12. Removing an organism from an ecosystem will have which of the following affects? Select all that apply.
A. Increase in biodiversity
B. Decrease in biodiversity
C. Increase in the overall health of the ecosystem
D. Decrease in the overall health of the ecosystem​

12. Removing An Organism From An Ecosystem Will Have Which Of The Following Affects? Select All That

Answers

Answer 1

Answer:

B and D

Explanation:

Biodiversity comes from having multiple types of organisms. This also allows different organisms to eat and create nutrients that is needed by all other organisms in the ecosystem.


Related Questions

are orchids a monocot or dicot? Why?

Answers

Answer:

I think the answer is Orchids are monocots, one of the two groups into which botanists divide flowering plants. Monocots have a single cotyledon (Greek for seed leaf) present in their seeds; as opposed to dicots, which have two cotyledons in each seed. In monocots, the cotyledon is part of the plant's embryonic structure.

Explanation:

I hope this helps. Have a great day!

new chromosomes remain attached to cell membrane

Answers

Answer:

Question

Answered step-by-step

Replication in Living Cells Prokaryotes Eukaryotes Both 1. New chromosomes remain attached to cell membrane 2. Proteins check for errors 3. Starts at one place 4. Procee…

Replication in Living Cells Prokaryotes Eukaryotes Both 1. New chromosomes remain attached to cell membrane 2. Proteins check for errors 3. Starts at one place 4. Proceeds in two directions 5. Copies of DNA condense into chromosomes that separate 6. Starts at many places

Video Answer:

Solved by verified expert

preview

This problem has been solved!.

Try Numerade free for 7 days

Watch Video Walkthrough

Best Match Question:

Replication in Living Cells Prokaryotes Eukaryotes Both 1. New chromosomes remain attached to cell membrane 2. Proteins check for errors 3. Starts at one place 4. Proceeds in two directions 5. Copies of DNA condense into chromosomes that separate 6. Starts at many places

Recommended Videos

04:15

In what ways does chromosomal DNA replication in eukaryotes differ from DNA replication in prokaryotes?

04:58

Questions

Choose from the terms below.

(A) Translation

(B) Transcription

(C) Replication

(D) RNA processing

(E) None of the …

03:26

Link each cell phase to the event that occurs within it.

1. Each of the chromosomes in a human cell

contains two sister chromatids by the en…

03:14

Match the stages of mitosis with the events they encompass: Stages: (1) anaphase, (2) metaphase, (3) prophase, (4) telophase. Events:

(a) re-f…

Transcript

Hello. So let's answer another question. Okay. For number one when you chromosomes remain attached to the cell membrane, it happens both and procreate tick and eukaryotic cell for number two. Okay. Um For # two XS here that proteins check for errors. So this checking of proteins happens in both crockery attic and eukaryotic cells are answer for number two is we have both. Okay. Next starts at one place. It happens in pro carry remotes. So replication and Procardia originate from only one place. While eukaryotes replication can occur from multiple positions. Next for number four it says it says here it proceeds in two directions. So our answer here is we have pro carry oats. So replication in prokaryotes is bi directional in advances into direction Again for number five copies of DNA condensed into chromosome that separates our answer here is we have both. So DNA condenses in the nuclear oid uh and later gets separated. That's in the uh and also in eukaryotes. Then the DNA condenses inside the nucleus. Okay, so this is our answer and for the last one, Number six starts at many places I've mentioned it earlier. It happens only in eukaryotes. Okay, so this is the answer.

Use of which of the following will result in the control of insects pests in turf?

Answers

There are several methods that can be used to control insect pests on turf, including cultural, biological, chemical, and physical control methods. The most effective method will depend on the specific pest species and the extent of the infestation.

Cultural control methods involve modifying the turf environment to make it less hospitable to pests, such as improving soil quality, reducing thatch buildup, and properly irrigating and mowing the turf. Biological control methods use natural enemies of the pests, such as predators, parasites, and pathogens, to reduce their populations.

Chemical control methods involve the use of pesticides to kill or repel pests. Still, their use should be minimized as they can negatively impact the environment and non-target organisms. Physical control methods involve removing or excluding pests, such as traps or barriers.

To know more about Cultural control:

https://brainly.com/question/16984615

#SPJ1

How does fossils record help scientists observe changes in organism over time ?

Answers

As the world changes, plants and animals change with it. Aside from a few living fossils, the species we see today are very different from species that lived in the past.

What is the minimum age of a fossil?

A living being that lived more than 11 thousand years ago is considered a fossil, that is, before the Holocene, which is the current geological epoch.

Ancient remains or evidence, but less than 11,000 years old, such as sambaquis, are classified as subfossils.

The dating of a fossil can be done based on the already known percentage of Carbon-14 (C14) in relation to Carbon-12 (C12) of living matter (without decomposition).

Thus, the fossil record can be used to show that organisms changed to meet new conditions.

See more about fossil age at:

brainly.com/question/2495177

#SPJ1

Hank has a very detailed model of the solar system where each planet is made out of granite rock. Since his little sister really liked the model, he spent two weeks in his dad's workshop building her a Styrofoam copy. When he picked up the models to take them back inside the house, which physical property would he immediately notice upon picking them up?
A.
conductivity
B.
color
C.
density
D.
ductility











Hank has a very detailed model of the solar system where each planet is made out of granite rock. Since his little sister really liked the model, he spent two weeks in his dad's workshop building her a Styrofoam copy. When he picked up the models to take them back inside the house, which physical property would he immediately notice upon picking them up?
A.
conductivity
B.
color
C.
density
D.
ductility

Answers

Density

Reasoning:
Styrofoam doesn't have as much density as granite.

Which statement gives an advantage for a single-celled organism?

Answers

It can reproduce quickly. Single-celled organisms are smaller in size.

5. Which happens last in the process of photosynthesis?
The plant captures the sun's energy
Oxygen exits the leaf.
Water is taken up by the plant's roots.
O Carbon dioxide enters the leaf.

Answers

Answer:

Oxygen exits the leaf

Explanation:

Photosynthesis is the process whereby green plants and other certain organisms manufacture their own food using sunlight as an energy source. The photosynthetic process makes use of carbon dioxide and water to produce glucose (sugar) and oxygen.

Water and carbon dioxide must first be taken in by the plants from the soil and atmosphere respectively in order to perform the process. Glucose is produced as the main product while oxygen is produced last as a waste product of the process. Hence, the EXIT OF OXYGEN FROM THE LEAF is the last thing that occurs in photosynthesis.

Which two sentences describe what scientists have discovered about red algae and sponges ?

Which two sentences describe what scientists have discovered about red algae and sponges ?

Answers

The two sentences that describe what scientists have discovered about red algae and sponges are:

B. Biomarker evidence of sponges has been found in rocks that date back to the great oxidation event, while evidence of red algae appeared long after the event.

D. The earliest fossil evidence of multicellular life is of red algae, while the earliest fossils of sponges, also multicellular, appeared much later.

Scientists have discovered biomarker evidence of sponges in rocks that date back to the great oxidation event, while the earliest fossil evidence of multicellular life is red algae.

Hence options B and D are correct.

To learn more about red algae:

https://brainly.com/question/4289110

#SPJ1

Which represents the greatest time frame in which a short-term environmental change can occur?

in days
in minutes
over hundreds of years
over thousands of years

Answers

Answer:

Over hundreds of years

Explanation:

Environmental changes occur as a result of human action and natural processes. These changes leads to the disruption in the normal environmental processes. Examples of human actions include release of pollutants into the atmosphere, overcrowding and destroy of plants and animals habitats etc while the natural causes include earthquakes and the end results include climate changes.

The greatest time frame in which a short-term environmental change can occur is over hundred of years as environmental changes are normally known to occur after several thousands and millions of years.

Answer:

over hundreds of years

Explanation:

Below is a DNA template strand that serves as a gene used to create a specific protein. The DNA template is read from LEFT to RIGHT. Please determine the sequence of amino acids for the protein that is produced using this sequence of DNA.
AAATAAGTCGGTCACCTAGTC

Answers

To determine the sequence of amino acids for the protein produced using the given DNA template strand, we need to first transcribe the DNA into messenger RNA (mRNA), and then translate the mRNA into the sequence of amino acids using the genetic code.

Transcription involves copying the DNA template into a complementary sequence of mRNA, where thymine (T) is replaced by uracil (U). So, the mRNA sequence for the given DNA template strand would be:

UUAUUAGACCGAGUGGAUCAG

Using the genetic code, we can then translate the mRNA sequence into the sequence of amino acids that make up the protein. Each codon (a sequence of three nucleotides) in the mRNA sequence codes for a specific amino acid, as specified by the genetic code. The sequence of amino acids corresponding to the mRNA sequence would be:

Phenylalanine - Asparagine - Aspartic acid - Arginine - Valine - Serine

So, the sequence of amino acids for the protein that is produced using the given DNA template strand would be:

Phenylalanine - Asparagine - Aspartic acid - Arginine - Valine - Serine.

To know more about amino acids:

https://brainly.com/question/31442968

#SPJ1

Which of the following hormones increases the heart rate in response to stress?
a. Glutamate
b. Epinephrine
c. Testosterone
d. Insulin

Answers

Answer:

Epinephrine is another name for Adrenaline

Explanation:

Adrenaline is a hormone that increases your heart rate in response to stress.

A 2019 study published in Nature Ecology & Evolution looked at data from
more than 1,500 species of birds, mammals, and fish in order to determine
whether their rate of evolutionary change was linked to species survival.
The study found that while some species did evolve faster than others,
there was no clear relationship between evolutionary rate and survival.
Instead, the study suggests that previous species success predicts species
survival much more accurately than speed of adaptation does.
Which finding, if true, would most directly support the underlined claim?
Choose 1 answer:
Endangered and extinct species displayed a significantly slower
evolutionary rate than other species.
Evolutionary rate only impacted species survival when adaptations
were linked to environmental pressures.
Successful species tended to remain more successful than more
quickly-evolving competitors.
Invasive species that overtook competitors tended to exhibit a
higher evolutionary rate than other species.

Answers

Successful species tended to remain more successful than more quickly-evolving competitors. -


Final answer:

The finding that successful species were often more successful than faster-evolving competitors would most directly support the claim that previous species success, not evolution rate, is the most accurate predictor of survival.

Explanation:

The finding that would most directly support the underlined claim—that previous species success predicts species survival much more accurately than speed of adaptation—would be the one stating that 'Successful species tended to remain more successful than more quickly-evolving competitors'. This statement gives direct evidence to the fact that the success of a species in the past is a good predictor of its future survival, regardless of how fast it may be evolving.

This is not to say that the evolution rate isn't important at all. It's just that, according to the 2019 study published in Nature Ecology & Evolution cited in the question, the connection isn't clear or strong enough to be considered a reliable predictor of species survival.

Learn more about Species Survival here:

https://brainly.com/question/31856905

#SPJ2

If the [H+] = 10-5 M for an aqueous solution, the pH of the solution is? Is the solution
acidic or basic (alkaline)?

Answers

If the [H⁺] = 10⁻⁵ M for an aqueous solution , the pH of the solution is 5 . the solution is acidic in nature.

The pH formula is given by :

pH = -log [H⁺]

[H⁺] =  10⁻⁵

putting the value of [H⁺] in the formula we get :

pH = - log [10⁻⁵]

 pH    = 5

The range of pH scale is from 0 to 14 . pH value 7 is neutral and less than 7 is acidic in nature and greater than is basic in nature.

here, the pH value is less than 7 so, the solution is acidic in nature.

Thus, If the [H⁺] = 10⁻⁵ M for an aqueous solution , the pH of the solution is 5 . the solution is acidic in nature.

To know more about pH of solution here

https://brainly.com/question/28580519

#SPJ1

Hummingbirds share a mutualistic relationship with the flowers they feed on. Which of
these statements about the relationship between the flower and the hummingbird is true?

Answers

Answer:

yes

Explanation:

List three functions of ovaries
pls fast I'll mark as brainliest!​

Answers

Answer:

Three functions of ovaries are listed below:

1. Oocytes (the female gamete) need to be protected and given refuge by the ovaries in order to be fertilised.

2. To create the hormones relaxin, inhibin, oestrogen, and progesterone.

3. Ovulation, the process by which each menstrual cycle results in the release of one egg.

To learn more about functions of ovaries visit https://brainly.com/question/957208?referrer=searchResults

Explanation:

a population of 5,000 mice has 400 dominant alleles and 3,600 recessive alleles. what is the frequency of dominant alleles in the population?

Answers

According to Hardy−Weinberg equilibrium, the frequency of dominant alleles in the population is 0.08.

The Hardy-Weinberg Equilibrium (HWE), a key tenet in population genetics, says that "genotype frequencies in a population stay constant across generations in the absence of perturbation by outside forces."

It is easy to enter these numbers into the Hardy-Weinberg equation (p2 + 2pq + q2 = 1) once p and q are known. The expected frequencies of each genotype for the chosen characteristic within the population are then provided by this.

To learn more about Hardy−Weinberg equilibrium click here,

https://brainly.com/question/16823644

#SPJ4

How can poor nutrition affect individual cell functions?

Answers

Answer:

Nutritional imbalance is a major challenge for living organisms to achieve systemic homeostasis and maintain normal physiology. Mammals have developed processes to control systemic nutrient utilization and storage. For example, excess nutrients are converted and stored in adipose tissue, liver, and muscle during times when nutrients are abundant. By contrast, stored nutrients are metabolized to provide energy and building blocks to maintain vital physiological processes when nutrient availability is low.

From these processes, adipose tissue volume changes in response to under- or overnutrition. This change in adipose tissue volume, in turn, influences the secretion of hormones and cytokines from adipose tissue (adipocytokines). Many of these adipocytokines have important immune signaling functions which can influence immune cell biology and alter the immune response.

Drag each label to the correct location on the map.


Identify the types of precipitation on the map. The color scale gives the rainfall amounts in inches.

Answers

The given question is incomplete as it lacks the map which is important, however the correct answer is attached:

Answer:

The correct answer is -

Top box (green area) - moderate rain,

Middle box (sky blue area) - light rain, and

Bottom box (red area) - heavy rain.

Explanation:

As per the map and the scale presented on the map that indicates the rainfall in inches. The green area indicates that the rain fall in this area is one inch which is moderate as the the sky blue rainfall measurement is .5 inches which is half. However, the red area is the highest rainfall area in comparison to both of these which is about four inches.

On the basis of these it we can label all three boxes as per their rainfall amount that is,

Top box (green area) - moderate rain,

Middle box (sky blue area) - light rain, and

Bottom box (red area) - heavy rain.

Drag each label to the correct location on the map.Identify the types of precipitation on the map. The

Answer:

The person above is correct

Explanation:

i took the test and got it right. btw tysm for the help i really appreciate it!

What is different about dynamic stretching when compared to other styles of stretching?

What is different about dynamic stretching when compared to other styles of stretching?

Answers

The differemce about dynamic stretch when compared to other styles of stretching is that they are performed for multiple sets and repetitions.

Spinal cord is blank to the esophagus

Answers

Answer:

posterior

Explanation:

Part D Consider the results of each solution. Did any one solution work best? Could you combine or modify the solutions to develop a better method for removing the oil from the water?​

Answers

No one solution worked best for removing oil from water. It is possible to combine or modify the solutions in order to develop a better method for removing the oil from the water, such as using a combination of physical, chemical, and biological methods in order to remove more of the oil from the water. Additionally, the effectiveness of the chosen method will depend on the type of oil, the specific contaminants present, and the environmental conditions of the water.

what are the organisms of eubacteria​

Answers

Answer:

Eubacteria are typically classified into five different phylums: Chlamydias, Cyanobacteria (Blue-green algae), Gram-positive bacteria, Proteobacteria, and Spirochetes. Chlamydias are often parasitic bacteria. Cyanobacteria are most commonly known to be aquatic and obtain energy via photosynthesis.

Explanation:

hope it was helpful

As the human population increases, how do people use land differently? A. Grasslands are used for cropland. B. Developed land is converted to wetlands. C. More land is available for animal habitats. D. Urban land becomes cropland.​

Answers

Answer:

A

Explanation:

The others don't make sense, and are the opposite of what would happen if human population increased.

As the human population increases, people tend to use land differently in various ways. One of the ways is by converting grasslands into cropland to meet the increasing demand for food. The correct option is A.

What are the different uses of land?

The conversion of grasslands into croplands results in the loss of natural habitats and biodiversity. Additionally, some developed land is being converted into wetlands to mitigate the negative impacts of urbanization on the environment.

However, this process is slow and limited due to the cost and complexity involved. Another way is by setting aside more land for animal habitats, which helps to protect endangered species and maintain ecological balance.

Lastly, as urbanization continues, there is a trend towards urban agriculture, where urban land is converted into cropland to support local food production and reduce transportation costs.

Therefore, the correct option is A.

Learn more about Land uses here:

https://brainly.com/question/5831440

#SPJ5

please help me in this question thank yoy

please help me in this question thank yoy

Answers

C would be the correct answer

It is a statement of judgment of a person about something in the world.

Answers

Answer:

heres your answer :)

Explanation:

Declarative Statements are the kind of statements which expresses someone's belief, view, or judgment about something/someone.

Drag each tile to the correct box.
Arrange the steps of extraction of DNA in the order in which theyshould be performed:

1. pour off the ethanol

2. dissolve the precipitate in buffer or water

3. blend the sample

4. add protease or sodium acetate

5. add the detergent

6. add ethanol

7. centrifuge the sample

Answers

Liquefaction, separation, precipitation, and purification are the four steps in order for extracting DNA. The process of lysis releases DNA-containing cells.

How is ethanol taken out of a DNA sample?

In light of all these factors, we have discovered a straightforward method to eliminate ethanol by performing a DNA denaturation and renaturation operation. The procedure involves heating the DNA solution for a brief period of time at 80 C.

Why do we extract DNA with ethanol?

The primary function of monovalent cations and ethanol is to dissolve the DNA's solvation shell, allowing the DNA to precipitate as a pellet. Moreover, ethanol encourages DNA aggregate formation. The amount of ethanol solution utilized during the DNA washing procedures is typically around 70%.

To know more about DNA visit :-

https://brainly.com/question/264225

#SPJ1

how does the structure of a carbohydrate allow it to perform its function?​

Answers

Answer:

Carbohydrates are organic molecules ONLY composed of carbon, hydrogen, and oxygen molecules. So, their structure would be just covalent bonds between the three elements, and most likely non-polar. They give out a lot of energy, and carbohydrates are also known as sugars. Most foods have them.

Branliest plzzzz?

29. Brain has one son, two grandchildren, and three great-grandchildren. This is example of
O exponential growth.
Odynamic growth.
O linear growth.
Obinary growth.

Answers

This is an example of exponential growth.

Exponential growth refers to a pattern of growth where the quantity or size of something increases at an accelerating rate over time.

In the given scenario, Brain has one son, two grandchildren, and three great-grandchildren.

Each generation is producing more offspring, resulting in a rapidly increasing number of descendants.

The progression from one generation to the next demonstrates exponential growth because each subsequent generation adds more individuals than the previous one.

As the generations continue, the number of descendants grows exponentially larger.

Exponential growth can be observed in various natural and human-made systems, such as population growth, compound interest, and the spread of infectious diseases.

In this case, the number of descendants in Brain's family tree follows an exponential pattern, as each new generation multiplies the number of offspring, leading to a significant growth rate.

Therefore, the example given aligns with the concept of exponential growth.

For more answers on exponential growth

https://brainly.com/question/13223520

#SPJ8

Pour each bag of candy into a separate container or dish so you can see all the colors in each bag. Assign a letter to each color of chocolate candies and fruit candies, and record your key.
For example, red=R, purple=P


Without looking, randomly choose nine candies from each container one at a time. Using the letter symbols, record each candy as it is removed. Record your results using the following table. Example, R for red, Bl for blue, and so on.




Color

Color

Color

Color

Color

Color

Color

Color

Color
Number of different colors in total for this trial
Fruit Candy Trial 1




















Fruit Candy Trial 2




















Fruit Candy Trial 3




















Chocolate Candy Trial 1




















Chocolate Candy Trial 2




















Chocolate Candy Trial 3






















Count the number of species in each sample. Each color represents a different plant in the habitat.

Example: R, Bl, G, G, Y, Y, G, Bl, Bl has 4 species of plants (R, Bl, G, and Y).
You will then be dividing the # of different species (which is the # of different colors) in the next step.

Calculate the diversity index of both the bag of chocolate candies and fruit candies using the following formula for each trial.


Diversity Index = # of species
# of samples

Example:
R, Bl, G, G, Y, Y, G, Bl, Bl is 4/9 = 0.44
The # of species is 4 because there are 4 different colors.

Put the diversity index for each of the 6 trials in this table. This will always be a number less than 1, but more than zero.
Calculate the average from the three trials.
Diversity Index Table

Sample
Trial 1
Trial 2
Trial 3
Average
Fruit








Chocolate










Analysis (Make sure you scroll down to see all 7 questions.)
How did the diversity index values vary from the chocolate candies and fruit candies? Which habitat is the most diverse?


Why are communities that are more diverse usually more stable? Include resistance to disease and predation in your answer.


Assume two habitats have the same number of species. One habitat is predominantly one species with just a few of the other species. The other habitat has equal numbers of all the different species. Which will have the highest diversity index?

Why do you think the process was repeated three times?


There are many human-caused losses of biodiversity, such as habitat destruction and introduction of invasive species. Are there any natural events that could alter the diversity index?


How do invasive species change the diversity index?


What do you think would happen to a habitat if the plant diversity declines?


please help fast!!!!
thank you

Answers

Invasive species can potentially change the diversity index in a number of ways. They may come to an area where they have no natural predators, leading to overpopulation and rapid consumption of ecosystem resources.

Invasive species are capable of causing extinctions of native plants and animals, reducing biodiversity, competing with native organisms for limited resources, and altering habitats.

The impacts of alien invasive species at the ecosystem level include changes to trophic structures, changes in the availability of resources such as water and nutrients, and changes in the disturbance regimes.

Learn more about invasive species:

https://brainly.com/question/21452505

#SPJ1

SBI3C Culminating Task Part A (True or False) 10 marks Answer each question "true" or "false" 1. Polymers are made up from monomers /50 2. Both animal cells and plant cells have cell walls and cell membranes 3. Osmosis is the movement of a solution (ex. water) across a non-permeable membrane 4. Gregor Mendel is known as the father of genetics due to his studies using pea plants (pods). 5. In a strand of DNA, "G" always pairs with "C" and "A" always pairs with "T" 6. Meiosis is important for the reproductive process in humans 7. Bacteria can be harmful, but some types of bacteria can be helpful_ 8. Inflammation and fever are part of your body's defense system against infection 9. You have more white blood cells than red blood cells 10. The heart pumps "oxygenated" blood to the lungs through the pulmonary system​

Answers

Answer:

1= yes
2= no
3=no
4=yes
5= unsure
6= yes
7=yes
8=yes
9= no
10=yes

Explanation:

Other Questions
Question 3 of 10The probability of rolling a 6 on a number cube is . If you were to roll thecube 60 times, you would expect to get a 6 around 10 times (6 - 60 = 10)..You simulate 60 rolls. How many 6s would make you question your model?O A. 10O B. 14O C. 20O D. 6 to change the direction of text you click on the text direction control on the ______ tab. To which character in Seedfolks does Paul Fleischman assign the most personal perspective on gardening?KimWendellAnaGonzalo A sample of He at 25C and 755 torr occupies a fixed volume of 16.8L. What mass of He must be pumped in to increase the pressure to 1.87 atm if the temperature remains the same? Order -2/3, -4/5, 8/15 and 3/5 from least to greatest which company used techniques such as a profit distribution system, fixing retail prices, and endorsements and licensing connections to establish itself as an industry standard? How do people of Cordillera Mindoro use their music?. Consumer surplus will _____ when a monopolist goes from single-price monopoly to perfect price discrimination. Remain the same increase decrease initially increase and then return to its original level. Which state below is NOT true about black holes?They have the strongest force of gravity in the universe.At their cores, the laws of physics still apply.They give off no light radiation.They are points or areas in space. which of the following correctly describes the glucose-alanine cycle? What are the real or imaginary solutions of each polynomial equation?b. x = 8x - 2x . My favorite book which was written by Beverly clearly is Roman the pest What is the relative pronoun How do I solve this 625=1/2(8)(x)^2 ? you want to have $1 million in real dollars in an account when you retire in 30 years. the nominal return on your investment is 9 percent and the inflation rate is 4 percent. what real amount must you deposit each year to achieve your goal? (do not round intermediate calculations and round your answer to 2 decimal places, e.g., 32.16.) Be sure to answer all parts. Show the overall reaction for formation of racemic 3bromohexane from (E)3hexene by entering the structures of the products and reactants in the template provided. Part 1 out of 3 draw structure ... arr draw structure ... + draw structure ... (E)3hexene (S)3bromohexane (R)3bromohexane Racemic product = 50% (S) and 50% (R) as shown in the figure below, two long parallel wires (1 and 2) carry currents of i1 = 3.22 a and i2 = 4.80 a in the direction indicated. the change of population abundance (size. is a function of mortality, recruitment, population size and: group of answer choices disease food in/out movements fitness Question, what do yall like gaming better with, Contoller, touch screen, or keyboard and mouse? I like gaming with a contoller better, and when the game has a built in ch at like among us, pubg etc. i use the keyboard to type. Explain how Mendel's law of segregation is simulated in the lab. in what ways did napoleon's support of revolutionary ideals contrast with other actions that he took?