2020 haninec lower subscapular nerve transfer for axillary nerve repair in upper brachial plexus palsy.pdf

Answers

Answer 1

The auxillary nerve has both a motor and a sensory issuance of innervation. It has motor fibers that innervate the deltoid muscle, serving as an abductor, flexor, and extensor at the shoulder joint, as well as the teres minor muscle, permitting lateral process of the glenohumeral joint.

How long does recovery from brachial plexus surgery take?

Depending on the complexity of the case, surgery for a brachial plexus injury can take anywhere from 3 to 12 hours. Patients should expect to be limited in their movements for at least four weeks after surgery, and upper extremity therapy may be required for several months while nerves and muscles recover.

How successful is brachial plexus surgery?

Tendon transfers typically heal faster but provide less functional results. The success of your procedure is determined by the severity of your injury as well as the surgeon's and team's expertise. 80% to 90% of patients who have nerve transfers see improvement in function.

The auxillary nerve receives both motor and sensory innervation. It contains motor fibers that innervate the deltoid muscle, which acts as an abductor, flexor, and extensor at the shoulder joint, as well as the teres minor muscle, which allows for the glenohumeral joint's lateral process.

To learn more about  Axillary nerve, refer

https://brainly.com/question/6881711

#SPJ4


Related Questions

Which of the following can lead to cancer?
A. a disruption in the cell cycle
B a cell entering the G0
C. A cell never leaving G0
D. The death of a cell

Answers

The option that can lead to cancer is a disruption in the cell cycle (option A).

What causes cancer?

Cancer is a disease in which the cells of a tissue undergo uncontrolled (and often rapid) proliferation.

Cell cycle is the life cycle of eukaryotic cells from a quiescent beginning, growth, duplication of DNA followed by mitosis and division. The period of time in the cell cycle when nothing is happening is known as the G0 phase i.e. inactivity.

Cancer is a genetic disorder. It happens when genes that manage cell activity mutate and create abnormal cells that divide and multiply, eventually disrupting how the body works.

Therefore, disruption or alteration in the normal procedure of the cell cycle can lead to cancer.

Learn more about cancer at: https://brainly.com/question/8590464

#SPJ1

after chromosomes duplicate are the two sister chromatids that form identical? what is the significance of centromeres?

Answers

The sister chromatids are joined together by cohesin-containing proteins and are similar to one another. At the centromere, a section of the DNA that is crucial for their separation during later stages of cell division, the bond between sister chromatids is strongest.

Sister chromatid attachment and the attachment of spindle fiber are two of its primary activities. Centromeres aid in the proper chromosome alignment and segregation during cell division in eukaryotic cells. By guiding the construction of the microtubule-binding kinetochore and acting as the cohesion site between sister chromatids, centromeres perform crucial roles in equitable chromosomal segregation. Duplication is a type of mutation when one or more copies of a DNA segment are created. This DNA segment can be as short as a few bases or as large as a significant chromosomal region.

Learn more about sister chromatids

https://brainly.com/question/1574880

#SPJ4

How are a substance and a solution similar? How are they different?

My friends my account is oOMissCuteOo not oOMuskaOo ok!

Answers

The solution and substance are similar because the solution is a homogenous mixture.

What are the similarities between solution and substance?

A substance and solution are similar to each other in many ways because a solution is a homogeneous blend of two or more elements and/or compounds. Whereas a substance is an element or compound, therefore, a solution is a homogeneous combination of two or more substances.

A substance is different from solution because substance is an element or a compound whereas a solution is made up of combination of two or more substances. In a mixture, substances are generally just mixed and are not completely dissolved. In a solution, substances are dissolved completely and they cannot be filtered out.

So we can conclude that the substance and a solution are different as well similar to each other because the solution is a homogeneous mixture whereas substance is an element or a compound.

Learn more about Solution here: https://brainly.com/question/24372553

#SPJ1

Slides: Are there striations across the width of the muscle cells? Number of Nuclei? What are the size, shape, and arrangement of fibers? What function occurs as a result of the contractions in the selected muscle? (see page 3 of the lesson) What is the relationship between structure and function in the selected muscle? (see page 3 of the lesson)
Muscle - Human Cardiac
Intestines - Outer Wall Detail (smooth muscle)
Slide 1: Muscle- Skeletal Longitudinal Section
and
Slide 2: Muscle-Skeletal Cross Section

(The questions are for the muscles listed aboved)

Answers

In skeletal muscle cells, there are striations across the width of the muscle fibers due to the arrangement of myofilaments.

The number of nuclei in each muscle cell is typically multiple, as each cell is formed by the fusion of multiple myoblasts during development.

What is the composition of skeletal muscles?

The size, shape, and arrangement of muscle fibers can vary depending on the type of muscle.

Skeletal muscles are composed of long, cylindrical fibers that are arranged in parallel bundles.

Cardiac muscle fibers are shorter and more branched, forming a network of interconnected cells. Smooth muscle fibers are spindle-shaped and are not organized into distinct bundles or striations.

Learn more about skeletal muscles at: https://brainly.com/question/24655445

#SPJ1

what does pyruvate convert into when back at the mesophyll cell of C4 photosynthesis?

Answers

When pyruvate enters the c4 cycle and returns to the mesophyll cell, it is transformed back into phosphoenolpyruvate (PEP).

In mesophyll cells, specialized cells found in the leaves of C4 plants, carbon dioxide (CO2) is first fixed into a four-carbon compound, typically oxaloacetate, during C4 photosynthesis. The CO2 is then released from this four-carbon compound and enters the Calvin cycle for additional processing. Bundle sheath cells are another kind of specialized leaf cell.

Pyruvate is produced in the mesophyll cells as a byproduct of the breakdown of the four-carbon compound. The four-carbon compound required for CO2 fixation in mesophyll cells is then recreated using PEP.

Learn more about mesophyll cells at:

brainly.com/question/5252518

#SPJ4

The transcribed strand in DNA is: Group of answer choices 5' to 3' sense antisense AUG all of the above

Answers

The transcribed strand in DNA is the antisense strand that runs in the 3' to 5' direction. The correct option is A).

During transcription, RNA polymerase reads the template strand of DNA in the 3' to 5' direction and synthesizes a complementary RNA molecule in the 5' to 3' direction. The transcribed RNA molecule is therefore complementary in sequence to the template strand, which is also known as the antisense strand.

The other strand of DNA, which runs in the 5' to 3' direction, is called the sense strand because its sequence is identical to the RNA molecule, except that it contains thymine (T) instead of uracil (U).

In summary, the correct answer to the question is that the transcribed strand in DNA is the antisense strand that runs in the 3' to 5' direction. Therefore, the correct option is A).

To know more about DNA refer here:

https://brainly.com/question/30993611#

#SPJ11

Question # 2
Multiple Choice
According to the CDC article on noroviruses, food can be contaminated by all except
direct contact with contaminated hands
tiny droplets of vomitus that spray through the air when an infected person vomits
indirect contact with animal feces
direct contact with work surfaces that are contaminated with infectious stool or vomit

Answers

Answer:

I think Indirect contact with animal feces

hope it helped :)

Which group of organisms in the aquarium contains the largest amount of energy? a) primary consumers, b) secondary consumers, c) producers, d) herbivores

Answers

Answer:

b) secondary consumers.  This is because they are at the top of the food chain

please give brainliest! :)  

I hope this helped

wirte 2 slogans on 'need to conserve nature? ​

Answers

Answer:

Tree planting is the safest solution to pollution. Save the earth, save our environment. Don't be cruel, conserve your fuel.

Answer:

Explanation:

1. Save plants, save nature

2. Don't let mother nature become a "once upon time"

What are the two posterior branches of the internal iliac arteries?

Answers

The internal iliac artery is a major blood vessel that supplies blood to the pelvic region and lower extremities. It branches into two major posterior arteries, which are known as the posterior division of the internal iliac artery.

The first posterior artery is the iliolumbar artery. This artery supplies blood to the muscles in the lower back, as well as to the lumbar vertebral bodies and the sacral nerve roots. Additionally, the iliolumbar artery is important for supplying blood to the ilium, which is one of the largest bones in the pelvis.

The second posterior artery is the lateral sacral artery. This artery is responsible for supplying blood to the sacral region of the spinal cord, as well as to the muscles and tissues in the lower back. The lateral sacral artery is also important for supplying blood to the sacroiliac joints, which connect the sacrum to the ilium.

We can learn more about posterior branches here:

https://brainly.com/question/14149522#
#SPJ11

which clinical syndrome caused by gross chromosomal abnormalities is associated with bilateral cleft lip and palate, microphthalmia or anophthalmia, and polydactyly?

Answers

The clinical syndrome caused by gross chromosomal abnormalities that is associated with bilateral cleft lip and palate, microphthalmia or anophthalmia, and polydactyly is Pallister-Killian syndrome (PKS). The disorder is a rare genetic disorder that affects multiple systems in the body and is caused by an extra copy of chromosome 12p.

PKS is a complex multisystem disorder characterized by an unusual facial appearance, intellectual disability, seizures, and other health problems. Pallister-Killian syndrome is a chromosomal disorder that is caused by an extra copy of chromosome 12p in cells of the body. Because the extra chromosome 12p is present in a mosaic pattern, this condition is referred to as a mosaic chromosomal abnormality.

PKS affects multiple systems in the body, including the heart, eyes, kidneys, and other organs. PKS is associated with a unique facial appearance, intellectual disability, seizures, and other health issues. Individuals with PKS have distinct facial features such as a high forehead, short nose, low-set ears, a small chin, and a cleft lip and/or palate. Vision difficulties such as microphthalmia or anophthalmia, which are underdeveloped or absent eyes, are also a feature of PKS.

PKS may also cause polydactyly, an extra finger or toe, or syndactyly, in which two or more fingers or toes are joined. The feet and hands may also have unusual creases, known as palmoplantar creases. There are other symptoms of PKS, which vary among individuals. These symptoms may include seizures, skeletal abnormalities, heart defects, hearing loss, and various other health issues.

To know more about chromosomal abnormalities, refer

https://brainly.com/question/2852863

#SPJ11

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Answers

The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.

In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.

In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.

The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.

It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.

For more such answers on RNA

https://brainly.com/question/13939644

#SPJ8

The nerve cells in a chef’s hand sense heat from a pan. The nerve cells send signals to the chef’s brain. The brain sends signals to the hand to release and drop the pan.

Answers

Answer:

We sense temperature in our environment through specialised nerve cells that project into the outer layers of the skin. These nerve cells are activated by high temperatures and capsaicin, the substance that makes chilli peppers hot. In response to a stimulus like heat or capsaicin, proteins on the surface of nerve cells called ion channels open up a channel that lets charged ions flow into the cell, setting off a nerve impulse. The impulse travels along sensory neurones to the spinal cord and then up to the brain, where it is interpreted as heat.

If you are looking for maximum strength and protection with the mat that you 1 point
use, what would be an appropriate choice?
O Lightweight One-ply board
4
OTwo-ply board
O Extra thick eight-ply board

Answers

Extra thick eight-ply board would be an appropriate choice.

What precisely is fabric?

The word "fabric" refers to cloth or other materials made by weaving together threads like cotton, nylon, wool, and silk. Clothes, drapes, and sheets are all made from fabrics.

If you want a mat that promotes the most strength and protection, choose one with a thick fabric, full-bodied fibres that are difficult to unravel, and high standard softness.

What are the various types of fabric?

Fabrics can be loosely categorised into synthetic fabrics and natural fabrics based on the kind of fibres they are created from. Natural materials include things like cotton, denim, wool, and silk.

To know more about cell visit:

brainly.com/question/30046049

#SPJ1

Complete question is-

If you are looking for maximum strength and protection with the mat that you 1 point

use, what would be an appropriate choice?

A) Lightweight One-ply board

B) Two-ply board

C) Extra thick eight-ply board

D) Three-Ply board

In the food web shown below, which of the organisms can be classified as a producer?

In the food web shown below, which of the organisms can be classified as a producer?

Answers

Answer: The plants

Explanation: Because the producers get their energy from sunlight

Answer:

Wheat; Plant; Flower (the bottom three)

Explanation:

Plants are producers that create their own food and are food for other organisms.

study island i got it right

molecular and neural adaptations to neuromuscular electrical stimulation: implications for ageing muscle

Answers

This study explores the molecular and neural adaptations that occur in response to neuromuscular electrical stimulation (NMES) and discusses their implications for aging muscle.

The study investigates the effects of neuromuscular electrical stimulation (NMES) on molecular and neural adaptations in the context of aging muscle. NMES involves the application of electrical impulses to muscles, which can enhance muscle activation and promote muscle strength and function.

The molecular adaptations refer to the changes that occur at the cellular and molecular levels in response to NMES. These adaptations can include alterations in gene expression, protein synthesis, and signaling pathways involved in muscle growth, repair, and remodeling. NMES has been found to stimulate the expression of specific genes and proteins associated with muscle regeneration and hypertrophy.

Neural adaptations, on the other hand, pertain to the changes that take place in the nervous system in response to NMES. NMES can improve neuromuscular coordination, motor unit recruitment, and neural activation patterns, leading to enhanced muscle control and performance. These neural adaptations are crucial in optimizing muscle function, particularly in individuals with age-related muscle decline.

Understanding the molecular and neural adaptations to NMES is important for addressing the specific challenges faced by aging muscle. With advancing age, there is a decline in muscle mass, strength, and function, which can contribute to functional limitations and increased risk of falls and injuries. NMES has been suggested as a potential intervention to mitigate these age-related changes by promoting muscle growth, improving neuromuscular function, and enhancing overall muscle performance.

To know more about neural adaptations  refer here

https://brainly.com/question/33732682#

#SPJ11

The differentiating solution in the Holzer method for glial fibers is:

Answers

The differentiating solution in the Holzer method for glial fibers is aniline-chloroform.

What is chloroform?

When you're dealing with chemicals like chloroform it helps to know that there are certain characteristics attached to it. These include being clear,colorless and having an almost sweet smell like ether. Chloroform also has density levels higher than water.

To produce this volatile chemical compound the formula CHCl3 comes in handy. The resulting product has many applications;from use as a precursor to refrigerants and PTFE to its potent anesthetic effects that have been classified as both euphoriant and sedative.

Learn about aniline here https://brainly.com/question/32134299

#SPJ4

2
The scientific names Ursus maritimus, Ursus arctos and Ursus americanus all have a common
name meaning...
They are closely related
They are distantly related
They have a distant but common ancestors
ОО
They are not related at all

Answers

I have have no Idea maybe they are closely related

Please only answer if you know the answer

I will follow back and give brainliest

Please only answer if you know the answerI will follow back and give brainliest

Answers

Answer:

one cell with two identical nuclei

Answer:

C: One cell with two identical nuclei.

Explanation:

Hope this helps!

:)

HELPPPPPP!
During which phase is the difference between animal and plant cell mitosis the most significant?
prophase
metaphase
anaphase
telophase
interphase

Answers

Answer:

Their main difference is how they form the daughter cells during cytokinesis. During that stage, animal cells form furrow or cleavage that gives way to formation of daughter cells. Due to the existence of the rigid cell wall, plant cells don't form furrows.

Explanation:

Which is a function of a protein macromolecule? A. Insulating organs in the body from harm B. Providing leaves with waterproofing C. Providing codes for bullding organs D. Transporting other molecules in the body​

Answers

D) Transporting other molecules in the body.

Explanation: The function of the protein macromolecule is to move things in and out of the cell and transport other molecules in the body.

Answer:

D is correct i just took the test

Explanation:

A grassland ecosystem experiences a long-lasting drought and unusually warm temperatures over several summer months.

Which statement explains the ,begin emphasis,most,end emphasis, likely effects of these changes on the grassland ecosystem during the drought?
Answer options with 4 options
A.
Increased temperatures will result in an increased variety of producer species.
B.
Increased temperatures will result in increased rates of photosynthesis in producers.
C.
Decreased rainfall will result in decreased competition among consumer species for food.
D.
Decreased rainfall will result in decreased diversity of consumer species due to less available food.

Answers

Decreased rainfall will result in decreased competition among consumer species for food.

The correct option is  C.

What is a ecosystem ?

An ecosystem is a region in which a bubble of life is created by plants, mammals, and other organisms interacting with the weather, environment, and other factors. Abiotic elements, or non - living things components, coexist with biotic components in habitats. Ecosystem functioning is the ability of natural phenomena and elements to either directly or indirectly meet human demands for commodities and services.

What is importance of ecosystem?

Human welfare and survival rely on healthy terrestrial ecosystems because they give us access to critical goods and benefits. More than 90% of our food originates from ecosystem types, which also offer us energy, resources for building and clothing, health-related products, fresh water, and pure air.

To know more about Ecosystem visit:

https://brainly.com/question/13979184

#SPJ13

A widespread population of the miniature burrowing pig (Microscrofus troglodytes) is thought to actually consist of smaller local breeding units either side of an ecotone. 120 individuals were sampled across this distribution and genotyped for the AbClocus. The results were as follows: Is this population in HWE? Test using the chi-square test. Show working. If not, how does it deviate from HW expectation? What is the result? Do the data support the original hypothesis? Can you think of any other explanation? How might you test your hypotheses further?

Answers

Answer:

Explanation:

To determine whether the population is in Hardy-Weinberg equilibrium (HWE) for the Ab locus, we need to compare the observed genotype frequencies with the expected frequencies under HWE assumptions. The expected genotype frequencies under HWE can be calculated using the allele frequencies observed in the population.

Let's assume that the Ab locus has two alleles, A and B. We'll denote the allele frequencies as p and q, respectively, and the expected genotype frequencies under HWE as p^2 (AA), 2pq (AB), and q^2 (BB).

Given the genotyping data, we can analyze the observed genotype frequencies and calculate the expected frequencies. Let's say we obtained the following counts:

AA: 45 individuals

AB: 60 individuals

BB: 15 individuals

To determine the allele frequencies, we can calculate the allele counts. Let's denote the frequency of allele A as p and allele B as q.

Count(A) = 2 * AA + AB = 2 * 45 + 60 = 150

Count(B) = 2 * BB + AB = 2 * 15 + 60 = 90

Total count = Count(A) + Count(B) = 150 + 90 = 240

p = Count(A) / Total count = 150 / 240 = 0.625

q = Count(B) / Total count = 90 / 240 = 0.375

Now, we can calculate the expected genotype frequencies under HWE:

p^2 = (0.625)^2 = 0.390625

2pq = 2 * 0.625 * 0.375 = 0.46875

q^2 = (0.375)^2 = 0.140625

To determine whether the population is in HWE, we can perform a chi-square test using the observed and expected genotype frequencies.

Observed:

AA: 45 individuals

AB: 60 individuals

BB: 15 individuals

Expected (calculated above):

AA: (0.390625) * 120 = 46.875

AB: (0.46875) * 120 = 56.25

BB: (0.140625) * 120 = 16.875

To conduct the chi-square test, we compare the observed and expected frequencies for each genotype and calculate the chi-square statistic:

Chi-square = Σ [(Observed - Expected)^2 / Expected]

Calculating for each genotype:

AA: [(45 - 46.875)^2 / 46.875] = 0.07602

AB: [(60 - 56.25)^2 / 56.25] = 0.26765

BB: [(15 - 16.875)^2 / 16.875] = 0.10741

Summing the values:

Chi-square = 0.07602 + 0.26765 + 0.10741 = 0.45108

Degrees of freedom (df) = Number of genotypes - 1 = 3 - 1 = 2

To determine whether the population is in HWE, we compare the chi-square statistic with the critical value from the chi-square distribution table for the given significance level and degrees of freedom. If the calculated chi-square value exceeds the critical value, we reject the null hypothesis of HWE.

Alternatively, we can use statistical software or an online chi-square calculator to obtain the p-value associated with the calculated chi-square value. If the p-value is below the chosen significance level (e.g., 0.05), we reject the null hypothesis.

Further analysis:

If the population is not in HWE, it suggests that there are deviations from the expected genotype frequencies. The deviations could indicate factors such as non-random mating, genetic drift, selection, mutation, or migration.

To explore the deviations further and understand the factors contributing to the population's deviation from HWE, additional investigations can be conducted. These might include:

1.  Investigating mating patterns: Assessing whether individuals are preferentially mating with individuals of certain genotypes or from specific breeding units.

2.  Genetic drift: Analyzing the population size and potential bottlenecks or founder effects that could contribute to deviations from HWE.

3.  Selection: Examining whether natural selection is acting on the Ab locus, leading to deviations from expected genotype frequencies.

4.  Mutation and migration: Assessing the potential impact of new mutations or migration from other populations on the observed genotype frequencies.

By conducting these additional investigations, we can gain a better understanding of the factors influencing the population's deviation from HWE and further test the original hypothesis.

which pathogen is one of the leading causes of foodborne illness? norovirus listeria monocytogenes campylobacter jejuni clostridium botulinum incorrect

Answers

Norovirus is one of the leading causes of foodborne illness. It is a highly contagious virus that can spread through contaminated food or water.

Symptoms of norovirus infection include nausea, vomiting, diarrhea, and stomach cramps. It is important to practice good hygiene and proper food handling to prevent the spread of norovirus.The leading cause of foodborne illness in the United States is norovirus. It is responsible for an estimated 19 to 21 million illnesses, 70,000 hospitalizations, and 800 deaths each year. Norovirus is a highly contagious virus that can cause vomiting, diarrhea, nausea, and stomach cramps. It is often spread through contaminated food or water, or through contact with an infected person.

It is important to practice safe food handling practices to help prevent foodborne illness.

Learn more about norovirus here:

https://brainly.com/question/31752800

#SPJ11

98.9 grams Na-
Convert to moles

Answers

Answer:

4.31877 moles

Explanation:

I believe its around 4.30 moles.

98.9g over 1 times 1 over 22.90 this is the molar mass of na= 4.31877  moles

Hope this helps!

Progesterone levels are highest during which phase of the ovarian and uterine cycles, respectively?
- luteal; secretory
- luteal; proliferative
- follicular; proliferative
- follicular; menstrual
- luteal; menstrual

Answers

Progesterone levels are highest during the luteal phase of the ovarian cycle and the secretory phase of the uterine cycle. So, the correct answer is: - luteal; secretory

In the ovarian cycle, the luteal phase begins after ovulation and lasts for approximately 14 days, during which the corpus luteum produces high levels of progesterone to prepare the uterine lining for potential implantation of a fertilized egg. Similarly, in the uterine cycle, the luteal phase follows the secretory phase and is characterized by high levels of progesterone that support the thickened uterine lining.

If implantation does not occur, progesterone levels drop, leading to the shedding of the uterine lining and the start of a new menstrual cycle.

To know more about Progesterone visit:-

https://brainly.com/question/12732603

#SPJ11

In no less than 300 words, summarize General Strain Theory, Social Control Theory, and Social Learning Theory. Provide an example for each.

Answers

General Strain Theory, Social Control Theory, and Social Learning Theory are among the leading criminological theories that explain criminal behavior, delinquency, and the reasons why people deviate from the social norm.

General Strain Theory(GST) is a sociological theory that asserts that individuals' strain or stress can lead to criminal behavior. According to GST, three sources of strain; failure, negative stimuli, and separation can contribute to an individual's deviant behavior.

Example: Suppose a person is looking for work but is continually refused because of his age. This may cause the person to feel frustrated and may lead him to engage in criminal behavior.

Social Learning Theory asserts that people learn to be violent or non-violent based on observation and modeling from their environment, and people in their social surroundings. The theory argues that people will engage in criminal behavior if they think the benefits outweigh the negative consequences. the theory also suggests that people are more likely to be violent if they feel their environment encourages it.

Example: A child might be exposed to a parent who uses violence as a means of problem-solving. They may grow up believing that violence is the only way to solve problems and begin engaging in violent behaviors themselves.

Social Control Theory argues that people do not commit crimes or deviant behavior because they fear the negative consequences of doing so and they are less likely to engage in deviant behavior as they have stronger ties to society.

Example: A person may choose not to engage in criminal behavior because they fear the punishment that may come with it.

In conclusion, these three theories attempt to explain criminal behavior and deviant behavior from different perspectives. While General Strain Theory argues that strain or stress leads to deviant behavior, Social Control Theory suggests that people will refrain from criminal activity because of the consequences. Social Learning Theory asserts that people learn from their environment and the people in it and may model or imitate their behavior.

Component of general strain theory: https://brainly.com/question/30565656

#SPJ11

Một đoạn phân tử DNA có 2200 nucleotide. Hãy cho biết đoạn DNA này dài bao nhiêu Å ? Biết một chu kì xoắn có 10 cặp nucleotide (nu), dài 34 Å.

Answers

Answer:

10 cm Tôi hy vọng điều này có thể giúp bạn

which choices describe a characteristics of a species that is likely to become invasive? select all that apply. responses reproduces rapidly reproduces rapidly thrives near human developments thrives near human developments tolerates a range of environments tolerates a range of environments highly specialized

Answers

The characteristics of a species that is likely to become invasive include reproduces rapidly, thrives near human developments, and tolerates a range of environments.

Highly specialized species are less likely to become invasive. A species that is likely to become invasive typically has the following characteristics: reproduces rapidly, thrives near human developments, and tolerates a range of environments. These traits enable the species to spread quickly, adapt to various conditions, and exploit resources in new areas, often outcompeting native species. Highly specialized species are less likely to become invasive due to their specific habitat requirements and limitations.

To know more about environments visit:

https://brainly.com/question/5511643

#SPJ11

Influenza is a bacterial infection whose symptoms include sore throat and fever. True or False

Answers

Answer: Im positive is true i hope this helps

Explanation: i leanded this last year

Other Questions
Han rides his bike for 50 miles over 4 hours.How long will it take him to ride 75 miles? Which three descriptions explain how people on the home front supported the war effort? find all relative extrema of the function. use the second derivative test where applicable. (if an answer does not exist, enter dne.) y = x2 log2 x If you stand on 38 degrees south latitude, in the eastern hemisphere, what continent are you standing on? This is the beginning of the end.Is this an example of an oxymoron or paradox?Explain your answer consider the diffraction pattern produced by illuminating a double slit. show answer no attempt if the spacing between the slits d is very large, what happens to the spacing between the zero intensity points? Which of the following explains why animals need more food when it is cold? please help, thank you so much! Complete the DFDs (Data Flow Diagram) for the Open Road Insurance Company including the Department of Motor Vehicles, Police Department, and Insurance Company. Assume the same ERD (Entity Relationship Diagram) given in the article. Consider a container holding 10 reactant particles and no product particles. Some reaction occurs creating the following mixtures. Calculate the value of Q for each mixture and drag your answers into the correct boxes. The reaction is: R(g) -> P(g) Mixture Q Drag These 9 reactants, 1 products 5 1 0.45 8 reactants, 2 products 0.11 4 1111 5 reactants, 5 products 0.25 6 2 reactants, 8 products Reset Submit mi mama es A. bonito B. bonitos C. bonita D. bonitas When using MakeCode Arcade, what is the easiest way to make modules?A. By incorporating an if-then statementB. By creating functionsC. By adding an event handlerD. By directing a new control structure The difference between autobiography and memoir is zachary invests $400 into an account that earns 3.5% simple interest for 5 years. he does not make any other deposits or withdrawals. at the end of 5 years, zachary invests the entire account balance into a different account that earns 5% simple interest. he leaves the money in the account for 2 years without making any additional deposits or withdrawals. what is the new account balance at the end of 2 years? drag and drop values into the boxes to correctly complete the statements. put responses in the correct input to answer the question. select a response, navigate to the desired input and insert the response. responses can be selected and inserted using the space bar, enter key, left mouse button or touchpad. responses can also be moved by dragging with a mouse. zachary invests $response area into the account that earns 5% simple interest. at the end of 2 years, the account balance is $response area. There are 100 Takis in a 20 oz bag. Which proportion is written correctly so that you can find thenumber of Takis in a 7 oz bag? 19. Which of the following do NOT involve the movement of molecules from an area of higherconcentration to an area of lower concentration? (1 point)O osmosisO facilitated diffusionO diffusionO bulk transport _____ are small groups that range from 2 to about 12 individuals and average about 5 or 6 individuals. what structure should be projected within the shadow of the foramen magnum on a well positioned ap axial (towne) projection radiograph of the skull? On December 2, Coley Corporation acquired 2,000 shares of its $4 par value common stock for $21 each.On December 20, Coley Corporation resold 1,600 shares for $13 each. Which of the following is correct regarding the journal entry for the resold shares?a) Credit Treasury Stock $33,600b) Debit Cash $26,000c) Credit Additional Paid-in Capital $14400d) Credit Treasury Stock $20,800 RETURN ON INVESTMENT IN THE REALM OF QUALITY DENOTES THE RATIO OF _____TO ____ RESULTING FROM THE IMPROVEMENT INITIATIVESCosts; benefitsEfforts, resultsBenefits, costsProfits; investments