

a) The two vectors are linearly independent and span S which means {x, \(x^{2}\)} forms a basis for S.

b) The two vectors are linearly independent and span T which means \({(x -1),(x - 1)^2}\)forms a basis for T.

c) The vector is linearly independent and spans S∩T which means {x(x−1)} forms a basis for S ∩ T.

We have the information from the question:

Let S be the subspace of \(P_3\) consisting of all polynomials p(x).

We have:

p(0) = 0 and let T be the subspace of all polynomials q(x) such that q(1) = 0.

a) S is all polynomials of the form p(x) = \(ax^2 + bx\) where a, b are

real numbers.

p(0) = \(a(0)^2 + b(0)\) = 0 for all a, b.

I propose that {x, \(x^{2}\)} forms a basis for S.

We must show that:

The vectors x and \(x^{2}\) are linearly independent and span S.

To show they are linearly independent we must show that:

\(\alpha _1(x^2) + \alpha _2(x) = 0(x^2) + 0(x)\)

Only has the solution :

\(\alpha _1=\alpha _2=0\)

Upon grouping the terms we find:

\(\alpha _1=0\\\\\alpha _2=0\)

Thus the two vectors are clearly linearly independent.

Now to show that the two vectors span S we must show that any element

in S which I will represent by p(x) = ax^2 + bx can be written as:

\(\alpha _1(x^2) + \alpha _2(x) = ax^2 + bx\)

where, \(\alpha _1,\alpha _2\) are scalar  vectors.

Upon grouping the terms we find that:

\(\alpha _1=a\\\\\alpha _2=b\)

With this solution we have:

\(\alpha _1(x^2) + \alpha _2(x) = ax^2 + bx\)

which means the two vectors span S.

Thus, the two vectors are linearly independent and span S which means {x, \(x^{2}\)} forms a basis for S.

b)T is all polynomials of the form :

\(q(x) = a(x - 1)(bx + c) =abx^2 + acx - abx - ca = ab(x^2) + (ac - ab)x - ac\)where a, b, c are real numbers.

This is because q(1) = a(1 − 1)(b + c) = 0 for all a, b, c.

Let s = ab and t = ac.

Now we have that T is all polynomials of the form

\(q(x) = sx^2 + (t - s)x - t\)

\({(x - 1),(x - 1)^2}\)forms a basis for S.

In order to confirm this we must show that the vectors x − 1 and \((x - 1)^2\)are linearly independent and span S.

To show they are linearly independent we must show that:

\(\alpha _1((x -1)^2) + \alpha _2(x - 1) = 0(x - 1)(0(x) + 0)\)

only has the solution α1 = α2 = 0

Upon grouping the terms we find:

\(\alpha _1=0\\\\\alpha _2=0\)

Thus the two vectors are clearly linearly independent.

Now to show that the two vectors span T we must show that any element

in T which I will represent by \(q(x) = sx^2 + (t - s)x - t\) can be written as:

\(\alpha _1((x - 1)^2) + \alpha _2(x - 1) = sx^2 + (t - s)x - t\)

Where, \(\alpha _1,\alpha _2\) are scalars.

Upon grouping the terms we find that:

\(\alpha _1=s\\\\\alpha _2=s+t\)

With this solution we have:

\(sx^2 + (t - s)x - t = sx^2 + (t - s)x - t\)

which means the two vectors span T

Thus, the two vectors are linearly independent and span T which means \({(x -1),(x - 1)^2}\)forms a basis for T.

c)  S∩T is all polynomials of the form \(c(x) = a(x-1)(bx) = abx^2-abx\)

where a, b are real numbers.

This is because \(c(0) = a(0 - 1)^2\)

(b(0)) = 0 and

c(1) =\(a(1 - 1)^2\)

(b(1)) = 0 for all a, b.

Let ab = t

This means S∩T is all polynomials of the form \(c(x) = tx^2-tx = tx(x-1).\)

I propose that {x(x − 1)} forms a basis for S ∩ T.

Now, we must show that the vector x(x − 1) is linearly independent and spans S ∩ T.

To show it is linearly independent we must show that:

\(\alpha _1\)(x(x − 1)) = 0(x(x − 1))

only has the solution \(\alpha _1\) = 0.

Upon grouping the terms we find:

\(\alpha _1\) = 0

Thus the two vectors are clearly linearly independent.

Now to show that the vector spans S ∩ T we must show that any element

in S ∩ T which I will represent by c(x) = tx(x − 1) can be written as:

\(\alpha _1\)(x(x − 1)) = tx(x − 1).

where \(\alpha _1\) is a scalar.

Upon grouping the terms we find that:

\(\alpha _1\) = t

With this solution we have:

tx(x − 1) = tx(x − 1)

which means the vector spans S ∩ T.

Thus, the vector is linearly independent and spans S∩T which means {x(x−1)} forms a basis for S ∩ T.

Learn more about Polynomial at:

https://brainly.com/question/11536910

#SPJ4

A scientist uses a submarine to study ocean life.
She begins at sea level, which is an elevation of 0 feet.
She travels down 37.4 feet.
She then ascends 19.8 feet.
Next, she descends a second time, 8.4 feet.

How many feet must she now rise to get back to sea level?

Answers

Answer:

To get back to sea level, the scientist must now rise a total of 19.2 feet. This is calculated by subtracting the total amount of feet she has descended (37.4 + 8.4 = 45.8 feet) from the total amount of feet she has traveled (37.4 + 19.8 + 8.4 = 65.6 feet). Therefore, 19.2 feet (65.6 - 45.8) must be ascended in order to reach sea level.

One year, the population of a city was 358,000. Several years later it was 286,400. Find the percent decrease.

Answers

A percentage is a way to describe a part of a whole. The percentage decrease is 20%.

What are Percentages?

A percentage is a way to describe a part of a whole. such as the fraction ¼ can be described as 0.25 which is equal to 25%.

To convert a fraction to a percentage, convert the fraction to decimal form and then multiply by 100 with the '%' symbol.

One year, the population of a city was 358,000. Several years later it was 286,400. Therefore, the percentage decrease is,

Percentage decrease = (358,000-286,400)/(358,000) × 100% = 20%

Hence, the percentage decrease is 20%.

Learn more about Percentages:

https://brainly.com/question/6972121

#SPJ1

Often, conditional probabilities are worded with what​ phrase?

​"dependent"

​"given that"

​"either/or"

​"mutually exclusive"

Answers

The correct phrase commonly used to word conditional probabilities is "given that." This phrase explicitly indicates the condition or event on which the probability calculation is based and emphasizes the dependence between events in the probability calculation.

Let's discuss each option in detail to understand why the correct phrase is "given that" when wording conditional probabilities.

"Dependent": The term "dependent" refers to the relationship between events, indicating that the occurrence of one event affects the probability of another event. While dependence is a characteristic of conditional probabilities, it is not the specific wording used to express the conditionality.

"Given that": This phrase explicitly states that the probability is being calculated based on a specific condition or event being true. It is commonly used to introduce the condition in conditional probabilities. For example, "What is the probability of event A given that event B has already occurred?" The phrase "given that" emphasizes that the probability of event A is being evaluated with the assumption that event B has already happened.

"Either/or": The phrase "either/or" generally refers to situations where only one of the two events can occur, but it does not convey the conditional nature of probabilities. It is often used to express mutually exclusive events, where the occurrence of one event excludes the possibility of the other. However, it does not provide the specific condition on which the probability calculation is based.

"Mutually exclusive": "Mutually exclusive" refers to events that cannot occur simultaneously. While mutually exclusive events are important in probability theory, they do not capture the conditionality aspect of conditional probabilities. The term implies that if one event happens, the other cannot occur, but it does not explicitly indicate the specific condition on which the probability calculation is based.

In summary, the correct phrase commonly used to word conditional probabilities is "given that." It effectively introduces the condition or event on which the probability calculation is based and highlights the dependency between events in the probability calculation.

To learn more about conditional probabilities visit : https://brainly.com/question/23382435

#SPJ11

HELP!!!!!
Calculate the amount of money​ you'll have at the end of the indicated time period.
You invest ​$3000 in an account that pays simple interest of 7% for 30 years.

Answers

The answer is $9,300

what is the answer pls help 5' 2" − 2' 3" =

Answers

Answer:

2' 11'

Step-by-step explanation:

Answer:

1.83333333333

Step-by-step explanation:

i dunno if these were supposed to be fractions

which of the following best defines an output

which of the following best defines an output

Answers

The answer is B it best explains the definition of output

Which of the following graphs is a function?
a.
c.
COF
d.
b.
A
Next
Submit
Save and Exit
Mark this and return

Which of the following graphs is a function?a.c.COFd.b.ANextSubmitSave and ExitMark this and return

Answers

Answer:

The answer is D I believe

11y + 3(2y - 4) slove

11y + 3(2y - 4) slove

Answers

Answer:

Step-by-step explanation:

17y-12

11y+3(2y-4)

11y+6y-12

17y-12

I hope this helps!

Find the distance between the two points rounding to the nearest tenth (if necessary).
(-6, 7) and (-3,0)
Help needed asap!;)

Find the distance between the two points rounding to the nearest tenth (if necessary).(-6, 7) and (-3,0)Help

Answers

Answer:

7.6 for delta math trust me

Step-by-step explanation:

real numbers $x$ and $y$ have an arithmetic mean of 7 and a geometric mean of $\sqrt{19}$. find $x^2+y^2$.

Answers

Real number \($x^2+y^2= \boxed{158}$\)

Let's start by using the formulas for arithmetic mean and geometric mean:

Arithmetic mean:

\($\frac{x+y}{2}=7 \Rightarrow x+y=14$\)

Geometric mean:

\($\sqrt{xy}=\sqrt{19} \Rightarrow xy=19$\)

Now, we can square the equation for the arithmetic mean:

\($(x+y)^2=14^2 \Rightarrow x^2+2xy+y^2=196$\)

Substituting\($xy=19$\), we get:

\($x^2+y^2+2(19)=196$\)

Simplifying:

\($x^2+y^2= \boxed{158}$\)

For similar questions on Real Number

https://brainly.com/question/17201233

#SPJ11

Help me please I don’t really understand how to do these types of problems

Help me please I dont really understand how to do these types of problems

Answers

to get the slope of any straight line, we simply need two points off of it, let's use those in the picture above.

\((\stackrel{x_1}{-5}~,~\stackrel{y_1}{-4})\qquad (\stackrel{x_2}{1}~,~\stackrel{y_2}{-3}) \\\\\\ \stackrel{slope}{m}\implies \cfrac{\stackrel{rise} {\stackrel{y_2}{-3}-\stackrel{y1}{(-4)}}}{\underset{run} {\underset{x_2}{1}-\underset{x_1}{(-5)}}} \implies \cfrac{-3 +4}{1 +5} \implies {\Large \begin{array}{llll} \cfrac{ 1 }{ 6 } \end{array}}\)

7TH GRADE MATH NEED ASAP

7TH GRADE MATH NEED ASAP

Answers

Answer: 94 even though  already said it but yet you deleted my answer witch was rooooooood

Step-by-step explanation:

on the basis of the survey data, would you recommend that the housing offfice consider increasing the amount of housing on cmapus avaiable to graduate students?

Answers

Yes, I would recommend that the housing office consider increasing the amount of housing available to graduate students due to the survey average data showing a high demand for campus housing.

The survey data indicates that there is a significant demand for housing on campus amongst graduate students. Over half of the respondents stated that they would like to live on campus if it was available and affordable. This suggests that there is a need for more on-campus housing for graduate students. Furthermore, a large portion of the respondents mentioned that they would be willing to pay more for on-campus housing that is of better quality. This indicates that not only is there a need for more housing, but that there is also room to improve the quality of the existing housing. Therefore, it is recommended that the housing office consider increasing the amount of housing on campus available to graduate students. This could be done by adding more housing units, increasing the quality of the existing housing, or both. Doing so would likely provide more options for graduate students to live on campus, thus reducing the demand for off-campus housing.

Learn more about average here

https://brainly.com/question/24057012

#SPJ4

An elevator has a placard stating that the maximum capacity is 1884 lb-12 passengers. So, 12 adult male passengers can have a mean weight of up to 1884/12=157 pounds. If the elevator is loaded with 12 adult male passengers, find the probability that it is overloaded because they have a mean weight greater than 157 lb. (Assume that weights of males are normally distributed with a mean of 165 lb and a standard deviation of 32 lb.) Does this elevator appear to be safe? BICICIE The probability the elevator is overloaded is (Round to four decimal places as needed) Does this elevator appear to be safe? OA. No, there is a good chance that 12 randomly selected adult male passengers will exceed the elevator capacity OB. No, 12 randomly selected people will never be under the weight limit. OC. Yes, there is a good chance that 12 randomly selected people will not exceed the elevator capacity OD. Yes, 12 randomly selected adult male passengers will always be under the weight limit. A bank's loan officer rates applicants for credit. The ratings are normally distributed with a mean of 200 and a standard deviation of 50. If an applicant is randomly selected, find the probability of a rating that is between 200 and 275. Round to four decimal places. www OA. 0.4332 OB. 0.9332 OC. 0.5000 OD. 0.0668 Find the value of the linear correlation coefficient r. The paired data below consist of the costs of advertising (in thousands of dollars) and the number of products sold (in thousands). Cost 9 2 3 5 9 10-> 4 2 68 67 Number 52 55 85 A. 0.235 OB. 0.708 OC. 0.246 OD. -0.071 86 83 73

Answers

The answer is option A. No, there is a good chance that 12 randomly selected adult male passengers will exceed the elevator capacity.

Probability that it is overloaded if 12 adult male passengers have a mean weight greater than 157 lb is 0.0229.Round to four decimal places as needed.Based on the calculations the elevator does not appear to be safe.The solution for the given problem is as follows:

Given that, the maximum capacity of the elevator is 1884 lb - 12 passengers.

We can write as below:

Maximum capacity per person=1884/12=157lb.

And, weights of males are normally distributed with a mean of 165 lb and a standard deviation of 32 lb.Thus, Z = (157-165) / (32 / √12) = -1.7321Then, P(Z > -1.7321) = 0.9586

Hence, the probability that it is overloaded if 12 adult male passengers have a mean weight greater than 157 lb is:P(Z > -1.7321) = 1 - P(Z < -1.7321) = 1 - 0.0229 = 0.9771 (rounded off to 4 decimal places).This probability is greater than 5% and therefore, the elevator does not appear to be safe.

To know more about randomly:

https://brainly.com/question/13319968

#SPJ11

Please help!!! Due today!! Picture of question + example. Please show work!!!

Please help!!! Due today!! Picture of question + example. Please show work!!!

Answers

15a^3+6a^2+25a+10
hope this helps!!!

Which of the following are assumptions underlying the simple linear regression model y = Bo B1x e? Check all that apply The variance of the error term e varies for differing values of x. The error term is a random variable with an expected value of zero. The error term is normally distributed. The error term E follows a chi-square distribution.

Answers

The error term is a random variable with an expected value of zero.2. The error term is normally distributed

The assumptions underlying the simple linear regression model `y = Bo + B1x + e` are: 1.

The variance of the error term e is constant across all values of x.Thus, the assumptions that are underlying the simple linear regression model `y = Bo + B1x + e` are the second and the third options, which are "The error term is normally distributed." and "The variance of the error term e is constant across all values of x." respectively.

Learn more about random variable

https://brainly.com/question/30789758

#SPJ11

g a 160-lb man carries a 20-lb can of paint up a helical staircase that encircles a silo with radius 20 ft. if the silo is 40 ft high and the man makes exactly two complete revolutions, how much work is done by the man against gravity in climbing to the top?

Answers

The man does 14,400 ft-lbs of work against gravity while climbing to the top of the helical staircase. A 160-lb man carrying a 20-lb can of paint climbs a helical staircase around a silo with a radius of 20 ft. The silo is 40 ft high, and the man makes two complete revolutions.

To calculate the work done by the man against gravity, we first need to determine the total vertical distance he climbs.

The height gained in one revolution can be found using the Pythagorean theorem. The man moves along the circumference of the circle with radius 20 ft, so the horizontal distance in one revolution is 2 * π * 20 = 40π ft. Thus, the helical path forms a right-angled triangle, with the height gained as one side, 40π ft as the other side, and the helical path's length as the hypotenuse. If the man makes two complete revolutions, the total horizontal distance traveled is 80π ft.

Let h be the height gained in one revolution. Then, h² + (40π)² = (80π)². Solving for h, we find that h = 40 ft. Since there are two revolutions, the total height gained is 80 ft.

The man's total weight (including the paint can) is 160 + 20 = 180 lbs. Work done against gravity is the product of force, distance, and the cosine of the angle between the force and displacement vectors. In this case, the angle is 0° since the force and displacement are in the same direction (vertically). So, the work done is:

Work = (180 lbs) * (80 ft) * cos(0°) = 180 * 80 * 1 = 14,400 ft-lbs.

Therefore, the man does 14,400 ft-lbs of work against gravity while climbing to the top of the helical staircase.

Learn more about vertical distance here: brainly.com/question/28907336

#SPJ11

Please Help
What are the domain and range of the function? f(x)=3/5x^5
Domain: (−∞, 0)∪ (0, ∞) Range: (0, ∞)
Domain: (−∞, 0)∪ (0, ∞) Range: (−∞, 0)
Domain: (−∞, ∞) Range: ​(−∞, 0)​
Domain: ​(−∞, 0)∪ (0, ∞)​ Range: (−∞, 0)∪ (0, ∞)

Answers

Answer:

Domain: ​(−∞, 0) ∪ (0, ∞)​; Range: (−∞, 0) ∪ (0, ∞)

Step-by-step explanation:

See attachment.

We want to find the domain and range of the function \(f(x)=\frac{3}{5} x^5\).

The domain is the set of all possible x-values that are included in the function, while the range is the set of all possible y-values that are included in the function.

Look at the graph.

We can see that the x-values can go into infinity except when approaching the line x = 0. Here, the function will never touch x = 0 because that would make the graph undefined. So, we can say that the domain is all real numbers except for x = 0, or ​(−∞, 0) ∪ (0, ∞).

It's the same thing with the y-values. Although it looks like the line is touching the y-axis, or the line y = 0, the graph actually is not - it's just going really close to it. So, the range is again ​(−∞, 0) ∪ (0, ∞).

Thus, the answer is D.

 Please Help What are the domain and range of the function? f(x)=3/5x^5 Domain: (,0)(0,) Range: (0,)

Answer:

Last one

Domain: ​(−∞, 0)∪ (0, ∞)​ Range: (−∞, 0)∪ (0, ∞)

Step-by-step explanation:

f(x) = 3/(5x⁵)

Since x is in the denominator, x can not be 0

Domain: all real values of x except 0

For y = 0, x has to be infinite therefore y can not be 0

Range: all real values except 0

PQ= RQ and PS= RS a=?

PQ= RQ and PS= RS a=?

Answers

The measure of angle a is 15 degrees and this can be determined by using the properties of the isosceles triangle.

What are interior angles?

In geometry, interior angles are formed in two ways. One is inside a polygon, and the other is when parallel lines cut by a transversal. Angles are categorized into different types based on their measurements.

Given:

The length of the segment PQ is equal to the length of the segment RQ.The length of the segment PS is equal to the length of the segment RS.

The following steps can be used in order to determine the measure of angle a:

Step 1 - According to the given data, it can be concluded that triangle PQR and triangle PSR are isosceles triangles.

Step 2 - Apply the sum of interior angle property on triangle PQR.

\(\angle\text{Q}+\angle\text{P}+\angle\text{R}=180\)

\(\angle\text{Q}+2\angle\text{R}=180\)

\(2\angle\text{R}=180-60\)

\(\angle\text{R}=60^\circ\)

Step 3 - Now, apply the sum of interior angle property on triangle PSR.

\(\angle\text{P}+\angle\text{S}+\angle\text{R}=180\)

\(\angle\text{S}+2\angle\text{R}=180\)

\(2\angle\text{R}=180-90\)

\(\angle\text{R}=45^\circ\)

Step 4 - Now, the measure of angle a is calculated as:

\(\angle\text{a}=60-45\)

\(\angle\text{a}=15\)

The measure of angle a is 15 degrees.

For more information on interior angles, refer to the link given below:

https://brainly.com/question/28795639

Which of the following choices is the standard deviation of the sample shown
here?
18, 19, 20, 21, 22
A. 2
B. 12.5
C. 20
D. 2.5
E. square root of 2

Answers

Answer:  E. square root of 2

We can write that in shorthand as sqrt(2)

sqrt(2) = 1.41421 approximately

======================================================

Explanation:

Step 1)

Add up the values to get 18+19+20+21+22 = 100

Divide by n = 5, since there are 5 items in the list. So 100/n = 100/5 = 20

The sample mean is xbar = 20

--------------

Step 2)

Subtract the mean from each data value

18 - xbar = 18 - 20 = -219 - xbar = 19 - 20 = -120 - xbar = 20 - 20 = 021 - xbar = 21 - 20 = 122 - xbar = 22 - 20 = 2

The results we get are: -2, -1, 0, 1, 2

---------------

Step 3)

Square the results from the previous step

(-2)^2 = 4(-1)^2 = 1(0)^2 = 0(1)^2 = 1(2)^2 = 4

The results here are: 4, 1, 0, 1, 4

---------------

Step 4)

Add up those squares from the previous step: 4+1+0+1+4 = 10

Now divide by n = 5 to get 10/n = 10/5 = 2

The result 2 represents the population variance. Applying the square root to the population variance leads to the population standard deviation. So we end up with the final answer of sqrt(2). The answer is choice E.

sqrt(2) = 1.41421 approximately

---------------

Note: if you want the sample standard deviation, then you divide by n-1 = 5-1 = 4, but the other steps are the same as before.

Chord AC intersects chord BD at point P in circle Z.
AP=12 m
DP=5 m
PC=6 m

What is BP?
Enter your answer as a decimal in the box.

_______ m

Answers

The length of BP is 14.4 meters.

To find the length of BP, we can use the property that states that when two chords intersect inside a circle, the product of the segment lengths on one chord is equal to the product of the segment lengths on the other chord.

Using this property, we can set up the equation:

AP * PC = BP * DP

Substituting the given values:

12 m * 6 m = BP * 5 m

Simplifying:

72 m^2 = BP * 5 m

To solve for BP, divide both sides of the equation by 5 m:

72 m^2 / 5 m = BP

Simplifying:

14.4 m = BP

Therefore, the length of BP is 14.4 meters.

To know more about length,

https://brainly.com/question/32191269

#SPJ11

which function is equivalent to h(x)=10x^(2+9x-1)

Answers

Answer:

h(x) = (10x - 1)(x + 1)

Step-by-step explanation:

Given

h(x) = 10x²+9x-1

Required

Get its equivalent

To do this, we simply factorize h(x)

We have that:

h(x) = 10x²+9x-1

Expand

h(x) = 10x² + 10x - x - 1

Factorize

h(x) = 10x(x + 1) -1(x + 1)

This gives:

h(x) = (10x - 1)(x + 1)

Hence, the equivalent of h(x) = 10x²+9x-1 is h(x) = (10x - 1)(x + 1)

Answer: h(x) = (x+1) (10x-1)

Step-by-step explanation: I got it correct

50 points !!!!!!!! please hep !!!!

50 points !!!!!!!! please hep !!!!

Answers

Solve for θ :

r = 1/32 v₀² sin(2θ)

32r / v₀² = sin(2θ)

arcsin(32r / v₀²) = 2θ

⇒   θ = 1/2 arcsin(32r / v₀²)

Note that in projectile motion, we're only concerned with launch angles in the range 0 ≤ θ ≤ π/2, so there are no issues with taking inverse sines.

Triangle OPQ is similar to triangle RST. Find the measure of side ST. Round your answer to the nearest tenth if necessary

Answers

Given that triangles OPQ and RST are similar triangles, the measure of side ST is: 75.3.

What are Similar Triangles?

The ratio of the corresponding sides of two similar triangles are always equal, meaning the sides are proportional to each other.

Given:

OP = 17ST = 31PQ = 7

Since Triangle OPQ is similar to triangle RST, therefore:

RS/OP = ST/PQ

Substitute

RS/17 = 31/7

Cross multiply

RS = (31 × 17)/7

RS = 75.3

Learn more about similar triangles on:

https://brainly.com/question/11920446

Triangle OPQ is similar to triangle RST. Find the measure of side ST. Round your answer to the nearest

What is the length of the hypotenuse in the right
triangle?
Square root 12,593 cm
60 cm
Square root 14,225 cm
65 cm

What is the length of the hypotenuse in the righttriangle?Square root 12,593 cm60 cmSquare root 14,225

Answers

Answer:

About 50.92

Step-by-step explanation:

For which of these variables would you be interested in finding the biserial correlation coefficient rather than the point-biserial correlation coefficient?

Answers

Answer:

The formula for the point biserial correlation coefficient is:

point biserial correlation formula

M1 = mean (for the entire test) of the group that received the positive binary variable (i.e. the “1”).

M0 = mean (for the entire test) of the group that received the negative binary variable (i.e. the “0”).

Sn = standard deviation for the entire test.

p = Proportion of cases in the “0” group.

q = Proportion of cases in the “1” group.

Most people won’t work this formula by hand as most statistical software packages can calculate the coefficient for you.

Please find the volume worth 50 points.

Please find the volume worth 50 points.

Answers

The volume of the half-sphere is V = 5744.1 cubic units.

How to find the volume?

The volume of a sphere of radius R is:

V = (4/3)*pi*R³

Where pi = 3.14

Here we have half a sphere, so the volume will be 1/2 of the above expression, and the radius is, so R = 14 units, then the volume of the half-sphere will be:

V = (1/2)*(4/3)*3.14*(14)³ = 5744.1 cubic units.

Learn more about volumes:

https://brainly.com/question/1972490

#SPJ1

Find the theoretical probability of rolling a number cube labeled 1-12 and
it landing on 7.

Answers

Answer:

1/12

Step-by-step explanation:

There are 12 sides, and 7 is one of them. Therefore, there is a 1/12 chance of it landing on that side if it is a fair cube.

Other Questions
Witch statement is true about dependent clauses Which of the following correctly describes the cell cycle?A: Event in the normal life cycle of a cell B:Events in the normal life cycle of a human C:Event that change DNA What is the radius of a circle with equation x y 81? I really need help with my question! A company issues $100,000 of 6%, 5-year bonds dated January 1 that pay interest semiannually. The bonds are issued when the market rate is 8%. The present value tables indicate the present value factor of an annuity for 3% at 10 periods is 8.5302; and for 4% at 10 periods is 8.1109. To find the present value of the interest payments, multiply _______ by the present value factor _________. what is the pressure when a force of 10N is applied to 2m? Suppose a researcher wishes to edit a gene of interest containing the target DNA sequence 5'_GCGTAACTAGTCCTAACGAG-3' . Design the customized portion of an sgRNA for this target DNA sequence: 5' CUCGUUAGGACUAGUUAGCG In DEF, m F=43, d=16 mm , and f=24mm. Find m D . We know that Dickinson chose the word "sense" to mean "sanity."True or FalseMuch Madness is divinest SenseTo a discerning EyeMuch Sensethe starkest MadnessTis the MajorityIn this, as All, prevailAssentand you are saneDemuryoure straightway dangerousAnd handled with a Chain HEY CAN ANYONE PLS ANSWER DIS MATH QUESTION!! Values Group of answer choices can be moral or nonmoral in nature are based on others' conceptions about the importance of things are unrelated to knowledge, motor skills, or fitness are objective beliefs that are defined by each professional organization to guide our personal and professional decisions Flag question: Question 44 you flip a coin for which the probability of heads is 0.50.5 and the probability of tails is 0.5.0.5. if the coin comes up heads, you win $1. otherwise, you lose $1. determine the expected value of your winnings. (use decimal notation. give your answer as an exact number.) expected value: T/F tickets for the coliseum were written on papyrus (a type of paper), and each contained a number from 1 to 78, which corresponded to one of the 78 archways through which to enter the facility. pls help i'll mark as brainliest pls help what do abyssal hills, seamounts, guyots and atolls have in common? A farmer knows that a grocery store will reject a shipment of his vegetables if more than 4% of the vegetables contain blemishes. He inspects a large truckload of tomatoes to determine if the proportion with blemishes (p) exceeds 0.04. He selects an SRS of 150 tomatoes from the more than 2,000 tomatoes in the truck. Suppose that 8 tomatoes sampled are found to have blemishes. Which of the assumptions for inference about a proportion is violated, if any?a. Large Counts: np > 10b. Large Counts: n(1 p) > 10c. The sample is a random sample of the entire population.d. 10% condition: the sample size is less than 10% of the population.e. There do not appear to be any violations. Is Brutus a round character?. Determine the domain :y=|x+5|+1 a bomb calorimeter has a heat capacity of 2.47 kj/k. when a 0.111-g sample of ethylene (c2h4) was burned in this calorimeter, the temperature increased by 2.26 k. calculate the energy of combustion for one mole of ethylene. fw(c2h4) The table shows the parts of powder and water used to make gelatin.Boxes of Gelatin Powder (oz) Water (cups)3 9 68 At this rate, how much powder and water will Jeff use to make 8 boxes of gelatin? Jeff will use 24 oz of powder and 16 cups of water. Jeff will use 16 oz of powder and 21 cups of water. Jeff will use 14 oz of powder and 11 cups of water. Jeff will use 16 oz of powder and 24 cups of water.