4. the revenue that is forgone from an alternative use of an asset, such as cash, is called . sacrificial revenue. an opportunity cost. an economic loss. none of these choices are correct.

Answers

Answer 1

The revenue that is forgone from alternative use of an asset, such as cash, is called an opportunity cost.

What is opportunity cost.?

Generally, The value or advantage lost by participating in a certain activity in comparison to engaging in a different activity is known as the opportunity cost in microeconomic theory.

Simply put, it indicates that by choosing one activity, you are forgoing the chance to engage in a different one.

Opportunity costs are the possible advantages that a person, investor, or company forgoes while deciding between two options.

Read more about opportunity cost.

https://brainly.com/question/24319061

#SPJ1


Related Questions

According to the video, which qualities do Insurance Underwriters need? Check all that apply.

communication skills
customer service skills
computer skills
knowledge of sales strategies
an outgoing attitude
a background in finance

Answers

Answer:

The correct answers are (A) (C) (F)

Explanation:

Hope this helps ya'll :)

A communication skills, C computer skills, F a background in finance

Explanation:

A cash flow statement can help you develop and determine budget categories.
a. True
O b. False

Answers

B. False hope this helps!

When George was 50 years old, he inherited a lump-sum of $80,000 from his father. He invested the money in an equity fund outside of his RRSP because he did not have any contribution room left. He pays the income tax on the investment return from the investment return, and reinvests his after-tax return. If the fund earns 9% per year before tax, how much will George have in the equity fund at age 65, if his marginal tax rate between now and retirement is 46%? a) $222,120 b) $411,333 c) $197,096 d) $163,019

Answers

The total amount in the equity fund after 15 years will be $222,121.90 (approximately). Thus, the correct option is (a) $222,120.

Given information:Initial Investment, P₀ = $80,000Rate of return, r = 9%Per annum tax rate, t = 46%Time period, t = 65 – 50 = 15 yearsThe total amount in the equity fund after 15 years will be equal to the present value of the initial investment plus the present value of all the reinvested returns over the 15 years.

Let the amount in the equity fund after 15 years be denoted by A and let the annual after-tax interest be denoted by R. Then, the following formula can be used:A = P₀ + R[(1 – (1 + r)⁻ᵗ)/ (1 – (1 + r (1 – t))⁻ᵗ)]A = 80,000 + R[(1 – (1.09)⁻¹⁵)/ (1 – (1.09 (1 – 0.46))⁻¹⁵)]A = 80,000 + R[(1 – 0.196)/ (1 – 0.589)]A = 80,000 + R(0.55)A = 80,000 + 0.55R ………..

(i)The annual after-tax return, R = r (1 – t) = 0.09(1 – 0.46) = 0.0486.Substituting the value of R in equation (i), we get:A = 80,000 + 0.55(0.0486)A = 80,000 + 0.02673AA = $222,121.90Therefore, the total amount in the equity fund after 15 years will be $222,121.90 (approximately). Thus, the correct option is (a) $222,120. Answer: (a) $222,120.

To know more about  equity fund , refer to the link:

https://brainly.com/question/30007855#

#SPJ11

Automation has improved the quality and efficiency of repetitive tasks. True or False

Answers

Answer:True

Explanation:

when a broker associate leaves one real estate company for another

Answers

When a broker associate leaves one real estate company for another, they must follow the termination procedures, join the new company through an application process, inform clients about the move, and update marketing materials and profiles.

When a broker associate decides to leave one real estate company for another, several factors come into play, both for the associate and the respective companies involved.

Firstly, the associate needs to terminate their existing relationship with the current real estate company. This may involve following the procedures outlined in their employment contract or agreement, which could include providing notice, returning company property, and settling any outstanding financial obligations. It's important for the associate to handle this transition in a professional and respectful manner to maintain their reputation within the industry.

Once the associate has officially left the company, they can begin the process of joining the new real estate company. This typically involves submitting an application, going through an interview process, and meeting any requirements set by the new company, such as obtaining necessary licenses or certifications.

During this transition, the associate may need to inform their existing clients about the move and provide them with options for continuing their real estate needs. This includes transferring client files, contracts, and any ongoing transactions to the new company. Open and transparent communication with clients is essential to maintain trust and ensure a smooth transition.

Additionally, the associate may need to update their marketing materials, website, and professional profiles to reflect their new affiliation with the new company. This includes updating contact information, logos, and branding elements to align with the new company's identity.

Overall, the process of a broker associate leaving one real estate company for another requires careful adherence to contractual obligations, effective communication with clients, and compliance with the new company's requirements. Professionalism, transparency, and timely execution are key to ensuring a successful transition for both the associate and their clients.

To learn more about real estate refer here:

https://brainly.com/question/31962418

#SPJ11

A downward sloping demand curve can be explained by i. diminishing marginal utility. ii. diminishing marginal returns. iii. the substitution effect. iv. the income effect.

Answers

A downward sloping demand curve can be explained by i. diminishing marginal utility, iii. the substitution effect, and iv. the income effect.

What  is downward sloping demand curve?  

A downward sloping demand curve can be explained by i. diminishing marginal utility, iii. the substitution effect, and iv. the income effect.

1. Diminishing marginal utility: This refers to the idea that as a consumer consumes more of a good, the additional satisfaction (or utility) they gain from each additional unit decreases. This causes the demand curve to slope downward because consumers are less willing to pay a high price for additional units of the good.

2. Substitution effect: As the price of a good increases, consumers may choose to substitute it with other similar goods that are relatively less expensive. This causes the demand curve to slope downward because an increase in price results in a decrease in the quantity demanded as consumers switch to alternative products.

3. Income effect: When the price of a good decreases, consumers' real income effectively increases (since they can now purchase more of the good with the same amount of money). As a result, consumers may choose to buy more of the good, causing the demand curve to slope downward as lower prices lead to an increase in the quantity demanded.

Note that option ii. diminishing marginal returns is not relevant to the demand curve, as it refers to the production side of the economy (i.e., how output changes as additional units of input are used in production).    

To know more about downward sloping demand curve

visit:

https://brainly.com/question/29749119

#SPJ11

Cash payments a business makes to stockholders are called
.

Answers

Answer:

Cash dividends are often paid on a regular basis, such as monthly or quarterly, but are sometimes one-time-only payouts, such as after a settlement. Most brokers offer a choice to accept or reinvest cash dividends. Dividend-paying companies are typically established, with stable cash flow, and beyond the growth stage.

Explanation:

give me a brainliest

Distinguish between 'value' and 'price'.​

Answers

Value represents the amount of money that you are willing to pay for anything. Price is the amount of money that you are asked to pay for it.

Which career worker installs, maintains and repairs equipment used for communication?

Answers

Answer:

Telecommunications engineer.

Explanation:

Telecommunications can be defined as the scientific and technological process which involves the exchange of data (informations) from one user (sender) to another (receiver) at a distance, through a wired or wireless network connection. The transmission or exchange of these data (informations) are made possible through the use of electronic devices or equipments such as switches, routers, computers etc, which typically transmits electromagnetic waves, electric impulses, and packets.

Hence, these equipments or electronic devices require installation, configuration, repair and or maintenance, which are typically being done by a telecommunications engineer.

Therefore, the career worker who installs, maintains and repairs equipment used for communication is a Telecommunications engineer.

The system that requires an accountant to record a transaction when it occurs is called immediate accounting. True/ False

Answers

False. The system that requires an accountant to record a transaction when it occurs is called real-time accounting.

Real-time accounting refers to the practice of recording and updating financial transactions and information immediately or as close to the time of occurrence as possible. This approach provides timely and accurate financial data for decision-making and financial reporting purposes.

Immediate accounting is not a recognized term or system in accounting. It is important to note that there are different accounting systems and methods used in various organizations, such as accrual accounting, cash basis accounting, and various specialized accounting frameworks. However, none of these systems or methods are referred to as "immediate accounting."

Learn more about financial here:

https://brainly.com/question/28319639

#SPJ11

Which of the following statements is CORRECT?a. Diversifiable risk can be reduced by forming a large portfolio, but normally even highly-diversified portfolios are subject to market (or systematic) risk.b. A large portfolio of randomly selected stocks will have a standard deviation of returns that is greater than the standard deviation of a 1-stock portfolio if that one stock has a beta less than 1.0.c. A large portfolio of stocks whose betas are greater than 1.0 will have less market risk than a single stock with a beta = 0.8.d. If you add enough randomly selected stocks to a portfolio, you can completely eliminate all of the market risk from the portfolio.e. A large portfolio of randomly selected stocks will always have a standard deviation of returns that is less than the standard deviation of a portfolio with fewer stocks, regardless of how the stocks in the smaller portfolio are selected.

Answers

Answer:

a. Diversifiable risk can be reduced by forming a large portfolio, but normally even highly-diversified portfolios are subject to market (or systematic) risk.

Explanation:

Diversifiable risk can as well as be regarded as unsystematic risk, it is specific risk of a firm which impacts the price of the stock of individual rather than affecting the industry as a whole or sector where the the firm is carrying out it's operation. It a risk whereby there is possibility that change in the price of a security will be experienced because of the specific characteristics that the security have. It should be noted that Diversifiable risk can be reduced by forming a large portfolio, but normally even highly-diversified portfolios are subject to market (or systematic) risk.

Suppose that the price of oranges
increases from $1 to $1.10 per pound
and the quantity demanded falls from
1000 pounds to 800 pounds.
A. Calculate the price elasticity of
demand when price changes from
$1.to $1.10.
B. Are oranges elastic or inelastic at
this price point? Explain your
answer.
C. What happens to total revenue for
orange sellers when the price of
oranges increases a few cents
above $1 (total revenue increases,
decreases, stays the same, cannot
be determined)? Explain your
answer and why..
D. Assume that the demand for
oranges is a straight line, Calculate
its equation in terms of price (p)
and quantity (q).

Answers

The price elasticity of demand is -2.

B. Oranges are elastic at this price point because the price elasticity of demand is greater than 1. A price elasticity of demand value greater than 1 means that a change in price leads to a proportionally larger change in quantity demanded.

What is the  price elasticity about?

A. The price elasticity of demand can be calculated using the formula:

% change in quantity demanded / % change in price

The percentage change in price is:

(1.10-1)/1 * 100%

= 10%

The percentage change in quantity demanded is:

(800-1000)/1000 * 100% = -20%

Using these values in the formula, we get:

-20% / 10% = -2

Therefore, the price elasticity of demand is -2.

C. Total revenue is calculated as the price of oranges multiplied by the quantity sold. When the price of oranges increases, the quantity demanded decreases. The effect on total revenue depends on the price elasticity of demand. If demand is elastic (as it is in this case), the decrease in quantity demanded will be proportionally larger than the increase in price, so total revenue will decrease. Therefore, total revenue decreases when the price of oranges increases a few cents above $1.

D. We know that the demand for oranges falls from 1000 pounds to 800 pounds when the price increases from $1 to $1.10. Using the two points, we can find the slope of the straight line as:

(800-1000)/(1.10-1) = -200/0.1 = -2000

This gives us the slope of the line, which is also the coefficient of price (p) in the demand equation. Using the point-slope form of a line, we can find the equation of the line as:

q - 1000 = -2000(p - 1)

Simplifying, we get:

q = -2000p + 3000

Therefore, the equation of the demand curve for oranges is q = -2000p + 3000, where q is the quantity demanded and p is the price of oranges.

Learn more about price elasticity from

https://brainly.com/question/29615048

#SPJ1

If average annual income for all workers is $37,000 and a person with a bachelor’s degree can expect to earn 32 percent more than average, what is the average annual income for persons holding bachelor’s degrees (round to the nearest thousand)?

Answers

Answer:

 $48,840.00  

Explanation:

If the average  income is $37,000  

A graduate expects to earn 32% above average.

The graduate will earn $37,000 +( 32% of $37,000)

=$37,000 +(32/100 + 37,000)

=$37,000 +  $11,840.00  

= $48,840.00                                                        

 

                           

Answer:

49000

Explanation:

(source) TRUST ME  

im being serious tho it is 49000

regarding perfect competition, what does it mean when the goods sold by the firms in a market are homogeneous?

Answers

When two homogenous products are ideal equivalents for one another and consumers are unable to distinguish between the goods sold by various businesses, the products are said to be homogenous. The most crucial differentiator in the perfect competition between businesses making similar items is price.

What do you mean by a homogeneous product in perfect competition?

When a product is homogeneous, it means that its quality, form, size, and color are all the same. Therefore, no manufacturer can set a different price for the goods it produces. The market is characterized by homogeneous pricing.

A market with perfect competition has homogeneous goods (identical). Each vendor (or business) delivers a homogenous product in a market with perfect competition, meaning that each unit of the product has the same size, form, and other characteristics.

To learn more about homogeneous products, visit:

https://brainly.com/question/14367760

#SPJ4

Entrepreneur: Ken Kutaragi While employed as a sounds lab specialist at Sony, Ken Kutaragi bought his daughter a Nintendo (a game console made by a competitor of Sony). He found the sound effects primitive and thought he could make improvements to it using a digital sound clip. Consequently, Ken developed the SPC7000 for the next generation of Nintendo machines. On discovery of this innovation, the then CEO of Sony, Norio Ohga, realized its value and did not chastise Ken. Instead, he encouraged Ken to develop a gaming system for Sony, which became the PlayStation. This made Sony a major player in the games market, with PlayStation 2 becoming the best-selling game console of all time. Ken was persistent and he went on to develop other PlayStation products earning him the name The Father of the PlayStation. He was soon rewarded for his significant achievement. He was promoted to the position of Chairman and Chief Executive Officer of Sony Computer Entertainment (SCEI), the video game division of Sony Corporation, and made it into a major profit centre for the Sony Corporation.

(a) Distinguish between creativity and innovation. [6 marks]

(b) Name FIVE things which the management of Sony Computer Entertainment Inc did (in relation to Ken) to promote a culture of creativity. [5 marks]

(c) With reference to the case, identify TWO sources of innovation that was utilized by Kutaragi. [4 mmarks

please help!!

Answers

A creativity was to represent on the different way and innovation was the existing things to the involved new things.

What is innovation?

The term innovation refers to the process of creating an idea and invention on particular commodities. The innovations are always easy to work for human. They already exist in goods and services, they also modification is called the innovation.

There are five things to promote the management of Sony Computer Entertainment was the promote a culture of creativity was the new way a digital sound clip, design, eco friendly, reusable, and the other things. Two way of innovation are sound pitch, and volume.

As a result, the conclusion of the sources of innovation and the creativity are the aforementioned.

Learn more about on innovation, here:

https://brainly.com/question/30929075

#SPJ1

an unexpected import restriction imposed on mangoes by the usda part 2 a. will reduce the price of mangoes in the united states. b. will increase the price of mangoes in the united states. c. will discourage american producers of mangoes. d. will reduce the price of mango juice in the united states.

Answers

B. The USDA's surprise import limit on mangoes would push up the cost of mangoes in the country.

B. The unexpected import restriction imposed on mangoes by the USDA will increase the price of mangoes in the United States. This is because the restriction will limit the supply of mangoes available in the US market, leading to an increase in prices due to higher demand. The restriction may also discourage American producers of mangoes as they may find it difficult to compete with the restricted foreign imports. However, it is unlikely to have a direct impact on the price of mango juice in the United States as juice is often made from a variety of fruits and not solely from mangoes.

Learn more about import here

https://brainly.com/question/31566124

#SPJ11

What responsibilities does the film editor have? (Select all that apply).


reading the script

revising the script

digital grading

manipulating graphics, plot, sound, and score

Answers

The responsibilities of the film editor would be to:

reading the scriptmanipulating graphics, plot, sound, and scorerevising the script

Who is a film editor?

This is the person that is in charge of all that has to do with the turning of the uncut images that are from a film shoot into a more finished product. The editor is one that has to do with job of studying the scripts of movies and then developing the movies in a post production effort.

Hence we can say that the responsibilities of the film editor would be to:

reading the scriptmanipulating graphics, plot, sound, and scorerevising the script

Read more on film editor here: https://brainly.com/question/15621075

#SPJ1

if an inspector comes to check produce outside of their regular working schedule, which of the following is the hourly base rate of his/her services?

Answers

The hourly base rate of an inspector's services when they come to check produce outside of their regular working schedule would depend on several factors such as the inspector's employment agreement, industry standards, and regional regulations. Without specific information, it is challenging to provide an exact figure.

Inspectors who work outside their regular working schedule may be subject to additional compensation, such as overtime pay or shift differentials, depending on the policies in place. These additional rates are typically higher than the standard hourly base rate to account for the non-standard working hours.

To determine the exact hourly base rate for an inspector's services outside their regular schedule, it is best to consult the inspector's employment contract, collective bargaining agreements (if applicable), or refer to the prevailing industry standards and local labor regulations.

Learn more about industry standards here:

https://brainly.in/question/9564416
#SPJ11

(a) Some financial statements are theoretically linked with each other. For instance, the statement of financial position and the statement of financial performance are linked. Explain how these statements are linked to the accounting equation. Further, illustrate it with an example. [Limit 150 words] (4 marks) ANSWER a): (b) Accountants are responsible for the internal controls. Discuss this statement. [Limit 150 words] (3 marks) ANSWER b):

Answers

a) The statement of financial position and the statement of financial performance are linked to the accounting equation as they provide information about the assets, liabilities, and equity of a company, and these values must balance according to the equation. b)  the total assets ($35,000) are equal to the total liabilities and equity ($35,000), which confirms that the financial statements are linked to the accounting equation.

(a) The statement of financial position (also known as the balance sheet) and the statement of financial performance (also known as the income statement) are linked to the accounting equation. The accounting equation states that assets equal liabilities plus equity.

To understand how these statements are linked, let's consider an example. Suppose a company has the following financial information:

Assets:
- Cash: $10,000
- Accounts Receivable: $5,000
- Equipment: $20,000

Liabilities:
- Accounts Payable: $7,000

Equity:
- Owner's Capital: $28,000

Using the accounting equation, we can calculate the total assets:
Total Assets = Cash + Accounts Receivable + Equipment
Total Assets = $10,000 + $5,000 + $20,000
Total Assets = $35,000

Now, let's look at the liabilities and equity:
Total Liabilities + Equity = Accounts Payable + Owner's Capital
Total Liabilities + Equity = $7,000 + $28,000
Total Liabilities + Equity = $35,000

As we can see, the total assets ($35,000) are equal to the total liabilities and equity ($35,000), which confirms that the financial statements are linked to the accounting equation.

In summary, the statement of financial position and the statement of financial performance are linked to the accounting equation as they provide information about the assets, liabilities, and equity of a company, and these values must balance according to the equation.

Learn more about equity from given link: https://brainly.com/question/11556132

#SPJ11

If the minimum wage exceeds the equilibrium wage, then.

Answers

Answer:

The quantity demanded of labor will exceed the quantity supplied.

Explanation:

Pls, choose me as brainliest!

Assume that projected revenue for 2018 is 1,231,414. also assume the following projected 2018 costs in each of the cost categories from question one: packaged (cans & bottles) $122,939 kegs $73,637 shrinkage/wip loss $42,000 contract labor $9,000 direct labor $240,000 inbound freight $18,000 consumer advertising $30,000 trade promotion $30,000 sales promotion $18,000 salaries & benefits $180,000 given these costs, compute shannon's projected contribution margin in dollars.

Answers

Shannon's projected contribution margin for 2018 is $486,838.

To compute Shannon's projected contribution margin in dollars, we need to subtract the total projected costs from the projected revenue.

Projected revenue for 2018: $1,231,414

Projected costs:

Packaged (cans & bottles): $122,939

Kegs: $73,637

Shrinkage/WIP loss: $42,000

Contract labor: $9,000

Direct labor: $240,000

Inbound freight: $18,000

Consumer advertising: $30,000

Trade promotion: $30,000

Sales promotion: $18,000

Salaries & benefits: $180,000

Total projected costs = $122,939 + $73,637 + $42,000 + $9,000 + $240,000 + $18,000 + $30,000 + $30,000 + $18,000 + $180,000 = $744,576

Projected contribution margin = Projected revenue - Total projected costs

= $1,231,414 - $744,576

= $486,838

So, Shannon's projected contribution margin for 2018 is $486,838. This represents the amount of revenue that remains after subtracting all the variable and fixed costs associated with producing and selling the product. It is the amount that can be used to cover fixed expenses and contribute towards profit.

To know more about contribution

https://brainly.com/question/10410785

#SPJ4

In the space below, explain how you can access the character map in Word 2016 using a complete sentence.

In the space below, explain how you can access the character map in Word 2016 using a complete sentence.

Answers

Answer:

Following are the solution to this question:

Explanation:

This method through clicking the "Start" key and select mostly on Software sub-menus, but instead clicking mostly on Accessories submenus of its Programs menu, and afterward the System Tools character sub-menu, select the "System Tools;" then click on the "Tools" key of the "Tools" table to display the actor application.  

In Windows 10 you also can access that Character Map by pressing, that Windows icon, then click mostly on Character Chart to view, that Character Map button.

Answer:

Click Start, point to Settings, click Control Panel, and then click Add/Remove Programs. Click the Windows Setup tab. Click System Tools (click the words, not the check box), and then click Details. Click to select the Character Map check box, click OK, and then click OK.

Explanation:

support Microsoft

As an HR strategic partners, it is important that we hire for specific skills that fit the position. We should analyze pay in accordance with finance to see what monies are available for a particular position and how to we compensate properly in the beginning for experience, skills, and wisdom. What would your conversation look like with the C-Suite staff to ensure everyone is onboard with the compensation structure and how money could be saved?

Answers

The conversation with the C-Suite staff regarding the compensation structure and cost-saving measures would focus on aligning hiring decisions with specific skills, analyzing pay in accordance with available finances, and ensuring proper compensation for experience, skills, and wisdom.

In the conversation with the C-Suite staff, I would emphasize the importance of hiring for specific skills that align with the position requirements. By focusing on skill-based hiring, we can ensure that we have the right talent in place to drive the organization's success.

I would then discuss the need to analyze pay in accordance with the organization's financial resources. This would involve understanding the budget available for each position and finding the balance between attracting top talent and managing costs effectively.

To gain their support and ensure everyone is onboard, I would emphasize the importance of properly compensating employees based on their experience, skills, and wisdom. By rewarding employees fairly from the beginning, we can attract and retain top talent while fostering a culture of fairness and motivation.

Additionally, I would highlight the potential cost-saving opportunities in the compensation structure, such as exploring alternative benefits or performance-based incentives, to optimize resource allocation and maximize the return on investment.

Learn more about cost-saving here:

https://brainly.com/question/31276411

#SPJ11

You want to ctegsosit $15,00na bank at an interest rate of 7 percent per year What is the uture vale of this money after three yes?
tuture value P+)
present value +0
OA S1837563
OR $19661.94
OC $20407.33

Answers

Answer:

A $18, 375.63

Explanation:

The amount to be deposited is $15,000

Interest rate is 7 percent

time is 3 years

the future value will be; the applicable formula

A = p x ( 1 + r) ^n

A = $15,000 x ( 1 + 7/100) ^ 3

A= $15,000 x 1.225043

A=$18,375. 64

When making decisions, managers often must decide between doing what is beneficial for the firm in the short term, and what is beneficial for both the firm and society in the long term. To address this conflict, a firm must

Answers

When making decisions, managers are often faced with a conflict between what is beneficial for the firm in the short-term and what is beneficial for both the firm and society in the long-term.

This conflict arises because the actions that benefit the firm in the short-term may not necessarily align with the interests of society as a whole, which can lead to negative consequences for both the company and society in the long-term.

To address this conflict, a firm must adopt a long-term orientation and consider the broader social and environmental impacts of its decisions. This means looking beyond immediate financial gains and recognizing that actions taken today can have far-reaching implications for the company's reputation, customer loyalty, employee morale, and overall sustainability.

Firms that prioritize social responsibility and sustainable business practices are more likely to build strong relationships with stakeholders, including customers, employees, investors, and regulators. They are also better equipped to weather economic downturns and other disruptions, as they have diversified their risk and invested in building resilient supply chains and communities.

Ultimately, the key to addressing the conflict between short-term gains and long-term benefits is a commitment to corporate social responsibility (CSR) and sustainable business practices. By prioritizing the needs of society and the environment alongside those of shareholders, firms can create value for all stakeholders over the long-term, ensuring their continued success and impact.

learn more about managers here

https://brainly.com/question/32150882

#SPJ11

The highest-income quintile of the population receives 13 times as much income as the lowest-income quintile. However, the highest-income quintile only spends 4 times as much as the lowest-income quintile. Identify the possible reason or reasons for this stark difference between income inequality and consumption inequality. a. The richest quintile has the ability to save a larger percentage of its income. b. Individuals experiencing temporary fluctuations in their incomes are more likely to maintain moderate spending habits.c. Intergenerational mobility allows children to consume more than their parents. d. The poverty line does not reflect relative poverty.

Answers

The richest quintile has the ability to save a larger percentage of its income. Option A is true.

What income quintile signify?

The highest income quintile is able to acquire wealth and invest it in assets like stocks, bonds, and real estate that produce more income because they can save a bigger percentage of their income. Because of this, their income grows faster than their spending. In contrast, those in the lowest income quintile are more likely to spend the majority of their income on basics like housing, food, and healthcare, leaving little money left over for savings or investments. The mismatch between income disparity and consumption inequality can also be influenced by other elements like credit availability, varying levels of education, and disparities in employment prospects.

To know more about Income Visit:

brainly.com/question/14732695

#SPJ1

amounts withheld from employee's earnings for employee income tax is considered a by the employer until the government is paid. multiple choice question. current asset long-term liability current liability long-term asset

Answers

The employer views the sums deducted from an employee's pay for employee income tax as a current liability until the government is compensated.

A current liability is a debt that the business plans to settle immediately utilizing resources shown on its current balance sheet. Accounts payable, wages, taxes, and deferred income are examples of typical current obligations.

The amount of federal income tax deducted from an employee's paycheck is known as withholding.

All of the current and fixed assets make up capital. Capital might be in the form of gifts or cash. As a result, a company entity's capital is divided into fixed capital and working capital.

To learn more about current liability

https://brainly.com/question/29341666

#SPJ4

Which type of involvement has been found to enhance the adjustment of low-income students in their transition to middle school?.

Answers

Parental  involvement has been found to enhance the adjustment of low-income students in their transition to middle school

What is the positive effect of parental involvement?

Parent participation is the working together of the parents and the school to enhance the educational experience and academic success of the children. Numerous studies have revealed how crucial parental involvement in a child's education is to that child's academic achievement. Parental involvement enhances learning outside of the classroom, gives kids a better overall experience, and improves their academic performance. Parents must encourage their children's learning at home as well as in preschool settings. The degree of participation is essential in creating a significant impact on the student's performance. The more the parental involvement, the the higher the impact on the child's academic achievement.

To learn more Parental  involvement, refer to

https://brainly.com/question/25695765

#SPJ4

____ personnel aggregate purchase requisitions into purchase orders (pos) in the procurement process. A)
purchasing unit
B)
accounting
C)
business unit
D)
warehouse

Answers

The correct option is A) purchasing unit.In the procurement process, purchasing unit personnel aggregate purchase requisitions into purchase orders (POs).

The purchasing department is responsible for obtaining goods and services for an organization. The procurement process involves identifying the requirements, identifying potential suppliers, soliciting bids, selecting a supplier, and negotiating the price.

The purchasing unit is the department responsible for acquiring the goods and services required by an organization. It is responsible for generating purchase orders based on the needs of the business unit. The purchasing unit must follow the procurement policies and procedures of the organization, which ensure that goods and services are acquired in a timely and cost-effective manner.

The purchasing unit is responsible for maintaining good relationships with suppliers and ensuring that the organization receives quality goods and services.

To know more about soliciting bids visit:-

https://brainly.com/question/29870232

#SPJ11

Tracking a website you visit and compiling information could be an example of _____.

Answers

Answer:

ISP

Explanation:

Internet Service Providers (ISPs) can see everything you do online. They can track things like which websites you visit, how long you spend on them, the content you watch, the device you're using, and your geographic location.

Other Questions
generally, ethical dilemmas are not routine. therefore, there is no way that an individual can be prepared or informed for a problem ahead of time. Windows Server backups are scheduled as follows: full backups on Saturdays at 3 a.m. and incremental backups weeknights at 9 p.m. Write verification has been enabled. Backup tapes are stored off site at a third-party backup vendor location. What should be done to ensure the integrity and confidentiality of the backups [tex](3x^{2} -14x-5)/(x-5)[/tex] Substitute the value of x back into the equation x + 3 2x = negative 2 x equals negative StartFraction one-fourth EndFraction plus StartFraction one-half EndFraction x plus 5. + x + 5 to justify the solution. What value of x is the solution?x = 5. A concert promoter charges $65 per ticket for a concert. The promoters cost will be $5500 plus $4 per ticket. If r = revenue and n = number of tickets sold, then (n) shows how revenue (amount of money received from ticket sales) depends on the number of tickets sold. r(n) = 65n If c= cost and n = number of tickets sold, then c(n) shows how cost (expenses of the concert promoter) depends on the number of tickets sold. c(n) = 4n+ 5500 Part I: Write an equation for the profit function p(n). Show your work. Hint: profit = revenue - cost Part II: Find the profit for the concert promoter if he sells 850 tickets. Show your work and explain what your answer means in terms of the problem. harmony reports a regular tax liability of $15,400 and tentative minimum tax of $17,440. given just this information, what is her alternative minimum tax liability for the year? What is the geometric shape of this molecule based on this diagram? 3. Translate the following into predicate logic (every propertyshould be expressed by a separate predicate. (3 points)a. Some linguist is tall and some linguist is young.b. Chomsky likes all teache what figurative language is the expression living life to the fullest rimary psychopath a. Individual who is antisocial because of social learning 1. b. Process whereby, if a person responds in time to a warning signal, he or she avoids painful or aversive stimuli semantic 2. aphasia criminal c. Robert Hare's classification of the "true" psychopath psychopath 3. d. Psychopaths exhibit deficits on variety oftasks that require activation ofthe 4. PCL e. A term used for the neurobiological indicators of a particular phenomenon, such as psychopathy 5. recidivism left f. Individuals who commit antisocial acts because of severe emotional problems or inner conflicts 6 hemisphere emotional g. A return to criminal activity after being convicted of a criminal offense paradox 7. h. Psychopaths seem to be able to talk about emotional cues but lack the ability to use them in the real world secondary psychopath 8. i. Developed by Robert Hare, currently the best- dyssocial known instrument for the measurement of criminal psychopathy j. Higher order mental abilities involved in goal 9, _psychopath antisocial directed behavior. 10 personality disorder is characterized by a k. history of continuous behavior in which the rights of others are violated markers 11 executive 1. Primary psychopaths who engage in persistent and serious antisocial/criminal behavior. 12. functions avoidance . Characteristic found in psychopaths whereby the words they speak are devoid of emotional sincerity learning 1. (a) In a class of 70 students, 40 belong to the Red Cross Society, 27 belong to the Girls' Guild Society, and 12 belong to both societies. The remaining students do not belong to any of the two societies. (i) Illustrate this information on a Venn diagram. (ii) How many students belong to the Red Cross Society only? (iii) How many students belong to one society? (b) Evaluate 0.07 x 0.6 0.014 x 0.03' Leaving the answer in standard form. Four islands in this study, ranging in area from about 100 to 800 square miles, each contained about 100 bird species. What does such variation tell you about the simple assumptions of the island equilibrium model? Two identical objects are moving directly to-ward one another at the same speed v.What is the total kinetic energy of the sys-tem of the two objects? The PQR of the image is a straight line. PQ = QS = QR. Find the magnitude of P^SR in degrees. Which word best describes a characteristic of postmodernism? A. Conventional B. Experimental C. LinearD. Critical(The answer is b) eory.According to cell theory, which of the following aremade of cells? Check all that apply.O flowersrocksbloodwaterbacteriasugarskinRETRY 1. The base pairing model of DNA replication predicts the complementary DNA strand after replication. Which of the following is a limitation of the model?Question 1 options:The model is limited to only human DNA.The model doesn't predict the proteins that are transcribed.The model is limited to DNA and doesn't account for RNA.The model is limited by not accounting for natural errors during DNA replication.Question 2 A Biology student is investigating DNA replication in peony flowers; which of the following is a specific and testable question that could guide their research?Question 2 options:What is the error rate in complementary DNA strand sequences of peony flower after replication?What is the DNA sequence of a peony flower?What is the rate of error in DNA replication?What is the complementary DNA strand sequence of a peony flower?Question 3 You are studying DNA replication; using the base pairing model of DNA replication, which of the following would you predict is the complementary DNA sequence for the parent DNA strand AGTCCATG?Question 3 options:AGTCCATGTCAGGTACGATTACAAGACTTGCAQuestion 4You are investigating the genetics of pink and white peony flowers; what is a specific and testable question you could ask about the flowers?(WILL MARK BRAINLIEST!!!) The English infinitive present tense verb structure is: to + verb.TrueFalse Why do cells carry out the hydrolysis of ATP?Explain why mitochondria are often called the powerhouse of the cell. A nurse is teaching a group of parents of preschoolers about safety. which information would the nurse include? select all that apply.