1

The gummy bears not placed in water or salt water serves as a control for comparison.


True

False


2

A gummy bear placed in salt water swells (becomes larger) since the salt enters the gummy bear.


True

False


3

Diffusion is defined as the movement from an area of high concentration to low concentration.



True

False

Answers

Answer 1

1. True
The statement is True. The gummy bears not placed in water or salt water serves as a control for comparison. 2. TrueA gummy bear placed in salt water swells (becomes larger) since the salt enters the gummy bear.

3. TrueDiffusion is defined as the movement from an area of high concentration to low concentration.More than 100 refers to any number greater than 100. It could be 101, 300, 5,000, and so on. It is a general statement that specifies that the number is more than a hundred, indicating that the number could be any value that is greater than 100.

To know more about movement visit:

https://brainly.com/question/11223271

#SPJ11


Related Questions

Question 14 (2 points) The process of evolution that involves a change in the DNA sequence that leads to evolutionary change is called natural selection. O mutation. genetic drift. migration.

Answers

The process of evolution that involves a change in the DNA sequence that leads to evolutionary change is called a mutation.

A mutation is a sudden and lasting alteration in the DNA sequence that can influence genetic variation. Changes in the DNA sequence can influence phenotype, which may or may not have an effect on an organism's fitness. Mutations occur spontaneously, either from errors in DNA replication or from exposure to mutagenic agents. Mutations may happen in either coding or non-coding regions of the DNA, and they can be either silent or expressed.

Evolution is a natural process that results in the gradual change of inherited characteristics in populations over generations. It is the process of alteration in the inherited characteristics of species over successive generations. In other words, it is the process of gradual changes that happen to species over time as they adapt to their environments. It can be defined as a change in the gene frequency in a population over time.

Types of Evolution 1. Natural Selection 2. Genetic Drift 3. Gene Flow 4. Mutation 5. Non-Random Mating 6. Admixture 7. Mutation Pressure 8. Genetic Draft 9. Bottleneck and Founder Effect 10. Sexual Selection the process of evolution that involves a change in the DNA sequence that leads to evolutionary change is called a mutation.

To learn more about DNA sequence here

https://brainly.com/question/31650148

#SPJ11

29.
In the dihybrid cross AaBb aabb, how many heterozygotes for both gene pairs are found among the F1 offspring?
A)
one
B)
two
C)
three
D)
four
E)
five

Answers

In a dihybrid cross, two traits are studied simultaneously. In this case, the two traits are A and B. The parental generation is AaBb aabb.

When these gametes combine, they produce an F1 generation with the genotype AaBb. The question is asking how many heterozygotes for both gene pairs are found among the F1 offspring. Heterozygotes have two different alleles for a particular gene, while homozygotes have two identical alleles. In this case, the F1 offspring are heterozygous for both genes, so the answer is D) four. This is because each parent is heterozygous for both genes, so all of the offspring inherit one dominant and one recessive allele for each gene. Therefore, all of the F1 offspring are heterozygotes for both gene pairs.

TO know more about homozygotes refer :

https://brainly.com/question/29455764

#SPJ11

which of the following is most closely related to the unique density patterns of water described?

Answers

Answer: Actually, the exact density of water is not really 1 g/ml, but rather a bit less (very, very little less), at 0.9998395 g/ml at 4.0° Celsius (39.2° Fahrenheit).

Explanation: Its hydrogen bonding causes its many unique properties, such as having a solid form less dense than its liquid form, a relatively high boiling point of 100 °C for its molar mass, and a high heat capacity. is a constant, so their respective concentrations are inversely proportional to each other.

Actually, at 4.0 degrees Celsius (39.2 degrees Fahrenheit), water has a density of 0.9998395 g/ml, which is very, very slightly less than 1 g/ml. Its numerous distinctive characteristics.

What is Density patterns?

A solid form that is less dense than its liquid form, a comparatively high boiling point of 100 °C for its molar mass, and a high heat capacity, are all brought about by its hydrogen bonding.

The density equation is straightforward: Take the mass of an item with uniformly distributed material.

A substance's density is a measurement of how heavy it is in relation to its size. When placed in water, an object will float if its density is lower than that of the water, whereas it will sink if its density is higher. The density of a material is a distinguishing quality that is independent of the substance's volume.

Therefore, Actually, at 4.0 degrees Celsius (39.2 degrees Fahrenheit), water has a density of 0.9998395 g/ml, which is very, very slightly less than 1 g/ml. Its numerous distinctive characteristics.

To learn more about Density, refer to the link:

https://brainly.com/question/29775886

SPJ2

a football player received the bad news that he tore his anterior cruciate ligament. what does this mean for the range of motion of his knee?a football player received the bad news that he tore his anterior cruciate ligament. what does this mean for the range of motion of his knee?his knee will exhibit more extension and hyperextension by shifting the tibia too far anteriorly on the femur.he will have difficulty bending the knee and it will allow too much lateral movement.he will not be able to straighten his knee and will suffer a disabling injury.his knee will exhibit more flexion and his tibia may dislocate from the femur posteriorly.

Answers

The torn anterior cruciate ligament (ACL) in the football player will result in a limited range of motion for his knee. Specifically, the knee will exhibit **more flexion** and there is a possibility that the tibia may dislocate from the femur posteriorly.

The ACL is an important ligament that helps stabilize the knee joint and prevents excessive forward movement of the tibia relative to the femur. When the ACL is torn, the knee loses its stability, and as a compensatory mechanism, the player may tend to limit extension and hyperextension movements. Instead, the knee will exhibit more flexion. Additionally, the lack of ACL support increases the risk of the tibia dislocating from the femur posteriorly, which can further impair the range of motion and cause significant discomfort. Rehabilitation and, in some cases, surgical intervention are often required to restore knee stability and function.

Learn more about anterior cruciate ligament (ACL) here:

https://brainly.com/question/3147393

#SPJ11

Why is a lake considered to be a natural ecosystem? ​

Answers

Answer:

Lake is an ecosystem where living organisms grow, reproduce and interact among each other as well as with abiotic components and carry out other activities in nature by themselves without any human interference, therefore it is referred to as a natural ecosystem.

Answer:

Because a lake is a self sustaining system detailed

Answer: A lake ecosystem includes biotic living plants animals and micro-organisms as well as abiotic non-living physical and chemical interactions.

When an enzyme is outside the temperature range, pH range, or both in which it normally functions, what happens to cause it to no longer work as expected? Explain your answer in terms of the enzyme's ability to bind to its substrate.

Answers

Answer:

The increase in temperature reflects an increase in the kinetic energy of the molecules, which favors the collision between the enzyme and substrate molecules. If the optimum pH changes, the conformation of the enzyme is altered and the substrate cannot enter its active site.

Explanation:

The relationship between pH and activity depends on the acid-base behavior of the enzyme and the substrate itself. Substrate and enzyme (active center) can contain acidic and basic functional groups, their degree of dissociation being dependent on pH, which will determine, among other aspects, the conformation of the protein, the binding capacity of the substrate to the active center of the enzyme and the transformation capacity of the substrate. The rate of an enzymatic reaction varies with increasing temperature. Such dependence reflects a double effect of temperature: positive at low values, due to the general increase that the speed of any chemical reaction experiences as temperature increases, and negative at high values, due to the thermal denaturation of the enzyme. That is, the speed of an enzymatic reaction increases as the temperature increases within a certain range, reaching a maximum value at the so-called optimal temperature. At higher values ​​the activity decreases because the enzyme, like any other protein, undergoes denaturing processes and, therefore, inactivation.

What do we call the state in a human body if cerebreum is not functioning well?​

Answers

Answer:

vegetative state

A vegetative state occurs when the cerebrum (the largest part of the brain) is severely damaged (making mental function impossible), but the reticular activating system is still functional (making wakefulness possible).

Answer:

hope my answer helps you mark me brianliest

Explanation:

A vegetative state occurs when the cerebrum (the largest part of the brain) is severely damaged (making mental function impossible), but the reticular activating system is still functional (making wakefulness possible).Damage to the cerebellum can lead to: 1) loss of coordination of motor movement (asynergia), 2) the inability to judge distance and when to stop (dysmetria), 3) the inability to perform rapid alternating movements (adiadochokinesia), 4) movement tremors (intention tremor), 5) staggering, wide based walking (ataxic gait ...The cerebellum coordinates voluntary movements such as posture, balance, coordination, and speech, resulting in smooth and balanced muscular activity. It is also important for learning motor behaviors.

2 Which substance, needed for protein synthesis, is carried into a leaf from the stem? A carbon dioxide B nitrate C oxygen D starch​

Answers

The substance, needed for protein synthesis, that is carried into a leaf from the stem is nitrate. Nitrate is an essential nutrient that plants use to produce amino acids and proteins. It is a part of the nitrogen cycle and is used in chloroplasts to create essential proteins.Option B is correct

The process of protein synthesis takes place in chloroplasts of the leaves of plants where nitrogen, along with other elements, is utilized to produce proteins. Nitrogen, in the form of nitrate, is an essential element required by the plant for the synthesis of amino acids and proteins.

Plants obtain nitrate through the soil from the water they absorb through their roots. It is transported from the roots to the leaves through the xylem vessels, which form a continuous pipeline from the roots to the stem and leaves of the plant. The process of protein synthesis is important for the growth and development of plants.

It is essential for the production of enzymes, hormones, and structural components such as cell walls and membranes. Nitrate is, therefore, a critical substance for protein synthesis and the growth and development of plants. Option B is correct

For more such questions on nitrate

https://brainly.com/question/28884348

#SPJ8

I need help doing this. I don’t understand how. There’s this website it’s on and I only found the blank copy

I need help doing this. I dont understand how. Theres this website its on and I only found the blank

Answers

Transcription and translation are two events involved in protein synthesis. Normal: mRNA: CCCGAAGAAAAA. tRNA: GGGCUUCUUUUU. Protein: Pro-Glu-Glu-Lys. cell shape: Rounded. Sickle: mRNA: CCCGUUGAAAAA. tRNA: GGGCAACUUUUU. Protein: Pro-Val-Glu-Lys. Blood cell shape: Concaved

What are transcription and translation?

Transcription and translation are two processes involved in protein synthesis.

Transcription occurs first in the nucleus. During this event, mRNA is synthesized by copying a segment of the DNA molecule. The template DNA strand is used to pair its nucleotides and grow the new mRNA strand.

Translation occurs in the cytoplasm. During this event, the protein is grown by reading the mRNA codon sequence. tRNA, associated with rRNA, recognizes the codons and adds the correct amino acid to the new growing polypeptide.

Normal hemoglobin

DNA: GGG CTT CTT TTTmRNA: CCC GAA GAA AAAtRNA: GGG CUU CUU UUUProtein: Pro-Glu-Glu-LysBlood cell shape: Rounded

Sickle hemoglobin

DNA: GGG CAA CTT TTTmRNA: CCC GUU GAA AAAtRNA: GGG CAA CUU UUUProtein: Pro-Val-Glu-LysBlood cell shape: Concaved

You can learn more about transcription and translation at

https://brainly.com/question/30166840

#SPJ1

ILL GIVE BRAINLIEST. plsss help asap

ILL GIVE BRAINLIEST. plsss help asap

Answers

Answer:

Without living space, the owl will not be able to reaise their young I belive.

Explanation:

As you know owls always decided to ret on tree ranches thats also where they lay there nest and raise their children. if im wrong im so sorry

Answer: without living space the owls will not be able to raise their young

Explanation: hope this helps

_____ cues are powerful depth cues that are available from the image in one eye.

Answers

Monocular cues are powerful depth cues that are available from the image in one eye.

Monocular cues provide depth information based on the visual input received by a single eye. These cues can help us perceive depth and three-dimensional (3D) space in our visual environment. Some examples of monocular cues include:

Linear perspective: Parallel lines that recede into the distance appear to converge, giving a sense of depth and distance.

Relative size: Objects that are closer to us appear larger, while objects that are farther away appear smaller.

Overlapping (occlusion): When one object partially covers another, the occluded object is perceived as being farther away.

Texture gradient: The texture of objects appears denser and more detailed when they are closer, while it becomes less detailed and more compressed as objects recede into the distance.

Shading and shadows: The presence and direction of light and shadows can provide cues about the position and depth of objects.

Motion parallax: When we are moving, objects that are closer to us appear to move faster than objects that are farther away, giving a sense of depth and relative distance.

These monocular cues help our brain interpret the two-dimensional image projected onto the retina and create a perception of depth and spatial relationships. They are particularly important when viewing images or scenes with one eye, as they provide valuable depth information in the absence of binocular cues, which rely on the comparison of visual input from both eyes.

Here you can learn more about monocular cues

https://brainly.com/question/30639088#

#SPJ11  

What are the 4 components of plasma membrane?

Answers

Answer:

Carbohydrates, cholesterol, proteins, and phospholipids.

Explanation:

The phospholipids form the bilayer. Carbohydrates are chains that are found on the cell membrane that recognize harmful cells. Proteins act as transporters, moving ions and molecules across the membrane. Cholesterol changes the structure of biological membranes, by changing the thickness, fluidity, water entering etc.

I hope this helps :)

These four elements cooperate to keep the plasma membrane's structure and functionality intact, enabling the selective passage of molecules into and out of the cell. The plasma membrane's four primary parts are as follows:

Phospholipids: These are the most abundant molecules in the plasma membrane and they form a lipid bilayer that serves as a barrier between the inside and outside of the cell. Proteins: These are embedded in the lipid bilayer and have various functions, such as acting as channels for the movement of ions and molecules, serving as receptors for signaling molecules, and providing structural support. Carbohydrates: These are attached to the proteins and lipids on the outer surface of the membrane and play a role in cell recognition and communication. Cholesterol: This molecule is found in the lipid bilayer and helps to regulate the fluidity and stability of the membrane.

For more such questions on plasma membrane

https://brainly.com/question/734740

#SPJ11

locate the bifurcation values for the one-parameter family and draw the phase lines for values of the parameter slightly smaller than, slightly larger than, and at the bifurcation values. 1. dy/dt=y^2 +a

Answers

The given differential equation is:dy/dt = y² + The bifurcation value is the value of a for which the number and stability of equilibrium solutions change.

The equilibrium solution is given by the equation:dy/dt = 0⇒ y² + a = 0⇒ y = ± √(- a)

So, the equilibrium solutions are y = + √(- a) and y = - √(- a).

The sign of the root is determined by the initial conditions and the direction of the phase line.

The bifurcation occurs when a = 0. When a < 0, there are two real equilibrium points.

When a > 0, there are no real equilibrium points, but the phase line has two directions of arrows going toward infinity.

When a = 0, there is only one equilibrium point at y = 0. At this point, the direction of arrows on both sides of the equilibrium is towards the equilibrium.

Thus, the bifurcation values for the one-parameter family are a = 0.

To learn more about bifurcation value here

https://brainly.com/question/33109660

#SPJ11

To differentiate iron deficiency anemia from beta thalassemia (β+β), which of the following sets of tests would be of the most benefit: iron studies, reticulocyte count red cell indices, hemoglobin electrophoresis red cell indices, reticulocyte count iron studies, red cell count iron studies, hemoglobin electrophoresis

Answers

To differentiate between iron deficiency anemia and beta-thalassemia (β+β), the sets of tests that would be of the most benefit is iron studies, red cell count. Thus, option D is correct.

Iron studies, including serum iron, ferritin, and total iron-binding capacity (TIBC), provide valuable information about iron levels and storage in the body. In iron deficiency anemia, these tests would show low serum iron, low ferritin, and high TIBC.

Conversely, in beta-thalassemia, iron studies would typically show normal to high serum iron, normal to high ferritin, and normal TIBC. Red cell count helps evaluate the number of red blood cells in the body. In iron deficiency anemia, it is usually decreased due to reduced production.

However, in beta-thalassemia, the red cell count is often normal or increased as a compensatory mechanism for the decreased lifespan of red blood cells.

While other tests like hemoglobin electrophoresis and red cell indices can also provide information, they are not as specific for distinguishing between iron deficiency anemia and beta-thalassemia. Hemoglobin electrophoresis can detect abnormal hemoglobin variants seen in beta-thalassemia but is not specific to differentiating it from iron deficiency anemia.

In conclusion, the most beneficial set of tests for differentiating iron deficiency anemia from beta-thalassemia (β+β) is iron studies, red cell count. These tests provide valuable insights into iron levels, storage, and red blood cell count, allowing for a more accurate diagnosis. Thus, option D is correct.

To know more about anemia refer here:

https://brainly.com/question/29343209#

#SPJ11

what is a hybrid cross between a domestic cow and an american bison called?

Answers

The term hybrid refers to an offspring that has been produced through the breeding of two different species, varieties, or subspecies.

When it comes to hybridization between a domestic cow and an American bison, the resulting offspring is known as a Beefalo.The Beefalo is a hybrid breed of cattle that is primarily raised for its meat production. It is a cross between the domestic cattle and the American bison.

Beefalos are typically larger than the bison but smaller than the domestic cattle. They are known for their hardiness, resistance to disease, and their ability to survive in harsh environments.The breed is a cross of the American bison and the domestic cow.

The term "Beefalo" is usually used to refer to crossbreeds of domestic cattle and American bison, although "bison-cattle hybrids" have also been used.

They were first created in the United States in the early 20th century by breeding bison with domestic cattle in an attempt to create an animal that was hardier and more resistant to disease than domestic cattle, while still providing beef of high quality.

To know more about crossbreeds, visit

https://brainly.com/question/30327480

#SPJ11

Suppose a person uses a microscope to look at a cell from the leaf of a tree.


Which structure would they see that would not be found in a cell from a fingernail?



ribosomes



chloroplasts



cilia



mitochondria


do not put a link

Answers

Answer:

chlooplast

Explanation:

because those are the ones that are only in plants and they make photosynthesis

The answer is chloroplast.

Disinfection is important in killing any remaining bacteria or pathogens in the wastewater. True False

Answers

Answer:

True

Explanation:

It is typically a final step to remove organisms from the treated water before the effluent is released back into the water system. Disinfection prevents the spread of waterborne diseases by reducing microbes and bacterial numbers to a regulated level.

Disinfectants are used to rapidly kill bacteria. They kill off the bacteria by causing the proteins to become damaged and the outer layers of the bacteria cell to rupture. The DNA material subsequently leaks out.

Disinfection is the process designed to kill or inactivate most microorganisms in wastewater, including essentially all pathogenic organisms. Contrast this to sterilization, which is the removal and destruction of all living microorganisms, including pathogenic and saprophytic bacteria, vegetative forms and spores.

A change in _____________ and _____________ cause the enzyme to denature.


A:Temp, PH
B: substrate, catalyst
C: temp, product
D: chemical, substance

Answers

Answer:

C hope this helped

Explanation:

temp, product

Explanation:

Temperature and product

Which vein lies lateral to the median cubital vein when the body is in the anatomical position?

Answers

The vein that lies lateral to the median cubital vein when the body is in the anatomical position is the cephalic vein. The cephalic vein is one of the major veins of the upper limb.

It is located on the lateral side (towards the thumb side) of the arm. In the anatomical position, the median cubital vein runs between the cephalic vein and the basilic vein, which is located on the medial side (towards the pinky side) of the arm. So, to recap, the cephalic vein is the vein that lies lateral to the median cubital vein when the body is in the anatomical position.

The cephalic vein starts from the dorsal venous network of the hand and travels along the lateral side (thumb side) of the forearm. It then continues upward along the anterolateral aspect of the arm, running parallel to the biceps muscle. It receives tributaries from various veins, including the dorsal venous network, radial vein, and median cubital vein.

To know more about Cephalic Vein visit:

https://brainly.com/question/31722018

#SPJ11

I NEEED HELP AS QUICK AS POSSIBLE!!!

I NEEED HELP AS QUICK AS POSSIBLE!!!

Answers

Answer:

It will maybe be B or CCuase ik it's not A or D

an increased rate of breathing as a result of an increased buildup of carbon dioxide in the bloodstream would be an example of:

Answers

Is hypercapnia a option? From what I know that’s what I would say.

Dna polymerase is most active during which phase of the cell cycle?.

Answers

Answer:

yes it is. That is because DNA has a definite purpose. and is most active during when it is in the important phase.....

the cell cycle

What would happen to the moose population if the wolves were removed?

What would happen to the moose population if the wolves were removed?

Answers

Answer:

Moose would go unchecked and increase to a point and then decrease due to other limiting factors.

Answer:increase than decrease due to a limit of factors.

Explanation:

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Answers

The sequence of RNA codons resulting from the substitution mutation that changed the 5th base in the DNA from a C to a T is AUGUGCGUUAUCCAGGGUAGCCAAUUGA.

In DNA, the base C (cytosine) pairs with G (guanine), while in RNA, the base C pairs with G. However, due to the substitution mutation, the original C is replaced by a T (thymine) in the DNA sequence.

In RNA, thymine is replaced by uracil (U). Therefore, the RNA codons corresponding to the mutated DNA sequence can be derived by replacing each T with U and maintaining the sequence order.

The original DNA sequence TACACGCAATTACCAGGGTAGCCATTGATT would have the corresponding RNA codons AUGUGCGUUAUCCAGGGUAGCCAAUUGA. Each codon consists of three bases and represents a specific amino acid or a start or stop signal in the translation process of protein synthesis.

It's important to note that the given DNA sequence is provided as a single continuous string, and without additional information about the reading frame or specific gene sequence, it is not possible to determine the precise protein sequence or the functional implications of the mutation.

For more such answers on RNA

https://brainly.com/question/13939644

#SPJ8

Please I beg you help me. Compare solids,liquids, and gases on the molecular level

Answers

Gases, liquids and solids are all made up of atoms, molecules, and/or ions, but the behaviors of these particles differ in the three phases. ... gas are well separated with no regular arrangement. liquid are close together with no regular arrangement. solid are tightly packed, usually in a regular pattern.

Answer:

The compression of solids is difficult, liquids are nearly incompressible but gases can be easily compressed.

Explanation:

molecular arrangements of solids is regular and close, but liquids have irregular and sparse molecular arrangement. Gases too also have more random and sparse arrangements of molecules.

Which term describes the number of different species in an area?
Responses

A. Ecosystem

B. Habitat

C. Biodiversity

D. Biome

Answers

Answer:

Biodiversity

Explanation:

Biodiversity is the variety of life in a habitat or ecosystem

which of the following does not describe the secondary structure of dna as proposed by watson and crick? group of answer choices the two strands of the double helix are stabilized by hydrogen-bonding between a and t and between g and c the base pairs are stacked on one other with their planes at 180 degree to the helix axis. the two strands of the double helix run in opposite directions the distance between the 1' carbons of the deoxyribose units is the same between the a-t and the g-c base pair the phosphate deoxyribose backbones of the helix are on the outside.

Answers

Option B: the base pairs are stacked on one other with their planes at 180 degrees to the helix axis, does not describe the secondary structure of DNA proposed by Watson and Crick.

James D. Watson and Francis H. C. Crick first postulated the three-dimensional structure of DNA in 1953. It is made up of two lengthy helical strands that are wound around a common axis to form a double helix. The two biopolymer strands that make up each DNA molecule coil around one another. Each strand has a 3′end and a 5′end containing a phosphate group (with a hydroxyl group).

Because the strands are antiparallel, one runs in a 5′ to 3′ direction and the other in a 3′ to 5′ direction. The double helix has a diameter of 2 nm and repeats every 3.4 nm, or 10 base pairs, which is the size of a base pair. Hydrogen bonds hold the two strands together and allow them to complement one another.

To know more about DNA structure, refer:

https://brainly.com/question/10842214

#SPJ4

Complete and correct question is:

Which of the following does not describe the secondary structure of DNA as proposed by Watson and Crick? group of answer choices

the two strands of the double helix are stabilized by hydrogen-bonding between a and t and between G and C

the base pairs are stacked on one other with their planes at 180 degrees to the helix axis.

the two strands of the double helix run in opposite directions.

the distance between the 1' carbons of the deoxyribose units is the same between the a-t and the g-c base pair.

the phosphate deoxyribose backbones of the helix are on the outside.

Genetic information is stored in which type of macromolecule?
a. nucleic acid
b. carbohydrate
C. lipid
d. protein

Answers

Nucleic acid, such as DNA and RNA

identify the following effects of agricultural production as biological or nonbiological. 1. organized warfare - Interpersonal violence has a long history going back at least to Neandertals. But the level of violence in pre-Holocene hominins was nothing compared with the organized warfare of early civilizations competing for resources.
2. business and technology - Organized farming created a stratified society where some did not have to work as much or at all in the fields, leaving them available for other pursuits.
3. writing and art - Organized farming created a stratified society where some did not have to work as much or at all in the fields, leaving them available for other pursuits.
4. jaw reduction - This is a biological effect of agricultural production. As humans chewed softer food, the demand on the jaw was lessened.

Answers

Organized warfare, business and technology, and writing and art are nonbiological effects of agricultural production, while jaw reduction is a biological effect.

1. Organized warfare is a nonbiological effect of agricultural production. The need to protect crops and territory from neighboring civilizations led to the development of organized warfare, which was fueled by the desire for resources and land. This resulted in increased violence and aggression among humans and ultimately changed the social and cultural fabric of early civilizations.

2. Business and technology are nonbiological effects of agricultural production. The organization and specialization of labor that came with the rise of agriculture led to the development of complex economic systems and technological innovations such as irrigation and plowing. This allowed for increased production and distribution of goods, as well as the creation of new forms of wealth and social stratification.

3. Writing and art are nonbiological effects of agricultural production. With the development of agriculture, some members of society had the freedom to pursue other interests, such as writing and art. This resulted in the creation of written language and the development of artistic traditions, which helped to preserve cultural knowledge and promote social cohesion.

4. Jaw reduction is a biological effect of agricultural production. The transition to a softer, more processed diet resulted in a decrease in the size of human jaws over time. This is a physical adaptation that is still observable today and reflects the long-term impact of changes in diet and lifestyle that came with the rise of agriculture.

For more about Organized warfare:

https://brainly.com/question/30006265

#SPJ11

What are three factors that limit a population's ability to adapt and survive?

Answers

Answer:

Not enough time, Not possible, Not enough variation

Explanation: I am 100% sure this is the answer i have looked it up multiple times. good luck, and hope this helps...

Other Questions
When finding the mean, or average, of a set of numbers you divide the sum of thegroup of numbers by the number of items in the group.What is the average height for the 3 trials listed below?6 cm4 cm2 cm12 cm6 cm2 cm4 cm if alice lives near a cattle plant, she probably doesn't notice the neighborhood smell that visitors to her house complain about. what idea explains this phenomenon? What is the value of m in this proportion? 1/2/3/5= 1/3m Enter your answer as a fraction in simplest form in the box. m= 16. If a triangle has two side lengths of 8 inches and 23 inches, describe the possible lengths for the thirdside? writing with gustar a company transferred completed goods from the assembly department to finished goods inventory. the goods cost $271,200. the journal entry to record this production activity includes a: What i one central idea of Tecumeh peech? Indigenou people do not believe in igning any treatie. Indigenou people hope to retore their trut in White ettler. Harrion hould top holding council without getting input from Indigenou people. Harrion hould top taking land from Indigenou people and hould return what wa taken Stock A has a required return of 19 percent. Stock B has a required return of 11 percent. Assume a risk-free rate of 4.75 percent. Which of the following is a correct statement about the two stocks? Stock A is riskier. Stock B is riskier. The stocks have the same risk. We would need to know if the markets are efficient to answer this question Variable costs of glass production are proportional to energy costs.Assume the following production data of a typical glass factory. For simplicity, assumeenergy costs cover 50% of variable costs.Productionquantity(thousand tons)600Energycosts(C/ ton)1.806102.106202.406302.706403.006503.306603.606703.906804.206904.50 The vertices of a rectangle are at (-1, -5). (3, -5), (3, - 7), and (-1, -7) What is the length of the shorter side of the rectangle? Enter your answer in the box. __Units please help me on this question and I will give u brain list. The _________ is a large structure that directs the cell's activities. (please help me) which of the following is true for normal distributions? group of answer choices kurtosis is always less than 1 the range of the random variable is bounded the mean, mode, and median are all equal skewness is always greater than 1 The image shows a city map.An electronic tablet shows a map to a destination.What is the purpose of this map?to compare US state capitalsto indicate the boundaries of citiesto provide travel directions to a locationto learn about an areas natural resources Find the voltage Vg on the gate of the NMOSFET that will make the voltage Vx=10mV, when Vd=20mV. Assume the NMOSFET is in the deep triode region. The NMOSFET has the following characteristics: n Cox=200uA/V2 Vth=0.5 V W/L=10/1.0 Im really need help English is not my strong suit, so if you can please help me out ASAP A male with the condition has four children with a female who is a carrier. What are the expected genotypic and phenotypic ratios of the offspring? Include a Punnett square to support your answer. In pea plants the Y allele encodes the yellow seed color and is dominant over the y allele that encodes the green seed color. The R allele encodes the round seed shape and is dominant over the r allele that encodes the wrinkled seed shape. What would be the phenotypic ratio of offspring from a YYRr x YyRr cross A dog is leashed to the corner of a house with a 14 foot leash. How much running area does the dog have? Round your answer to the nearest square footThe dog has aboutsquare feet of running area. Should fresh fish be stored on ice?