18 yo M presents with pain in the
interphalangeal joints of both hands. He also has scaly, salmon-pink lesions on the extensor surface of his elbows and knees. What the diagnose?

Answers

Answer 1

Based on the symptoms presented, the most likely diagnosis for the 18-year-old male is psoriatic arthritis. Psoriatic arthritis is a type of inflammatory arthritis that affects people with psoriasis, a skin condition that causes scaly, red patches on the skin.

The condition can cause pain, stiffness, and swelling in the joints, including the interphalangeal joints of the hands. In addition, the scaly, salmon-pink lesions on the extensor surface of the elbows and knees are also characteristic of psoriasis. Psoriatic arthritis can affect any joint in the body, but it most commonly affects the joints of the fingers and toes. Treatment options may include medication to reduce inflammation and manage symptoms, as well as lifestyle changes to improve overall health and well-being. It is important to seek medical attention and receive a proper diagnosis and treatment plan.

Learn more about arthritis here:

brainly.com/question/28275647

#SPJ11


Related Questions

which of these is not one of the dsm-5 criteria for insomnia disorder? sleep disruption causes distress or diminished everyday functioning occurs in combination with other mental disorders occurs during at least three consecutive months feeling unsatisfied with amount or quality of sleep.

Answers

Symptoms: Trouble falling asleep.frequent awakenings or trouble falling back asleep following awakenings are symptoms of difficulty maintaining sleep.

What are the DSM-5 criteria for insomnia?According to the DSM-5, insomnia is defined as a lack of sleep or poor quality sleep accompanied by one (or more) of the following symptoms:sleep initiation is difficult.an issue with sleep maintenance marked by frequent awakenings or trouble falling back asleep after awakenings.Ten disorders or disorder groups are included in the classification: narcolepsy, hypersomnolence disorder, breathing-related sleep disorders, circadian rhythm sleep disorders, non-REM (NREM) sleep arousal disorders, nightmare disorders, REM sleep behavior disorders, restless legs syndrome, and substance use disorders.But there are more categories that apply to insomnia:Primary insomnia is insomnia that does not have another underlying medical condition.

To learn more about insomnia disorder refer

https://brainly.com/question/13025993

#SPJ4

A nurse is caring for a client prescribed an aquathermia pad. what should the nurse monitor this client for during therapy?

Answers

A nurse caring for a client prescribed an aquathermia pad should ask the client to report if the aquathermia pad gets too warm.

The nurse should check the client's leg every 15 to 20 min after applying the aquathermia pad to ensure there are no complications. The nurse should ensure that the client's call light is in reach. If the client's skin shows increased redness nurse should discontinue using the aquathermia pad.

Aquathermia pads are electrical devices. Aquathermia pads contain fluid-filled tubes or coils that circulate warm water through the pads which conduct heat to the applicant's body to soothe and relax sore muscles, joints and ligaments.

To learn more about ligaments here

https://brainly.com/question/28138319

#SPJ4

Question 32 Which is NOT true about the health benefits of orgasm? (select the FALSE answer) Women who orgasm more than 5 times a week are at risk for menstrual cycle abnormalities due to oxytocin hormone An orgasm once or twice a week strengthens the immune system Men who have five or more ejaculations per week during their 20s have a significantly lower risk of prostate cancer later in life Men who have at least three orgasms per week are 50% less likely to die of heart disease.

Answers

The FALSE statement is "Women who orgasm more than 5 times a week are at risk for menstrual cycle abnormalities due to oxytocin hormone." Option 1 is correct.

Oxytocin hormone is released during orgasm and has various health benefits, including reducing stress and improving social bonding. Women who orgasm frequently do not have an increased risk of menstrual cycle abnormalities due to oxytocin hormone. In fact, regular orgasms can help regulate menstrual cycles and improve sexual health. The other statements are true and backed by scientific research.

Orgasms have been shown to strengthen the immune system, reduce the risk of prostate cancer, and lower the risk of heart disease in men. It is important to note that individual experiences may vary and that the health benefits of orgasm may be influenced by various factors such as age, health status, and sexual practices. Hence Option 1 is correct.

To learn more about Oxytocin hormone, here

https://brainly.com/question/28166321

#SPJ4

what are the most common blood-borne pathogens

Answers

hepatitis b (HBV), human immunodeficiency virus (HIV), hepatitis c (HBV) are the three most common blood borne pathogens

Nadia used to run a lot, but her knees have been bothering her lately. She wants to purchase a piece of fitness equipment that will help her keep up her cardio endurance levels while not putting a lot of pressure on her knees and joints. What is the BEST purchase for Nadia to make? A. an adjustable plate-loaded barbell B. a nautilus machine C. a treadmill D. an elliptical trainer

Answers

Answer: c

Explanation:

The best purchase for Nadia, who wants to keep up her cardio endurance levels without putting a lot of pressure on her knees and joints, is the elliptical trainer that is in Option D.

What, exactly, is fitness equipment?

Low-impact exercise equipment that is gentle on the knees and joints is important to choose because it reduces the amount of stress on the joints, which is essential for individuals with knee problems, so elliptical trainers are an excellent choice for low-impact exercise because they mimic the motion of running without the impact of hitting the ground, and also because elliptical trainers allow users to adjust the intensity level, making them an excellent choice for individuals with knee problems.

Hence, to keep up her cardio endurance levels without putting a lot of pressure on her knees and joints, she should use the elliptical trainer that is in Option D.

Learn more about the fitness equipment here.

https://brainly.com/question/9328351

#SPJ2

Performing Breast Self-Exams
What should an individual look or feel for during a breast self-exam? Check all that apply.
lumps near the lower rib cage
dimples or bulges in the skin
irritation of the skin
changes in the size of breasts
changes in the position of breasts

Answers

Bumpy areas close to the rib cage (assuming this refers to lumps in the breast tissue), bulges or dimples on the skin, both changes in breast posture and changes in breast size.

What should a person look or feel like when performing a breast self-examination?

Looking forward, check for puckering, dimpling, or modifications to size, form, or symmetry. Verify whether your nipples are surrendered (inverted). Examine your breasts while placing your hands on your hips.

What should you feel when examining your breasts?

a change in your breast's size, shape, or outline. a modification in how your breast skin feels or looks, such as puckering, dimpling, a rash, or redness. new lump, enlargement.

To know more about breast posture visit:-

https://brainly.com/question/29538813

#SPJ4

1. What is homeostasis and what biological and chemical processes help to mainta
homeostasis? Describe, explain, and offer three examples of this process.

Answers

In biology, homeostasis is the state of steady internal, physical, and chemical conditions maintained by living systems. This is the condition of optimal functioning for the organism and includes many variables, such as body temperature and fluid balance, being kept within certain pre-set limits.

Homeostasis, as currently defined, is a self-regulating process by which biological systems maintain stability while adjusting to changing external conditions

Examples include thermoregulation, blood glucose regulation, baroreflex in blood pressure, calcium homeostasis, potassium homeostasis, and osmoregulation.

Explain why tetracycline would not help a person diagnosed with viral meningitis

Answers

Answer:

Tetracycline is an antibiotic that does not work on viruses.

Explanation:

Antimicrobials are compounds capable of disrupting microorganism growth for viruses, bacteria, and fungi.

Antibiotics are naturally-derived or man-made synthetic compounds that inhibit bacterial growth, these halt protein synthesis within the bacterial cell.  Tetracycline specifically affects bacterial metabolism by targeting tRNA molecules, carrying RNA macromolecules to 30s ribosome sites for further synthesis.

Meningitis is a form of inflammation of the meninges, the fluid, and membrane surrounding the spinal cord and brain. These result from several types of infections and may be caused by a range of microorganisms. Viral meningitis is sometimes treated with antiviral medicine.

What happens in the Circulatory system? Why is it important and what's its FUNCTION? Thank you to whoever helps!

Answers

Answer:

The circulatory system, also known as the cardiovascular system, is a complex network of organs and vessels that work together to transport blood, nutrients, and oxygen throughout the body. The main function of the circulatory system is to deliver oxygen and nutrients to the body's tissues and remove waste products from them.

The circulatory system consists of the heart, blood vessels (arteries, veins, and capillaries), and blood. The heart is the muscular organ that pumps blood throughout the body, and the blood vessels act as a network of pathways through which blood can travel. Arteries carry oxygenated blood away from the heart to the body's tissues, while veins carry deoxygenated blood back to the heart. Capillaries are small, thin-walled blood vessels that connect arteries and veins and allow for the exchange of nutrients and waste products between the blood and body tissues.

The circulatory system is essential for the proper functioning of the body because it ensures that all the body's tissues receive a constant supply of oxygen and nutrients needed for energy production and growth. It also plays a critical role in maintaining the body's internal balance or homeostasis by regulating body temperature, pH levels, and fluid balance.

In summary, the circulatory system is vital to the body's overall health and well-being. Its main function is to transport oxygen, nutrients, and waste products throughout the body and regulate the body's internal environment.

Explanation:

Give two reasons why a couple might experience marital distress and explain why that might cause marital distress.

Answers

Explanation:
There are Many Reasons why a couple might experience martial distress,
----------------------------------------------------------------------------------------------------------
1.  lack of financial resources
this is not uncommon, especially in the pandemic when the economies in many countries are deteriorating, It could be the husband, or the wife, it doesn't necessarily matter, but the reason this might cause distress between a couple is because when one person is financially ruined, the other person's expenses are increased, and they are forced to work harder, working harder builds up stress, stress leads to anger, anger leads to distress between couples.

2.   infertility
Infertility happens when the human body is unable to reproduce, should it be by disease, or some other cause, We get it, You would love to have a kid to continue your cherished name, but that is no reason to leave the woman/man you love to achieve that, despite this that is not the reality of society, adoption isn't always an option, it could be, "My religion doesn't allow adoption" or "I don't want to raise someone elses kid", Whatever it is, this can lead to a series of fights and form an unhealthy relationship, it can even cause divorce.

Accepting comments for questions about this.

- I wish not to be named, Criminal Defense Attorney-At-Law, PhD, Yale Graduate with Highest Honors.

Answer:

causes of marital distress include substance abuse, gambling, the loss of a child, children with special needs, lack of financial resources, infidelity, infertility, loss of employment, and untreated mental illness.

Explanation:

I gave more than 2 hope that is okay.

they ask you how you are, and you just have to say that you're fine, when you're not really fine, but you just can't get into it because they would never understand.

Answers

Answer:

true

Explanation:

i feel your pain

Answer:

That's right, it happends, a lot to me

Explanation:

Match the following vocabulary terms with their proper definition.

Question options:

Dynamic Stretching


Slow Twitch Muscle Fibers


Cardiorespiratory Endurance


Locomotion


Anaerobic


Aerobic


Resting Metabolism


Basal Metabolism


Calisthenics


Muscular Endurance


Agility


Biomechanics


Mnemonic


Pedagogy


Wellness


Static Stretching


Concentric


Non Locomotion


Fast Twitch Muscle Fibers


Physical Activity

1.
Term often used to describe moderate to vigorous physical activity that can be sustained for a long time.

2.
Slow movement exercises designed to lengthen the muscles.

3.
Ability to exercise your entire body for a long time without stopping.

4.
A term that is useful in remember specific information.

5.
Ability to use muscles many times without tiring.

6.
Ability to change body positions quickly.

7.
Exercises done using all or part of the body weight as resistance.

8.
Number of calories expended by your body for basic functions.

9.
Muscle fibers that contract at a slow rate.

10.
Movement of the body from place to place.

11.
Activity so intense that your body cannot supply adequate oxygen to sustain it for a long time.

12.
Stretch performed slowly as far as you can without pain, until you feel a sense of pulling.

13.
Branch of Kinesiology that uses principles of physics to help us understand the human body in motion.

14.
The art and science of teaching.

15.
Movement using the large muscles.

16.
Positive component of health that involves having a good quality of life.

17.
A shortening isotonic muscle contraction.

18.
The amount of energy your body uses to keep you living.

19.
Muscle fibers that contract quickly.

20.
Movement of the body while stationary.

Answers

1 Physical activity

2 Static stretching

3 Cardiorespiratory endurance

4 Mnemonic

5 Muscular endurance

6 Agility

7 Calisthenics

8 Resting metabolism

9 Slow twitch muscle fibers

10 Locomotion

11 Anaerobic

12 Dynamic stretching

13 Biomechanics

14 Pedagogy

15 Non locomotion

16 Wellness

17 Concentric

18 Basal metabolism

19 Fast twitch muscle fibers

20 Non locomotion

If this info was helpful a brainliest is much appreciated, goodluck! :)

57:03
What arrow in the figure points to the section that
indicates how much food is in the package/container?
acts
A
B
C
om Fat 20
D
aily Value
3%
7%
3%
19%

Answers

Answer:

d

Explanation:

19% there is enough fat there in the food container

13. Approximately every twenty eight days the female begins a new
cycle.
menstrual
endometrial

Answers

Answer:

Menstrual! I am a girl so I know

Explanation:

Answer:

menstrual

Explanation:

psychology!!!

Your psychology teacher likes to spend lots of time running and hiking because of how it makes him feel. He always feels better physically afterwards. Which perspective of psychology would explain this? How so?

Answers

Answer:

the perspective of psychology that would explain the teacher's behavior is the biological perspective. This perspective emphasizes the role of biological processes in behavior and mental processes. In this case, the teacher's physical activity is producing endorphins, which are natural chemicals in the brain that contribute to feelings of pleasure, euphoria, and well-being. These endorphins act as natural painkillers, reduce stress, and boost the immune system, which all contribute to the teacher feeling better physically. Thus, the biological perspective would explain how the teacher's physical activity affects his brain and body, leading to improved physical well-being.

Explanation:

Answer:

The perspective of psychology that would explain this is the biological perspective. This perspective focuses on the role of physiological and genetic factors in shaping human behavior and experiences.

In this case, the teacher's physical activity, such as running and hiking, releases endorphins and other "feel good" neurotransmitters in the brain, which can lead to a sense of well-being and improved mood. Additionally, regular physical activity has been shown to have numerous health benefits, including improved cardiovascular health, reduced stress levels, and better mental health.

The biological perspective would also consider genetic factors that may influence the teacher's response to physical activity. For example, certain genes have been linked to greater or lesser responsiveness to exercise, which can affect how physically active individuals feel after exercise.

Overall, the biological perspective would explain the teacher's positive physical and emotional response to running and hiking as being influenced by physiological and genetic factors, including the release of endorphins and other neurotransmitters, as well as the health benefits of regular exercise.

Why does my heart hurt sometimes

Answers

you could be depressed. or you’re heart could be breaking, metaphorically speaking. not sure if you mean it actually hurts or if you’re speaking metaphorically

Health disparities in the client care population are likely to occur when the health-care workforce lacks diversity in which areas?

Answers

Health disparities in the client care population are likely in the area of health care services which is when the healthcare workforce lacks diversity.

Health disparities are the differences in the quality of health and healthcare across ethnic, racial, and socio-economic groups. It can be taken as mass-specific differences in the presence of disease,   access to healthcare, or health outcomes, they are the difference in the heath care field which are not dependent on access-related factors, or clinical preferences.

Along with race, ethnic, and cultural differences, health disparities are also depended on choices, lifestyle, age, socioeconomic, and sexual orientation too.Those disparities are an important factor as they possess ethical and moral dilemmas.Healthcare is tied to many notions of socio-justice, quality of life, and opportunity for the patients, the communities, and the nation as a whole .

To know  more about health disparities  refer to the link https://brainly.com/question/3871640?referrer=searchResults.

#SPJ4

the losing team in a baseball game scored 2 runs

Answers

The inequality that represents the number of runs, r , that the winning team could have scored is B. R > 2.

What is the inequality about?

In order to win a baseball game, a team must score more runs than the other team. In this case, the losing team scored 2 runs. Therefore, the winning team must have scored more than 2 runs.

The inequality R > 2 represents all the possible values of R that are greater than 2. This includes all the integers greater than 2, as well as all the decimals and fractions greater than 2.

Find out more on inequality here: https://brainly.com/question/24372553

#SPJ1

Complete question:

The losing team in a baseball game scored 2 runs. Which inequality represents the number of runs, r , that the winning team could have scored? A. R?2 B. R>2 C. R<2 D. R=2

knowing the early signs of amyloidosis could save lives. shortness of breath and foot pain are some of the common symptoms.

Answers

Amyloidosis a rare illness, is brought on by the accumulation of the protein amyloid in organs. The organs may not function correctly as a result of the amyloid accumulation.

The digestive system, neurological system, liver, kidneys, spleen, heart, and kidneys are some of the organs that might be impacted.

Certain forms of amyloidosis co-occur with other illnesses. Treatment for the other illnesses may help these sorts. Life-threatening organ failure can result from some forms of amyloidosis. Among the warning signs and symptoms of amyloidosis are:

extreme weakness and exhaustionnumbness, tingling, or discomfort in the hands or feet Shortness of breathswelling in the legs and anklespossibly bloody or constipated diarrhoeaa larger tongue that occasionally has what appears like ripples on its margin.skin changes include thickening or bruising more easily

Learn more about amyloidosis here:

https://brainly.com/question/30056948

#SPJ4

The nurse is assessing a 7-year-old with a hearing aid. his mother says he is losing his hearing again. which finding would the nurse expect to make?

Answers

The nurse is assessing a 7-year-old with a hearing aid. His mother says he is losing his hearing again. The nurse would expect to make the finding related to the overproduction of cerumen.

Hearing aids can assist enhance hearing and speech, primarily for children with a type of hearing loss named nerve deafness (sensorineural hearing loss).

The hearing aids aim to help with the growth of your child's speech and language aptitudes along with their education.

The most familiar type of hearing aid for infants and children is anointed behind-the-ear (BTE) hearing aid because it sits behind the ear.

More about the hearing aids in children:

brainly.com/question/7895281

#SPJ4

What is “double jeopardy” as it relates to gender?

Answers

Double jeopardy refers to the suffering of women belonging to minorities. It is the discrimination women face due to their race as well as gender.

In terms of healthcare, it refers to the double discrimination elderly women from minorities face owing to their age as well as their race. It has been found that elderly women are delayed treatment compared to their white counterparts.  

Women have always suffered discrimination since older times and this is still being continued in many parts of the world.  

It has been observed that there is a higher rate of mortality in black women compared to the white elderly as well as the younger generation. According to the hypothesis, the reason for this is the discrimination they face owing to their age as well as race.

Learn more about double jeopardy in:

https://brainly.com/question/31646274

#SPJ1

i need to get toxic fr. HELPPPPPP

Answers

Answer:

If you’re a drama magnet, you need to learn how to stop being toxic by keeping the focus on yourself, and letting people live their own lives. 3. Get control of your jealousy. Some of my own most toxic behavior has been born out of jealousy. When your life isn’t what you want it to be, it’s tempting to look at other people who seem to ...

Explanation:

Conner is worried because his grades are slipping and his mother recently lost her job. Sometimes this can lead to depression. Which would be his best strategy for supporting his mental health?
A.
Get the help of a psychologist to explore why his grades might be slipping and strategies for managing the events in his life.
B.
Get the help of a psychiatrist to determine which prescribed drug would help him perform better at school.
C.
See a family physician for a checkup and determine if a course of medical treatment will help him.

Answers

Answer: A

Explanation: B is incorrect because psychiatrists are for people with long term genetic mental illnesses and a drug is not going to solve his problems. C is incorrect because physicians are medical doctors who treat physical illness. It’s A because psychologists are therapists for mostly short term mental problems

Get the help of a psychologist to explore why his grades might be slipping and strategies for managing the events in his life.

What is Depression?

Depression is a common but significant mood illness (sometimes known as major depressive disorder or clinical depression). It produces severe symptoms that interfere with your ability to function on a daily basis, including sleeping, eating, and working.

The signs of depression must last for at least two weeks before a diagnosis may be made.

Major depression is characterized by depressive symptoms that have persisted for at least two weeks and are typically disruptive to one's ability to work, sleep, study, and eat. Dysthymia, or persistent depressive disorder, is characterized by less severe depressive symptoms that persist for at least two years on average.

Therefore, Get the help of a psychologist to explore why his grades might be slipping and strategies for managing the events in his life.

To learn more about Psychologist, refer to the link:

https://brainly.com/question/3833605

#SPJ2

How do you know if someone's toxic? (I really really need to know this because my step-father SLAPPED me!)

Answers

Answer:

thats funny

Explanation:

Answer:

honey tht doesnt mean hes toxic it just means your bad, or if u aint do nun then tht just means hes crazy

Explanation:

alot of peoples step parents suck....i love my stepmom tho shes awesome sorry if u feel like im braggin

When a client provides a return demonstration of appropriate food selections for carbohydrates, which food does the nurse acknowledge as rich in carbohydrates?
milk
oatmeal
bread

Answers

When a client provides a return demonstration of appropriate food selections for carbohydrates, the nurse acknowledges that all three options - milk, oatmeal, and bread - are rich in carbohydrates.

Carbohydrates are one of the three macronutrients that provide energy to the body. They are found in many different types of foods, including grains, fruits, vegetables, and dairy products.

Milk is a good source of carbohydrates because it contains lactose, a type of sugar. Oatmeal is also a great option because it is a whole grain that contains complex carbohydrates, which provide sustained energy. Bread, particularly whole-grain bread, is another carbohydrate-rich food that can be included in a healthy diet.

It is important for individuals to choose a variety of carbohydrate-rich foods as part of a balanced diet. This can help ensure that they are getting all the necessary nutrients to support their overall health and well-being. The nurse may also provide guidance on portion sizes and timing of carbohydrate intake based on the individual's specific needs and health goals.

Learn more about Carbohydrates at https://brainly.com/question/336775

#SPJ11

People are weighed on the same scale each week over 3 months at a gym. Prior to weigh ins, they complete an excercise routine together and drink one bottle of water. what js a possible confounding factor in a diet study over 3 months?

Answers

A possible confounding factor in a diet study over 3 months could be the routine and water consumption prior to weigh-ins.

In a diet study where people are weighed on the same scale each week over 3 months, the goal is to observe the effects of dietary changes on weight. However, the introduction of an exercise routine and water consumption prior to weigh-ins can potentially confound the results.

Exercise can lead to temporary weight loss due to factors such as sweating and increased metabolism. Additionally, drinking a bottle of water before weighing can temporarily increase weight due to the added mass of the water.

These factors can mask the true effects of the diet on weight, making it difficult to differentiate between the impact of the diet and the temporary weight fluctuations caused by exercise and water consumption. Therefore, the exercise routine and water intake prior to weigh-ins serve as confounding factors that may influence the study results.

learn more about water here

https://brainly.com/question/19920929

#SPJ11

classify vegetables as related to the edible portions

Answers

Explanation:

Vegetables are the fresh edible portion of certain herbaceous plants - root, stem, leaves, fruit, seeds that are consumed by humans and other animals as food. These plant parts are either eaten fresh or prepared in number of ways, usually as a savory, rather than sweet dish.

Retention is how the brain encodes information. please select the best answer from the choices provided t f

Answers

Answer: False

Explanation:

Memory is defined as the process by which information is being stored, encoded and also retrieved. Encoding simply means the process by which information is transferred into the memory system.

Retention is simply refered to as the ability by which we keep information on our memory.

Therefore, the answer to the question is false.

An important part of memory function, which involves encoding and storing information in the brain, is retention.

When we are exposed to new knowledge our mind goes through a process which is retained for later use. During retention, sensory information is transformed by the brain into a format that can be stored and retrieved later.

Retention is a complex process that engages multiple neural mechanisms in the brain, including synaptic plasticity and the development of strong neural connections. The brain can create and strengthen pathways for these systems for information retrieval and storage.

So, the given statement is True.

Learn more about memory function, here:

https://brainly.com/question/2555641

#SPJ6

The breakdown of peptides into amino acids is an example of . The release of insulin after eating a large meal is an example of .

Answers

Answer:

1) positive feedback chain

2) negative feedback chain

Explanation:

How do you think new forms of technology will change the role and significance of the four major agents of socialization? Give examples.

Answers

New forms of technology will certainly change the role and significance of the four major agents of socialization. The four major agents of socialization include the family, education, peer groups, and mass media.

With technology making advances every day, it is likely that these agents will have to adapt and change to keep up with the times. For example, the role of the family might change as children have access to more information via the internet and social media. Parents may have to take a more active role in monitoring what their children are exposed to and helping them make sense of it all. Education will likely change as well, with more emphasis on technology and digital learning. This could lead to greater access to education for students in rural or remote areas. Peer groups may become more influential as social media allows individuals to connect with others who share their interests, regardless of geography. Finally, mass media will continue to be a powerful force, but with the advent of streaming services and personalized recommendations, people may be less influenced by traditional media sources.

To know more about socialization visit:

https://brainly.com/question/32757143

#SPJ11

Other Questions
Which of the following best describes John Proctor's feelings toward Abigail?A. guilt and romantic attachmentB. disdain and pityC. confusion and curiosityD. anger and spitefulness tan7A - tan4A - tan3A = tan7A*tan4A*tan3A please answer this honestly Describe the closing entries normally made by a merchandisingcompany. A project has an initial cost of $44067 and a three-year life. Better Car Insurance uses straight-line depreciation to a book value of zero over the life of the project. The projected net income from the project is $1627, $3532, and $1790 a year for the next three years, respectively. What is the average accounting return (AAR)?(Enter your answer in DECIMAL (not in percent). For example, if the result of your calculation is 1.23%, enter 0.0123)(Round your answer to the nearest thousands (upto three decimal places). i.e. if your answer is 1234.56789, enter 1234.568) Which is a run-on sentence?Craters of the Moon National Monument and Preserveis in Idaho, it is home to lava flows and cinder cones.In the wintertime, long icicles often hang from thegutters along our roof. Hi, I need the are to this question, I just need to show my work btw Some of these facts _______ incorrect.(1) is (2) are (3) has been (4) had been Which of the following traits evolved last (most recently) on the "one small step" phylogeny? A. digits B. eyes on top of a flat head C. strong armlike bones D. not enough information to tell define desertification Kelsey has a new baby brother! He weighs 8 lbs 3 oz. The doctor said the baby should gain about 5 ounces per week. At that rate, how much should the baby weigh-in 3 months (12 weeks)? Which of the following sentences from the article BEST develops the idea that ancient Egypt was an advanced civilization? A Despite the lack of natural resources like forests or an abundance of farm land, a great society emerged. B Over time, however, people learned that the Nile could provide plenty to eat. C Farmers began growing extra crops, allowing others to give up farming and pursue other trades. D They developed a calendar based on the flooding of the Nile that proved remarkably accurate. 1. Chelsea can paint a fence in 9 hours, and Greg can paint the same fence in 7 hours. How long does it take them to paint the fence if they work together? Round to the nearest tenth. 2. Tom left the mall and drove south. George left 2 hours later driving 36 mph faster to catch up with Tom. After 3 hours, he caught up with Tom. Find Toms average speed72 mph54 mph90 mph36 mph when you open a bottle of a soft drink and leave it open, the drink eventually goes flat. this happens because the equilibrium between carbonic acid (h2co3) and carbon dioxide (co2) shifts to produce 1. Use the DNA template below to make a complementary strand, as in DNA replication. Write the complementary bases above the bases given. Write the orientation of the new strand with respect to 5 and 3 . 3'TAATACAG C G CG CGAG C C C C CGGGATATCCTCA CAAATC 5' 2. In what direction is the new DNA strand replicated/synthesized? 3. In what direction is the template strand read by DNA polymerase? 4. Using the same DNA sequence, make a complimentary RNA strand, as in transcription. Write the RNA directly above the DNA strand. Write the orientation of the message with respect to 5 and 3 . 3'TAATACAGCGCGCGAGCCCCCGGGATATCCTCACAAATC5' 5. In what direction is the DNA strand read during transcription? 6. In what direction is mRNA strand synthesized by RNA polymerase? 7. What do you notice about the bases in the two strands you have written? 8. Use the codon table in your book to determine the order of amino acids that will be assembled based on the message (mRNA) your have transcribed. Use the three letter code to write the amino acids in the boxes. Remember that all proteins have methionine (met) as their first amino acid. No amino prior to that should appear. Indicate the N and C terminals. 3'TAATACAGCGCGCGAGCCCCCGGGATATCCTCACAAATC 5 9. How many amino acids form this small protein? 10. What is the full name of the seventh amino acid? 11. What effect is seen if the 3 end of the codon for the 9 th amino acid were changed from a G to an A ? 12. What effect is seen if the 3 end of the codon for the 8 th amino acid were changed from a U to a G? 13. What effect is seen if the 5 end of the codon for the 4 th amino acid were changed from a G to a U? The lateral position requires the use of _____ pillows heyyyyyyyyyyyyyyyyyyyyyyy Thato has 1 1/4gallons of water. He and his friends drink 3/8of it while hiking. What part of a gallon of water do they drink?Enter the fraction below. Air flows steadily at the rate of 0.5Kg/s through an air compressor, entering at 7 m/s velocity, 100 KPa pressure and 0.95 m3 /Kg volume and leaning at 5m/s, 700 KPa and 0.19m3 /Kg. the internal energy of the air leaving is 90 KJ/Kg greater than that of the air entering. Cooling water in the compressor jackets absorbs heat from the air at the rate of 58 KW (i) compute the rate of shaft work input to the air in KW. (ii) Find the ratio of the inlet pipe diameter to the outlet pipe diameter. a nurse is preparing to administer a unit of packed red blood cells. the patient has an iv of d5ns infusing. what iv solution should the nurse use to infuse the unit of packed rbcs?