4. What type of tissue surrounds the entire muscle?
5. What neurotransmitter is associated with the muscles:
7. The gap between the neuron and the muscle is called the:
8. During a muscle contraction, cross-bridges form between what two structures
9. The energy source for muscle contraction is
10. Vesicles in the motor neuron store what substance?
11. Myofibrils are composed of
12. The substance that crosses the gap between a neuron and a mus-

Answers

Answer 1

4.The type of tissue that surrounds the entire muscle is called the fascia.

5.The neurotransmitter associated with muscles is acetylcholine.

6.The gap between the neuron and the muscle is called the synaptic cleft.

7.During a muscle contraction, cross-bridges form between the actin filaments and the myosin heads.

8.The energy source for muscle contraction is adenosine triphosphate (ATP).

9.Vesicles in the motor neuron store the neurotransmitter acetylcholine.

10.Myofibrils are composed of two types of filaments: thin filaments made of actin and thick filaments made of myosin.

11.The substance that crosses the gap between a neuron and a muscle fiber (or cell) is a neurotransmitter, specifically acetylcholine at the neuromuscular junction.

learn more about tissue surrounding here:

https://brainly.com/question/31118167


Related Questions

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Answers

The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.

In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.

In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.

The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.

It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.

For more such answers on RNA

https://brainly.com/question/13939644

#SPJ8

where would you find hemoglobin that is about 65% saturated with o2 in a healthy resting person?

Answers

The hemoglobin that is about 65% saturated with o2 in a healthy resting person Systemic veins & pulmonary arteries.

Define Hemoglobin?

Hemoglobin is a protein in red blood cells that takes oxygen to body's organs and tissues and elates carbon dioxide from organs and tissues back to your lungs.

Thus, Systemic veins & pulmonary arteries are correct.

To learn more about hemoglobin click here:

https://brainly.com/question/15011428

#SPJ4

Which form of early photosynthetic life consumed much of the CO₂ in Earth's atmosphere, allowing life to become possible?
A Cyanobacteria
B. Spirochetes
C. Protists
D. Red-Yellow algae

Answers

I think it A because Cyanobacteria absorb co2 from the atmosphere and then release oxygen To the atmosphere

3: What organisms are the producers in
this ecosystem? (Multiple answers possible)
A. Leafy Flier
B. Some microorganism species
C. Squid-like Organism
D. Sea-slug-like Organism

Answers

Some microorganism species are the producer in the ecosystem. The correct option is (B).

Understanding Producer

Producers in an ecosystem are typically photosynthetic organisms that convert energy from the sun into organic matter that can be used by other organisms in the ecosystem. This can include plants, algae, and some types of bacteria.

Leafy flier, squid-like organism, and sea-slug-like organism are not typically photosynthetic organisms, as they do not have chloroplasts or other structures necessary for photosynthesis.

Learn more about producer here:

https://brainly.com/question/15913448

#SPJ1

Zappos says goodbye to bosses - The Washington Post
Reflect on the changes to organizational structure
taking place at Zappos. What concepts are illustrated in this
article? Has it been a successful i

Answers

The changes taking place at Zappos illustrates numerous concepts related to organizational structure. The Holacracy system being adopted by the company removes the traditional line of command; instead tasks are delegated by employees to “circles” which are then serviced by members of those circles.

It focuses on efficiency of operations, as decisions are made in a decentralized fashion. Furthermore, the organization encourages employees to engage in learning and development to reach their potential, which is complemented by the company’s employee-first mentality.

It is difficult to ascertain whether these changes have been successful in so far as it is too early to ascertain the long-term effects. While the initial reports from the media focus on the positive aspects such as improved communication, job autonomy and growth, it remains to be seen if the company will continue to succeed or fall flat.

know more about growth here

https://brainly.com/question/28789953#

#SPJ11

Which type of mutation results from the insertion or deletion of a nucletide into the gene?.

Answers

​Frameshift Mutation

A frameshift mutation is a type of mutation involving the insertion or deletion of a nucleotide in which the number of deleted base pairs is not divisible by three. "Divisible by three" is important because the cell reads a gene in groups of three bases.

Thanks!

the abbreviation inh indicates what route of drug administration?

Answers

The abbreviation "inh" commonly stands for "inhalation" when referring to drug administration routes.

Inhalation is a method of delivering drugs directly into the lungs for systemic or localized effects. It involves breathing in a medication in the form of aerosols, gases, or fine particles that can be absorbed by the respiratory system.

Inhalation offers several advantages as a route of drug administration. The lungs provide a large surface area for drug absorption, allowing for rapid and efficient systemic delivery. Furthermore, the rich blood supply in the lungs enables quick distribution of the drug throughout the body. Inhalation is often used for medications targeting respiratory conditions like asthma, chronic obstructive pulmonary disease (COPD), and cystic fibrosis. It allows the drug to directly reach the site of action, providing localized effects and minimizing systemic side effects.

Common devices used for inhalation include inhalers (metered-dose inhalers or dry powder inhalers), nebulizers, and vaporizers. These devices deliver the medication in a form that can be easily inhaled and absorbed by the lungs. Inhalation is a popular and effective route of drug administration for respiratory conditions, providing targeted therapy and improving patient outcomes.

To know more about inhalation click on below link :

https://brainly.com/question/32466674#

#SPJ11

All of the following are protozoans except Mushrooms Amoebas Paramecium Euglena

Answers

Answer:

because they belong in the fungi kingdom

Explanation:

Answer:

Mushrooms

Explanation:

Mushrooms belong to the fungi kingdom

A researcher uses the chemical inhibitor cyanide to reduce atp production in a neuron. What would be one effect of preventing atp production?.

Answers

Answer:

Disruption to the normal "resting" distribution of potassium and sodium ions

Explanation:

Suggest a reason for the difference in lactic acid threshold of athletes P and Q

Answers

A reason for the difference in the lactic acid threshold of athletes P and Q is that P is more physically fit and trained than Q.

The level of effort at which lactic acid, or lactate, starts to build up in the blood is known as the lactic acid threshold. The energy needed for low-intensity exercise can be entirely produced by using oxygen-dependent mechanisms (aerobic), and this can go on forever.

The lactic acid threshold is often reached by well-trained runners at 90% of their maximum heart rate and at a pace akin to that of a half-marathon. The lactate threshold typically occurs for less seasoned runners somewhere below 90% of the maximum heart rate.

One can raise the lactic acid threshold by running intervals. Interval training involves frequently exceeding your lactate threshold while jogging a predetermined distance at your highest speed, followed by a recovery pause. For instance, you might decide to sprint 400 meters around a track.

To know more about lactic acid refer to:  https://brainly.com/question/14020608

#SPJ9

Which pattern of inheritance would explain the different fur color in the related dogs?

Answers

Answer:

B/b alleles.

from a presentation

Describe the structure of a DNA molecule

Answers

Answer:

A double helix.

Explanation:

It best describes the structure of a DNA molecule. Moreover, the DNA is not a single stranded and it does not comprise amino acids.

Answer:

DNA is made up of molecules called nucleotides. ... Nucleotides are attached together to form two long strands that spiral to create a structure called a double helix. If you think of the double helix structure as a ladder, the phosphate and sugar molecules would be the sides, while the bases would be the rungs.

Explanation:

Based on the number of offspring they produce at one time, organisms are classified into two categories many offspring at once and a few at a time. Sort the characteristics based on the category they describe. low percentage of offspring reach adulthood limited parental involvement high percentage of offspring reach adulthood rapid maturation parental care observed Few Offspring at Once Many Offspring at Once​

Answers

Answer:

Few offspring at once                    

C. High percentage of offspring reach adulthood,

E. Parental care observed,

Many offspring at once

A. Low percentage of offspring reach adulthood,

B. limited parental involvement,

D.Rapid maturation,

i got this correct on my masty test i hope this helps you have a very awsom day and almost marry christmas .... happy hanukkah, feliz navidad, frohe weihnachten.

why do i use the term paranthropus instead of australopithecus for the robust species of australopithecus?

Answers

The term Paranthropus is used instead of Australopithecus for the robust species of Australopithecus because they have distinct physical characteristics that differentiate them from the other species of Australopithecus.

Robust Australopithecines have a more robust cranial structure, larger teeth, and a different jaw structure than other Australopithecines. These differences are significant enough to warrant the creation of a separate genus, Paranthropus, to describe these species.

                                      Additionally, some researchers believe that Paranthropus species diverged from the Australopithecus lineage earlier than other Australopithecus species, further justifying their classification as a separate genus. Overall, the term Paranthropus is used to differentiate the robust species of Australopithecus based on their unique physical characteristics and evolutionary history.

Learn more about Robust Australopithecines.

brainly.com/question/29651475

#SPJ11

Which coordinates best estimate the location of Woonsocket, SD?

Answers

Answer:

Woonsocket is located at 44°03′10″N 98°16′25″W.

Area code(s): 605

Country: United States

TRUE/FALSE the transport of carbon dioxide will tend to lower blood ph.

Answers

True, the transport of carbon dioxide will tend to lower blood pH. This is an essential regulatory mechanism in maintaining acid-base balance in the body.

The transport of carbon dioxide in the blood is mainly accomplished through three mechanisms: dissolved CO2, bicarbonate ions (HCO3-), and carbaminohemoglobin. Among these, the conversion of carbon dioxide to bicarbonate ions is the most significant process in terms of regulating blood pH.

When carbon dioxide enters the bloodstream, it reacts with water (H2O) to form carbonic acid (H2CO3) through the enzyme carbonic anhydrase. Carbonic acid then dissociates into hydrogen ions (H+) and bicarbonate ions (HCO3-). The released hydrogen ions contribute to the acidity of the blood, resulting in a lower pH.

The increased concentration of bicarbonate ions in the blood is accompanied by a decrease in pH, leading to a more acidic environment. This phenomenon is known as respiratory acidosis. The decrease in blood pH stimulates the respiratory centers in the brain, causing an increase in respiration rate and depth. This increased respiration helps eliminate excess carbon dioxide and restore the blood pH to a more balanced state.

In summary, the transport of carbon dioxide in the blood tends to lower blood pH. The conversion of carbon dioxide to bicarbonate ions leads to the release of hydrogen ions, contributing to increased acidity and a decrease in pH. This is an essential regulatory mechanism in maintaining acid-base balance in the body.

To know more about blood ,visit:

https://brainly.com/question/15289194

#SPJ11

What are the differences between flow of matter and energy in an ecosystem? Why?

Answers

The key difference between energy flow and matter cycling is that energy flow shows the energy transmission from one trophic level to next trophic level in food chains while matter cycling shows the flow or cycling of elements through the living and nonliving parts of ecosystems

Write the sequence of the mRNA strand that would be coded from the following strand of DNA:
TACCGAATTCGC
Please help me with this!!!

Answers

Answer:

DNA: TACCGAATTCGC

mRNA: AUGGCUUAAGCG

RNA: A=U, T=A, G=C

RNA contains Uracil and Thymine is no longer present

What is the probability of getting a white four o’clock plant if the parents are pink and white? (give phenotype %’s)

Answers

Probability of getting a white four o’clock plant if the parents are pink and white the chances is 50%.

What is the phenotype of four o'clock flower?

White (r) flowers are not completely dominant over red (R) blossoms in Four o'clock plants. A BLENDED INTERMEDIATE phenotype of PINK flowers is displayed on heterozygous plants.

The dominant phenotype, the intermediate heterozygous phenotype, and the recessive phenotype are the three types.

First evidence of incomplete dominance was found in the four o'clock plant. The allele in charge of the color red does not totally outweigh the allele in charge of the color white. The dominant and recessive phenotypes are "mix" to create the new phenotype pink.

Height, biomass, leaf shape, and other observable traits of a plant are referred to as its phenotype. When referring to the collective expression of the genotype in combination with the environment on an individual, we use the term "phenotype" in a more specific sense.

To learn more about phenotype of four o'clock flower refer to:

https://brainly.com/question/14854837

#SPJ1

PLSS HELP ME WITH THIS IMMEDIATELY!!! ILL MARK U BRAINIEST IF U DONT LEAVE A LINK OR GUESS!!

PLSS HELP ME WITH THIS IMMEDIATELY!!! ILL MARK U BRAINIEST IF U DONT LEAVE A LINK OR GUESS!!

Answers

Answer:

C

Explanation:

Due to constant erosion, it will erode and collapse from which sediments form which sink into the sea or float depending on its mass

Migration, hibernation, and dormancy are all methods of
A. producing food
B. changing the environment
C. adapting to changes in the environment
D. producing energy

Migration, hibernation, and dormancy are all methods of A. producing foodB. changing the environmentC.

Answers

The answer is C. Adapting to changes in the environment

Migration, hibernation, and dormancy are all methods of adapting to changes in the environment. The correct option is C.

What is migration?

Migration is the process of moving to a different place when the place you are living is not suitable for your living. Most animals migrate to different places when the temperature or food conditions are not good.  It is of two types, partial, or full migration.

Hibernation is a process of slowing down the physical and biological processes and going to a place and sleeping for a long time. It is a partial process. In winter, most animals undergo hibernation.

Dormancy is also like hibernation, in this process animals slow down their physical activities. It is a partial process.

Therefore, the correct option is C. adapting to changes in the environment.

To learn more about migration, refer to the link:

https://brainly.com/question/15410433

#SPJ6

Why do sharks find an injured fish - person - so easily?

Answers

Answer: a shark's sense of smell comes in handy in this situation. sharks have noses that arent used to breathe but to smell (they have a gill system for breathing) the shark can smell the blood from up to a quarter-mile away.

Explanation: sharks also pick up on minute electrical impulses using organs they have called Ampullae of Lorenzini. these organs are made of tiny hairs that are hidden in pores on the underside of their head

What term describes an organism that lacks superoxide dismutase and catalase enzymes to test your understanding of the role of these enzymes in microbial growth

Answers

Answer:

obligate anaerobe.

Explanation:

An organism that lacks superoxide dismutase and catalase enzymes would be killed in the presence of oxygen because of its inability to detoxify the superoxide radical and hydrogen peroxide. Such an organism would be an obligate anaerobe.

what is the endocrine system and how does it work ​

Answers

The endocrine system is made up of glands that make hormones. Hormones are the body's chemical messengers. They carry information and instructions from one set of cells to another.

What Does the Endocrine System Do?

Endocrine glands release hormones into the bloodstream. This lets the hormones travel to cells in other parts of the body.

The endocrine hormones help control mood, growth and development, the way our organs work, metabolism , and reproduction.

The endocrine system regulates how much of each hormone is released. This can depend on levels of hormones already in the blood, or on levels of other substances in the blood, like calcium. Many things affect hormone levels, such as stress, infection, and changes in the balance of fluid and minerals in blood.

The Opossum, which eats small snakes and berries alike, can fall under which categories within the food web feeding levels? Check all that apply.
A. Producer
B. Primary Consumer
C. Secondary Consumer
D. Tertiary Consumer

Answers

C
secondary consumer

Complete this rule for the movement of DNA fragments through an agarose gel. The larger the DNA fragment; the This diagram represents piece of DNA cut with Hindlll at each of the restriction sites pointed to by the arrows The numbers represent the number of base pairs each fragment: 23,130 2027 2322 9416 6,557 4361 How many fragments were produced by the restriction enzyme Hindill? On the gel diagram, show how you believe these (ragments will sort out during electrophoresis; The two fragments with no length indicated wIIl be too smallto be visualized on the gel. Neoative Poaahvte Label each fragment with its correct number of base pairs:

Answers

The movement of DNA fragments through an agarose gel is determined by their size. The larger the DNA fragment, the slower it moves through the gel matrix. Therefore, the migration of DNA fragments through the gel is inversely proportional to their size.


In the case of the DNA fragments cut by the Hindlll restriction enzyme, we can determine the number of fragments produced by counting the number of cuts made by the enzyme.

From the given information, we can see that Hindlll cut the DNA at five restriction sites, producing six fragments with sizes of 23,130 bp, 2027 bp, 2322 bp, 9416 bp, 6,557 bp, and 4361 bp.

During electrophoresis, the DNA fragments will sort out according to their size, with the smaller fragments migrating faster and the larger fragments migrating more slowly. The fragments will be visualized on the gel as bands, with the smallest fragments appearing at the bottom of the gel and the largest fragments at the top.

To show how the fragments will sort out during electrophoresis, we can draw a gel diagram and label each fragment with its correct number of base pairs.

We can place the smaller fragments at the bottom of the gel and the larger fragments at the top, with the smallest fragment (4361 bp) appearing at the bottom and the largest fragment (23,130 bp) appearing at the top. We can also label the negative and positive poles of the gel, indicating the direction of migration for the DNA fragments.

For more such questions on DNA fragment

https://brainly.com/question/17568989

#SPJ11

I need helpp plzzz!!

I need helpp plzzz!!

Answers

The process of photosynthesis stores energy in glucose.

The process of respiration releases energy from glucose.

The gas O₂ goes into the process of cellular respiration.

The gas CO₂ goes into the process of photosynthesis.

Listen for the following definitions and how the sisters describe their relationship with water.

Answers

Answer:

Explanation:

Iwi

Identify the chemical change below

A.a piece of wood burns in a fire
B.two pieces of paper are stapled together
C.a large log is cut into boards
D.water is removed by drying wet clothes on a laundry line

Answers

A peice of wood burns in a fire is the answer

What are the factors that influence the saltiness of water?

Answers

those factors influence the saltiness of water:

Evaporation

Precipitation

Ice formation

Ice melting

Answer:

Evaporation. Evaporation can only take away water volume, not salt content. Hot air around.

Rivers. Rivers can dilute the salt concentration of an ocean. If there are numerous rivers.

Ocean Currents. Function of Ocean currents are responsible in both increasing and.

Ice Formation. The formation of ice takes away most of the fresh water from the ocean.

Explanation:

Other Questions
Calculate the injury probability p (rounded to 2 decimals) that makes the decision maker indifferent between entering now and waiting until next year, that is for what probability are the EMV of both alternatives equal Kevin used a $50 bill to pay for 4 shirts.The cashier gave him $6.44 in change.Each shirt cost the same amount. Whatwas the cost of each shirt? The upward movement of cilia helps to move mucus up the trachea to the pharynx where it is swallowed. This system of cleaning out trapped debris is called the Uddin Corp.s statement of financial position at the end of 2019 included the following items:The following information is available for the 2020 fiscal year:1. Net income was $391,000. Interest paid is classified as operating activities.2. Equipment (cost of $20,000 and accumulated depreciation of $8,000) was sold for $10,000.3. Depreciation expense was $4,000 on the building and $9,000 on equipment.4. Amortization expense on a patent was $3,000.5. Current assets other than cash increased by $29,000. Current liabilities increased by $13,000.6. An addition to a building was completed at a cost of $31,000.7. An FV-OCI investment in shares was purchased for $20,500 on the last day of the year. This was the first such investment made by Uddin in its history.8. Bonds payable of $75,000 were issued at par.9. Cash dividends of $180,000 were declared and paid. Dividends paid are treated as financing activities.Uddin prepares financial statements in accordance with IFRS.a) Prepare a statement of financial position (SFP) as at December 31, 2020. (Hint: You will need to adjust ("plug") the December 31, 2020 amount of current assets to ensure the SFP balances.) (List Property, Plant and Equipment in order of Land, Buildings and Equipment.)b) Prepare a statement of cash flows for the year ended December 31, 2020, using the indirect method. (Show amounts that decrease cash flow with either a - sign e.g. -15,000 or in parenthesis e.g. (15,000).) this theorist believed that the causes of behavior are in the environment and that inner mental events are themselves shaped by environmental forces. you just got a roommate. if you want to get the most accurate judgment of your roommates personality, who should you ask? Flora made 8 withdrawals of $55 each from her bank account. What is the overall change in her account? the marketing manager for dunkin' donuts paid for television and magazine advertising to announce improvements in its coffee. the advertising is an example of which variable in the marketing mix? Words to describe the communication cycle? Which are key components of an RPA strategy?Educating, knowledge sharing, technology decisions.Timelines, scaling, change management.Platform selection, getting started, business case.business case, change management, obtaining commitment. A cylindrical container has a radius of 17 inches and a height of 63 inches, how many gallons will it hold? Who was the President during theCivil War?A. Abraham LincolnB. Franklin PierceC. Rutherford B. HayesD. James A. Garfield A closed system consists of a pendulum that is swingingback and forth. If the pendulum's gravitational potentialenergy decreases, what else must happen to the energy of thesystem?O A. Its total mechanical energy must decrease.O B. Its kinetic energy must decrease.O C. Its kinetic energy must increase.D. Its total mechanical energy must increase. she ........( not play ).........the gui t,but she ( play )........the piano. Find the horizontal asymptote of :Pic is at the bottom Why is it important to reform campaign finance law? Mike is purchasing fabric for a school project. He needs to cut out circles with an area of 314 square inches. The fabric at the store is precut into squares, each of which has a whole number of inches for the length of its side. What is the smallest square piece of fabric Mike can purchase to use to cut out one of the circles? pls help me I am in real trouble The Giver: Although it was his first December, Gabriel will not be assigned to a couple this year. What will happen to him? Write in Standard Form...???